KR20130134887A - Composition for promoting the hair growth comprising extracts of spirodela polyrhiza - Google Patents

Abstract

The present invention relates to a composition for promoting the hair growth, specifically the composition for promoting the hair growth which contains a Spirodelapolyrhiza extract activating the signal transmission of Wnt/β-catenin as an active component. [Reference numerals] (AA) Diluting medicine;(BB) Control medicine;(CC) Test medicine 1;(DD) Test medicine 2

Description

Composition for promoting the hair growth comprising extracts of Spirodela polyrhiza}

The present invention relates to a composition for promoting hair growth, and specifically, Bupyeongcho, which activates signaling of Wnt / β-catenin ( Spirodela) Polyrhiza ) relates to a composition for promoting hair growth comprising the extract as an active ingredient.

Hair is an important part of the growing interest in beauty as the times change. Hair is a thin, keratinized structure produced on the surface of the skin. This protects the body from external stimuli such as direct sunlight, cold, friction, and danger, and releases heavy metals such as arsenic, mercury, and zinc, which are harmful to the body. The side is also highlighted. However, more people are complaining of hair loss due to various causes, including changes in diet and increased internal and external stress.

Human hair is about 100,000-150,000 pieces, and each hair has a different growth cycle. The hair growth cycle consists of three stages: the anagen stage in which hair is most actively growing, the catagen stage in which hair degeneration begins, and the telogen stage in which hair growth stops or enters rest. Classified as In general, alopecia refers to an increase in the number of abnormal hair loss due to shortening of hair growth rate in the growing period and increased number of hair in the retrogressive or resting period among these cycles.

Male hormone plays an important role in hair follicle killing and dropping. Among the factors expressed in male hair follicles by male hormone, DKK-1 (Dickkopf-1) plays an important role in inhibiting hair follicle growth and death (J Investig. Dermatol., 2008: 128 (2): 262-9). On the other hand, hair growth and activation of stem cells are required for periodic hair growth, which is known to be caused by the generation and activation of Wnt / β-catenin (Nature. 2007: 447 (7142): 316-20). In addition, the above-mentioned DKK-1 is known as an antagonist of Wnt / β-catenin, it can be seen that the signaling system is very important in regulating hair growth. Currently, the products used for the treatment and prevention of hair loss include hair regrowth and hair loss prevention / hair wool agent. Hair regrowth is a medicine that raises hair in the area of hair loss, and hair loss prevention / wool hair nourishes the scalp and hair to make hair thick and healthy. Its purpose is to prevent it from falling out, so it distinguishes between its use and effect.

Bupyeongcho polyrhiza ) is an annual herb floating on water, commonly called frog rice. It has 2 ~ 5 egg-shaped leaves attached and its lower side has eggplant color and 5 ~ 11 thin roots. It grows in rice fields, swamps and reservoirs all over the country, harvests outcrops in summer and autumn, washes in clear water, and spreads thinly in the shade to dry. Bupyeongcho is composed of inorganic substances such as iodine, bromine, calcium acetate and calcium chloride, but the active ingredient of Bupyeongcho is not known exactly and Spirodela 47 flavonoids have been identified in plants of the genus Spirodela , such as polyrhiza ).

Decoction decoction by washing with Bupyeong-cho flowing water and heat was found to have a blood pressure lowering effect and a cardiac effect as a result of animal experiments. Attach the leaf to the snake bite and use it for alum, tumors, etc.

Patents related to Bupyeongcho extract include a composition containing Bupyeongcho extract (Korean Patent No. 10-0572003) and a natural composition (All Korean Patent No. 10-2004-0065498) having an allergic dermatitis and skin itching effect. However, the patent does not describe hair growth or hair growth promotion to rejuvenate hair for the purpose of alleviating acne, hair loss and itching by inhibiting the activity of 5 alpha-reductase.

In addition, preparations for the treatment or prevention of alopecia developed to date include formulations mainly composed of female hormones for promoting blood circulation, strengthening of hair root function, scalp moisturization and male hormone suppression, minoxidil, finastide, and tree. Although there are preparations containing cosaccharides (trichosaccharide), it is known that there is a high possibility of causing side effects such as sexual dysfunction, birth defects, systemic hair growth.

Accordingly, the present inventors can improve the problems such as side effects or precautions for use of conventional hair loss treatments, and can safely act on the hair growth or hair growth promotion while being safe for the human body without the disadvantages of hair loss prevention / hair growth promotion. As a result of intensive efforts to develop the composition, it was confirmed that the Bupyeongcho extract has an effect of promoting hair growth and completed the present invention.

It is an object of the present invention to provide a composition for promoting hair growth comprising an extract of Bupyeongcho as an active ingredient.

As one embodiment for achieving the above object, the present invention provides a composition for promoting hair growth comprising a Bupyeongcho extract as an active ingredient.

The term used in the present invention, ' Bupyeongcho ( Spirodela polyrhiza ) 'belongs to the Lemnaceae family and refers to a plant called duckweed grass. Remna polril hija (lemna polyrrhiza ). Bupyeongcho has long been used for colds, measles rashes, hives, and skin itching because of its ability to lower heat and release sweat. It is also known to be used when systemic edema and urine volume is low due to diuretics. In the present invention, Bupyeongcho can be purchased commercially, or may be used collected or cultivated in nature.

The method for preparing the Bupyeongcho extract may be used in the conventional extraction methods in the art, such as ultrasonic extraction, filtration and reflux extraction. Preferably, the dried Bupyeongcho obtained by pulverizing the Bupyeongcho from which foreign matters are removed by washing and drying may be an extract extracted with water, an alcohol having 1 to 6 carbon atoms or a mixed solvent thereof, and more preferably having 1 to 6 carbon atoms. It may be an extract extracted with alcohol, most preferably may be an extract extracted with ethanol. At this time, the extraction solvent is preferably 2 to 20 times the dry weight of Bupyeongcho. In the present invention, the extract is to include an extract obtained by the extraction treatment, a dilution or concentrate of the extract, a dried product obtained by drying the extract, or any one of these modifiers or purified products.

The Bupyeongcho extract may be prepared as follows.

Bupyeongcho extract of the present invention comprises the steps of a) pulverizing, powdering the purified Bupyeongcho root; b) extracting pulverized and powdered Bupyeongcho root by extracting the extract with cold solvent at room temperature; c) filtering the extraction stock solution; d) concentrating the filtered extraction stock solution; e) can be prepared by re-dissolving the concentrated extract stock with a solvent.

Spirodela polyrhiza ) extract can be extracted from various organs of natural, hybrid, and mutant plants, for example, from various organs of natural, hybrid, and variegated plants, for example roots, ground, stems, leaves, flowers. It can be extracted from the trunk of the fruit, the skin of the fruit, as well as from plant tissue cultures.

The Bupyeongcho extract may preferably be included in an amount of 0.01 wt% to 10 wt% based on the total weight of the composition.

In the present invention, the term "hair" refers to the hair of the body, and has a thread-shaped form composed of keratin proteins. The hair may preferably be hair, eyebrows, eyelashes, nose hair or body hair, but is not limited thereto.

As used herein, the term "hair growth" refers to the formation of individual hairs by rapidly differentiating the cells to push other cells out of the hair follicle. Hair growth of the present invention does not prevent falling of existing hair, but rather promotes hair production and growth. Preferably the hair growth may be carried out by promoting Wnt / β-catenin signaling, more preferably, the promotion of Wnt / β-catenin signaling is carried out by the inhibition of DKK-1 (Dickkopf-1) Can mean.

The Bupyeongcho extract inhibits Dkk-1 induced by DHT and thus can activate Wnt / β-catenin signaling.

As used herein, the term "signaling activity of Wnt / β-catenin" results in stabilization of β-catenin by binding a ligand to a Frizzled group family and promotes expression of a target gene by binding to Tcf / Lef transcription factors. Preferably, it is possible to stabilize the β-catenin by binding a ligand and a Frizzled group of receptors present in the dermal papilla cells and the percutaneous muscle keratinocytes, and enter the nucleus to bind to the Tcf / Lef transcription factor. It may mean to induce the expression of the hair growth gene and new hair follicle formation.

In the present invention, the term "DKK-1 (Dickkopf-1)" means an antagonist of Wnt / β-catenin, DKK-1 serves to inhibit Wnt / β-catenin signaling.

In one embodiment of the present invention it was confirmed that Bupyeongcho extract can promote the signaling of Wnt / β-catenin (Example 2), it was confirmed that reduces the mRNA expression of DKK-1 induced by DHT ( Example 3).

In view of the mechanism of inducing hair follicle formation of Wnt / β-catenin as described above, the Bupyeongcho extract of the present invention promotes signal transduction of Wnt / β-catenin, and thus can be used as a component of the composition for promoting hair follicle formation and promoting hair growth. In addition, the Bupyeongcho extract promotes the signaling of Wnt / β-catenin, which is known to be essential for the production of hair pigment, and thus, when the composition is used, an external preparation for skin that induces melanin production and prevents or alleviates vitiligo, white hair, and swordfish hair. It may be used as a component of, but is not limited thereto, and may be used to improve other diseases or symptoms requiring the activity of Wnt / β-catenin signaling.

In the embodiment of the present invention to obtain the Bupyeongcho extract, it was confirmed that the obtained Bupyeongcho extract has a hair growth promoting effect (Examples 4 to 6). In addition, it was confirmed that the extract activates Wnt / β-catenin signaling and inhibits DKK-1 induced by DHT (Examples 2 and 3). These results indicate that Bupyeongcho extract stimulates hair growth by activating Wnt / β-catenin signaling by inhibiting DKK-1.

The composition of the present invention may be formulated in any form that is typically applicable to the skin, but is preferably formulated in the form of an external preparation. For example, it may be prepared in a formulation that can be applied to the skin such as liquid, cream, paste, or solid, and by adding conventional additives, shampoo, tonic, hair conditioner, hair lotion, gel, pack, Creams, essences, powders, sprays, oils, soaps, liquid detergents, liquid hair repellent types, and the like, and the like, and may be used in various forms in the form of aerosol type of these formulations, but is not limited thereto.

When the formulation of the present invention is liquid, a solvent, a solubilizer or an emulsifier is used as the carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- Fatty acid esters of butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as carrier components. Can be.

In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. Especially, in the case of a spray, a mixture of chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

The components included in the composition of the present invention include components commonly used in external preparations that can be applied to the skin in addition to Bupyeongcho extract, for example, water, surfactants, moisturizers, lower alcohols, chelating agents, fungicides, antioxidants, It may further comprise one or more additives selected from the group consisting of preservatives, colorants and flavorings.

In one embodiment of the present invention the composition was prepared in the formulation of hair tonic, shampoo, hair lotion, eyebrow growth tonic, eyebrow growth cream (Examples 4 and 6).

It is preferable to use the hair growth promoting composition of the present invention in a transdermal administration method such as directly applying or spraying to the skin.

As used herein, the term "administration" means introducing the composition of the present invention in any suitable way, the route of administration of the composition of the present invention can be administered via any general route as long as it can reach the target tissue. have. Preferably, transdermal administration can be carried out, and local application is most preferable. The number of applications of the compositions of the present invention can be determined according to prescription, need or desire.

The amount of the composition of the present invention can be appropriately adjusted according to individual differences or formulations such as age, degree of lesion, etc., and it is generally preferred to use an appropriate amount once or several times a day on the scalp and use it for one week to several months. In one embodiment of the present invention was used for 5 months a week composition 5 for 6 months, it was confirmed that the hair growth promoting effect appeared (Example 5).

A composition comprising the extract of Bupyeongcho according to the present invention as an active ingredient may be used as a composition for promoting hair growth, and the composition may be useful in promoting hair growth by being safe for the human body while having an excellent hair growth effect. have.

FIG. 1 shows the results of confirming the expression of human DKK-1 mRNA by reverse transcription amplifier (RT-PCR) after simultaneously treating dihydrotestosterone (DHT) 100nM and Bupyeongcho extract 50 and 100 ug / ml on human dermal papilla cells. Figure shown.
2 is a diagram showing the hair growth promoting effect of the composition of Table 3 tested using C57BL / 6 mice.

Hereinafter, the present invention will be described in more detail with reference to examples. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example  1: Bupyeongcho ( Spirodela polyrhiza ) Obtaining Extract

1kg of Bupyeongcho well crushed using a blender was chilled with 5L ethanol for 1 week, filtered using filter paper (Whatman No. 2 filter paper), and the filtrate was concentrated under reduced pressure three times to obtain 105g of ethanol extract. And stored at 4 ° C. until used in the experiment.

Example  2: of Bupyeongcho extract Wnt / β- catenin  Investigation of signal transduction activity

TOPflash reporter (Millipore, USA) was used to investigate the effect of Wnt / β-catenin signaling activity of Bupyeongcho extract. Human dermal papilla cells were inoculated in 2 well cells at 2 x 10 ⁵ cells / well in a 24 well plate and incubated for 24 hours, then treated with Bupyeongcho extract to 10, 50, 100 ug / ml and further incubated for 15 hours to provide a dual luciferase assay. Firefly luciferase activity was measured using the kit (Promega, USA). The results were compared with the control group (70% ethanol treated group used for Bupyeongcho extract) to evaluate the effect of Wnt / β-catenin signaling activity.

In order to accurately measure luciferase activity, the test was carried out three times for each sample. The relative TOPflash activity (RLU) relative to the control group was calculated as a percentage increase and then shown in Table 1.

Wnt Signal Activation Effect of Bupyeongcho Extract Sample Name TOPflash active (RLU) Growth rate (%) Control group 1843 ± 3 - Bupyeongcho Extract 10ug / ml 2508 ± 6 136.0 Bupyeongcho Extract 50ug / ml 5506 ± 14 298.7 Bupyeongcho Extract 100ug / ml 10,456 ± 53 567.3

As shown in [Table 1], Bupyeongcho extract according to the present invention was evaluated to show a selective and excellent activity effect on the Wnt / β-catenin signaling by increasing the TOP flash reporter activity in a concentration-dependent manner.

Example  3: DHT ( Dihydrotestosteron Induced by DKK -One( Dickkopf -1) Inhibitory effect investigation

Activation of Wnt / β-catenin promotes hair growth, whereas male hormone or Dihydrotestosterone (WAKO, Japan) promotes the inhibition of Wnt / -βcatenin signaling through the expression of DKK-1 gene.

Therefore, to find out whether Bupyungcho extract can promote hair growth by inhibiting the expression of the DKK-1 gene, an antagonist of Wnt / -βcatenin, 50, 100 ug / ml of human Bupyeongcho extract and 100 nM of dihydrotestosterone were used together for 24 hours. After treatment, the expression of DKK-1 was analyzed by reverse transcription amplifier method (RT-PCR) using the primers of Table 2 (Bionia, Korea). Reverse transcription amplification conditions were performed at 94 ℃ 1 min, 58 ℃ 45 seconds, 72 ℃ 45 seconds 25 cycles, the results are as shown in FIG.

Standing column Forward primer TGATGAGTACTGCGCTAGTC (SEQ ID NO: 1) Reverse primer CTCCTATGCTTGGTACACAC (SEQ ID NO: 2)

As shown in Figure 1, Bupyeongcho extract significantly reduced the expression of DKK-1 increased by dihydrotestosterone treatment, it was found that promotes hair growth.

Example  4: Evaluation test for promoting hair growth effect

In this example, the C57BL / 6 mouse model was used as an animal test model for evaluating the effect of promoting hair growth. The C57BL / 6 mouse has black hair, spontaneous alopecia, and melanomas. The melanocytes are present only in hair follicles, and the melanin synthesis matches well with the hair growth cycle, which makes it possible to determine the growth cycle of the hair by the color of the skin. .

The experimental group treated with Bupyeongcho extract and the untreated control group were used to determine the effect of animal experiments on the hair growth promoting effect. Evaluation of hair growth promotion Animal test was performed using the mouse 7 weeks old (C57BL / 6, female, Daehan Biolink). After acclimation for a period of time, the mice were weighed and divided into 8 groups so that their weight was evenly distributed. In order to evaluate the growth promoting effect, the hair of the back of the anesthetized mouse was depilated with an electric razor, and the excipients, the control drugs prepared according to the prescription of the following [Table 3] once a day at the depilated area from the following day, and each Test drug was sufficiently applied to the hair removal site with a brush for 4 weeks.

After 28 days of hair removal, the grown hair was removed with an electric razor, and the weight of the grown hair was measured and photographed. The results are shown in [Table 4] and [FIG. 2].

(Unit: wt%)                         Compounding ratio (% by weight)   Excitation station   Treaty   Test drug 1 Test drug 2 Ethanol 100% 70 70     70 70 Minoxidil 5% - 20     - - Bupyeongcho Extract 5% - -     20  2 Purified water  Balance (100% total)

Experimental material Addiction Treaty Test drug 1    Test drug 2 Weight of hair (mg)     2.9 ± 0.2      13.6 ± 0.3   15.6 ± 0.2   10.3 ± 0.3

As shown in Table 4, Test Drugs 1 and 2 containing Bupyeongcho extract were excellent in promoting hair growth, but did not show any side effects in the skin.

From the animal test results described above, it was confirmed that Bupyeongcho extract has excellent hair growth effects, and the hair growth promoting composition according to the present invention was prepared in various formulations. The formulation examples are described in detail below. However, these formulation examples are only examples of the composition for promoting hair growth of the present invention, it will be apparent to those skilled in the art that the scope of the composition of the present invention is not limited only to these formulations.

Formulation Example 1: Hair Growth Composition 1 (Hair Tonic)

Bupyeongcho extract was prepared according to the formulation shown in Table 5 in the usual manner hair tonic.

Compounding ingredient Weight ratio (%) ethanol 55 Castor oil 5 glycerin 3 Pyrotonolamine 0.1 Bupyeongcho Extract 5% 2 Incense burner and pigment Suitable amount Purified water Balance (total 100)

Formulation Example 2: Hair Growth Composition 2 (Shampoo)

Bupyeongcho extract was prepared according to the formulation shown in the following [Table 6] shampoo in a conventional manner.

Compounding ingredient Weight ratio (%) Poly Quaternium 0.5 Sodium lauryl sulfate (30%) 20 Sodium Polyoxyethylene Lauryl Sulfate 30 Palm oil fatty acid diethanolamide 3 Quaternary Ammonium Cationic Surfactants 2 Carbopol-1342 0.3 Paraoxybenzoic acid ester 0.2 Bupyeongcho Extract 5% 2 Incense burner and pigment Suitable amount Purified water Balance (total 100)

Formulation Example 3: Composition 3 for Hair Regrowth Hair lotion )

Bupyeongcho extract was able to prepare a hair lotion in a conventional manner according to the formulation of the following [Table 7].

Compounding ingredient Weight ratio (%) Cetostearyl alcohol 2 Stearyl Triethyl Ammonium Chloride 2 Hydroxyethyl cellulose 0.5 Pyrrothonol amine 0.1 Bupyeongcho Extract 5% 2 Incense burner and pigment Suitable amount Purified water Balance (total 100)

Example  5: Hair growth effect confirmation test of the composition 1 (hair tonic) for hair growth

The hair growth composition 1 (hair tonic) of the present invention is used for hair and scalp for 6 months five times a week for a total of 19 men and women who have a significantly smaller number of hairs than the normal or show alopecia and weak hair. It was. After use, the degree of improvement (very good; +3, better; +2, slightly better; +1, no change; 0, slightly worse;-1, worse; -2, very bad; -3) After 3 months and 6 months, the user questioned the average value.

The evaluation results are shown in [Table 8].

Hair thickness Density Resilience  Overall rating 3 months later,
Average score    2.1 ± 0.2    2.3 ± 0.1     2.1 ± 0.3   2.4 ± 0.2 6 months later,
Average score    2.5 ± 0.2    2.8 ± 0.1     2.7 ± 0.3   2.7 ± 0.2

As shown in Table 8, in the case of using the composition 1 (hair tonic) for hair growth, it can be seen that the thickness, elasticity, etc. of the hair improved when 3 months and 6 months of use.

Example  6: Eyebrow Growth Agent  Growth Effect Confirmation Test of Composition

Formulation Example 1: Hair Growth Composition 4 (Eyebrow Growth tonic )

Bupyeongcho extract was prepared according to the following formula eyebrow growth tonic.

Compounding ingredient Weight ratio (%) ethanol 40 Tocopherol Acetate 0.1 Salicylic acid 0.3 L-menthol 0.3 Bupyeongcho Extract 5% 2 Twin 20 Suitable amount Purified water Balance (total 100)

Formulation Example 2: Hair Growth Composition 5 (Eyebrow Growth Cream)

Bupyeongcho extract was prepared according to the following prescription eyebrow growth cream.

Compounding ingredient Weight ratio (%) paraffin 5 Cetostearyl alcohol 5.5 Petrolatum 5.5 Glycerin monostearate 3 Polyoxyethylene octyldodecyl ether 3 Propylparaben 0.3 glycerin 7 Bupyeongcho Extract 5% 2 Dipropylene glycol 20 Polyethylene glycol 5 Spices Suitable amount Purified water Balance (total 100)

The hair growth composition 4 (eyebrow growth tonic) prepared above was used for four months, five times a week, for a total of 15 men and women with a significantly lower or lower number of eyelashes than normal. After use, the evaluation was performed with respect to eyelash thickness, compactness, length, elasticity, and overall evaluation items (very good; +3, better; +2, slightly better; +1, no change; 0, slightly worse;- 1, worsening; -2, very bad; -3) 4 months after the user questionnaire was evaluated by the average value.

The evaluation results are shown in [Table 11].

Eyelash length The thickness of the eyelashes Eyelash density Eyelash elasticity  Overall rating 4 months later,
Average score 2.7 ± 0.1    2.5 ± 0.2   2.7 ± 0.1   2.6 ± 0.1   2.7 ± 0.2

As shown in [Table 11], by using the composition 4 for hair growth, confirming the effect on the growth of the eyelashes, it can be seen that after 4 months of use, the length of the eyelashes is longer.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Composition for promoting the hair growth comprising extracts of          Spirodela polyrhiza <130> PA120160KR <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for DKK-1 <400> 1 tgatgagtac tgcgctagtc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for DKK-1 <400> 2 ctcctatgct tggtacacac 20

Claims (9)

Bupyeongcho polyrhiza ) Hair growth promoting composition comprising the extract as an active ingredient.
The composition of claim 1, wherein the hair growth is performed by promoting Wnt / β-catenin signaling.
The composition of claim 2, wherein the Wnt / β-catenin signaling promotion is performed by inhibition of DKK-1 (Dickkopf-1).
The composition of claim 1, wherein the extract is an extract extracted with a solvent selected from the group consisting of alcohols having 1 to 6 carbon atoms and mixed solvents thereof.
The composition of claim 4, wherein the alcohol solvent is ethanol.
The composition of claim 1, wherein the content of the Bupyeongcho extract is included in an amount of 0.01 wt% to 10 wt% based on the total weight of the composition.
The composition of claim 1, wherein the composition promotes growth of hair, eyebrows, eyelashes, nose hair or body hair.
The composition of claim 1 wherein the composition has any one formulation selected from the group consisting of shampoos, hair conditioners, gels, packs, essences and sprays.
The method of claim 1, wherein the composition further comprises at least one additive selected from the group consisting of water, surfactants, humectants, lower alcohols, chelating agents, fungicides, antioxidants, preservatives, pigments and flavorings. Composition.

Images