KR20130055040A - Pcr primer for detecting salmonella - Google Patents

Pcr primer for detecting salmonella Download PDF

Info

Publication number
KR20130055040A
KR20130055040A KR1020110118733A KR20110118733A KR20130055040A KR 20130055040 A KR20130055040 A KR 20130055040A KR 1020110118733 A KR1020110118733 A KR 1020110118733A KR 20110118733 A KR20110118733 A KR 20110118733A KR 20130055040 A KR20130055040 A KR 20130055040A
Authority
KR
South Korea
Prior art keywords
salmonella
enteritidis
gallinarum
pcr
dna
Prior art date
Application number
KR1020110118733A
Other languages
Korean (ko)
Other versions
KR101282924B1 (en
Inventor
장형관
박인재
차세연
강민
장상호
Original Assignee
전북대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전북대학교산학협력단 filed Critical 전북대학교산학협력단
Priority to KR1020110118733A priority Critical patent/KR101282924B1/en
Publication of KR20130055040A publication Critical patent/KR20130055040A/en
Application granted granted Critical
Publication of KR101282924B1 publication Critical patent/KR101282924B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

PURPOSE: A primer set for simultaneously detecting 4 kinds of salmonella including Salmonella enteritidis, Salmonella typhymurium, Salmonella gallinarum, and Salmonella pullorum and a detection method using the same are provided to quickly and accurately identify the 4 kinds of salmonella. CONSTITUTION: A primer set containing base sequences in sequence numbers 1-12 is used for simultaneously detecting Salmonella enteritidis, Salmonella typhymurium, Salmonella gallinarum, and Salmonella pullorum. A method for simultaneously detecting Salmonella enteritidis, Salmonella typhymurium, Salmonella gallinarum, and Salmonella pullorum comprises: a step of isolating genome DNA from a sample; a step of performing PCR using the genome DNA and the primer set; and a step of detecting PCR product.

Description

살모넬라의 동시 검출을 위한 ＰＣＲ 프라이머 {PCR primer for detecting Salmonella}PCR primer for detecting Salmonella

본 발명은 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)의 4종의 살모넬라를 동시에 검출할 수 있는 프라이머 세트 및 이를 이용한 검출 방법에 관한 것이다.
The present invention is Salmonella enteritidis ( Salmonella) enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella The present invention relates to a primer set capable of simultaneously detecting four types of Salmonella, gallinarum ) and Salmonella pullorum , and a detection method using the same.

살모넬라 엔테리티디스(Salmonella enteritidis)와 살모넬라 티피뮤리움(Salmonella typhymurium)은 소, 돼지, 닭 등 가축들에서 설사를 주 증상으로 하며, 심한 경우에는 탈수로 인한 폐사를 일으키고, 사람에게서 식중독을 유발하는 세균으로 공중보건상에서 매우 중요한 세균이다. 또한, 살모넬라 갈리나룸(Salmonella gallinarum)과 살모넬라 풀로룸(Salmonella pullorum)은 운동성이 없는 세균으로 닭에 특이적으로 감염하여 각각 가금티푸스와 추백리를 유발한다. Salmonella enteritidis and Salmonella typhymurium are the main symptoms of diarrhea in livestock such as cattle, pigs and chickens. It is a very important bacterium in public health. In addition, Salmonella gallinarum ( Salmonella gallinarum ) and Salmonella pullorum ( Malmonella pullorum ) is a non-motile bacterium that specifically infects chickens, causing poultry fever and Chubaekri.

많은 연구자들은 가축에서 설사를 일으키는 살모넬라 엔테리티디스, 티피뮤리움과 닭에 특이적으로 감염하는 살모넬라 갈리나룸, 풀로룸의 특성을 밝히기 위하여 살모넬라가 갖고 있는 O, H 항원을 이용하여 분류를 시도하였다. 이 방법은 동물 및 사람에서 질병을 일으키는 살모넬라를 분리하고 혈청형을 조사한 분류 방법이었다. 그러나 기존의 혈청형 분류방법은 시험시간이 많이 소요되며, 항혈청을 필히 보유해야 해 번거로운 단점을 가지고 있다.Many researchers have attempted to classify Salmonella's O and H antigens to characterize Salmonella enteritidis, Typhimurium, and Salmonella galinarum and Pullorum, which are specifically infected with livestock. . This method was used to isolate disease-causing Salmonella from animals and humans and to investigate serotypes. However, the existing serotype classification method takes a lot of test time, and has a cumbersome disadvantage of having antiserum.

최근 분자생물학적 기법의 발달로, 게놈 DNA 중의 특정부위의 유전자만을 증폭시키는 것이 가능해졌으며, 증폭된 유전자 산물을 전기영동을 통하여 확인함으로써 특정 세균종의 DNA 다형성을 검출 진단하는 방법이 개발되었다. 이 방법은 프라이머(primer)라 불리우는 10~20bp로 구성된 특정 DNA 단편을 이용하는 연쇄중합반응(PCR, polymerase chain reaction)에 기초한 것으로서, 민감도 및 특이성이 뛰어나며, 시료의 처리과정 및 수행과정이 비교적 간편하다.Recently, with the development of molecular biological techniques, it has become possible to amplify only genes in specific regions of genomic DNA, and a method for detecting and diagnosing DNA polymorphism of specific bacterial species has been developed by confirming amplified gene products through electrophoresis. This method is based on a polymerase chain reaction (PCR) using a specific DNA fragment consisting of 10 to 20 bp, called a primer, which has excellent sensitivity and specificity, and makes processing and execution of samples relatively simple. .

최근 이러한 PCR 기법을 도입한 살모넬라 진단법들이 개발되고 있다. 1999년에 살모넬라 엔테리티디스와 티피뮤리움을 동시에 구별할 수 있는 PCR 기법이 개발되어 논문에 발표 되었으나, 이는 재현성이 없는 것으로 나타났다. 2000년에 살모넬라 티피뮤리움을 단독으로 검출할 수 있는 PCR 기법이 개발 되었으나, 이는 살모넬라 티피뮤리움만을 검출하는 진단법으로 진단에 한계를 가지고 있다. 2008년에 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸을 동시에 구별할 수 있는 리얼타임 PCR(Real-Time PCR)기법이 개발되었으나, 이 개발된 기법에서는 살모넬라 갈리나룸과 살모넬라 두블린(Salmonella dublin)이 구별되지 않아 살모넬라 갈리나룸 진단에는 적합하지 않다. 또한, 2011년에 마찬가지로 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸을 진단할 수 있는 PCR 기법이 개발되었으나, 이는 각각 단독으로 PCR을 수행하여 진단해야 하며 그로 인한 진단 비용과 시간이 증가하는 단점을 가지고 있다. 또 다른 2011년에 개발된 PCR 기법은 살모넬라 갈리나룸을 단독으로 검출할 수 있는 기법이나, 상기 개발 기법들과 마찬가지로 진단에 한계성을 가지고 있다.Recently, Salmonella diagnostic methods incorporating such PCR techniques have been developed. In 1999, a PCR technique was developed to distinguish Salmonella enteritidis and Typhimurium at the same time, but it was not reproducible. In 2000, a PCR technique for detecting Salmonella typhimurium alone was developed, but this method has a limitation in diagnosis as a diagnostic method for detecting Salmonella typhimurium alone. In 2008, a real-time PCR technique was developed to distinguish Salmonella enteritidis, Tipimurium, and Galinarum, but in this development, Salmonella Galinarum and Salmonella dublin This distinction is not suitable for Salmonella gallinarum diagnosis. In addition, in 2011, PCR techniques for diagnosing Salmonella enteritidis, Typhimurium, and Galinarum were developed.However, these methods must be diagnosed by performing PCR alone, which increases the cost and time of diagnosis. Have. Another PCR technique developed in 2011 is a technique capable of detecting Salmonella gallinarum alone, but has limitations in diagnosis like the above development techniques.

이에 본 발명자들은 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸, 풀로룸의 6종의 특이 유전자 각각에 대한 PCR용 프라이머를 개발하고자 연구를 수행하였으며, 나아가 한번의 PCR 반응에 동시에 적용할 수 있도록 공통의 반응조건을 갖는 프라이머의 개발에 주력하여 왔다. 그 결과, 6종의 특이 유전자 각각의 PCR용 프라이머를 합성하였으며, 6쌍의 프라이머 모두를 한번의 PCR 반응에 동시에 적용하여 1회의 PCR 수행으로 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 동시에 검출할 수 있음을 확인하고 본 발명을 완성하였다.
Accordingly, the present inventors conducted a study to develop PCR primers for each of six specific genes of Salmonella enteritidis, T. pimurium, gallinarum, and pullulum, and they can be applied simultaneously to a single PCR reaction. The focus has been on the development of primers with reaction conditions. As a result, PCR primers for each of the six specific genes were synthesized. Salmonella enteritidis, typhimurium, gallinarum and pullulum were applied by applying all six pairs of primers simultaneously to one PCR reaction. It was confirmed that can be detected at the same time to complete the present invention.

국내특허출원번호 :10-2008-0101620Domestic patent application number: 10-2008-0101620

본 발명의 목적은 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)을 동시에 검출할 수 있는 프라이머 세트를 제공하는 것이다. An object of the present invention display utility Entebbe Salmonella (Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum ) and Salmonella pullorum to provide a set of primers that can be detected at the same time.

본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)의 동시 검출용 조성물을 제공하는 것이다. Another object of the present invention is Salmonella enteritidis (including the primer set)Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galinarum (Salmonella gallinarum) And Salmonella Pullo RoomSalmonella pullorumIt is to provide a composition for simultaneous detection of).

본 발명의 또 다른 목적은 상기 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)의 동시 검출용 키트를 제공하는 것이다. Another object of the present invention Salmonella enteritidis ( Salmonella) comprising the primer set enteritidis), Salmonella typhimurium (Salmonella typhymurium ), Salmonella gallinarum ( Salmonella gallinarum ) and Salmonella pullorum ( Salmonella pullorum ) to provide a kit for the simultaneous detection.

본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)을 동시에 검출하는 방법을 제공하는 것이다.
Another object of the present invention Salmonella enteritidis ( Salmonella) comprising the primer set enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum and Salmonella It provides a method for detecting pullorum ) at the same time.

상기와 같은 목적을 달성하기 위하여 본 발명은 서열번호 1 내지 12의 염기서열로 이루어진 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 프라이머 세트를 제공한다. In order to achieve the above object, the present invention comprises Salmonella enteritidis ( Salmonella) consisting of the nucleotide sequence of SEQ ID NO: 1 to 12 enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella A primer set for simultaneous detection of pullorum ) is provided.

또한, 본 발명은 상기 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 조성물을 제공한다. In addition, the present invention Salmonella enteritidis ( Salmonella) comprising the primer set enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum and Salmonella The composition for simultaneous detection of pullorum ) is provided.

또한 본 발명은 상기 조성물을 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 키트를 제공한다.In another aspect, the present invention is Salmonella enteritidis ( Salmonella) comprising the composition enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella kit for simultaneous detection of pullorum ).

또한 본 발명은, (a) 시료로부터 게놈 DNA를 추출하는 단계 및 (b) 추출된 게놈 DNA를 주형으로 하고, 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계;를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 을 동시에 검출하는 방법을 제공한다.
In another aspect, the present invention, Salmonella enteritidis ( Salmonella) comprising the steps of (a) extracting genomic DNA from a sample and (b) using the extracted genomic DNA as a template, and performing PCR using the primer set; enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum and Salmonella Pullorum ) provides a method to detect simultaneously.

본 발명에 따른 프라이머 세트는 한번의 PCR을 통해, 특정 시료로부터 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)의 4종의 살모넬라를 확인할 수 있어, 신속하고 정확한 진단이 가능하다.
Primer set according to the present invention Salmonella enteritidis ( Salmonella) from a specific sample through a single PCR enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella Four types of Salmonella, gallinarum ) and Salmonella pullorum , can be identified, enabling rapid and accurate diagnosis.

도 1은 표 1에 기재된 각 프라이머 세트의 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸의 게놈상 위치를 나타낸 모식도이다.
도 2는 표 1에 기재된 프라이머 세트 1 내지 3을 이용하여 단독 PCR을 수행한 결과이다.
도 3은 표 1에 기재된 프라이머 세트 4 내지 6을 이용하여 단독 PCR을 수행한 결과이다.
도 4는 표 1에 기재된 프라이머 세트 1 내지 6을 이용하여 멀티플렉스 PCR을 수행한 결과이다.
도 5는 표 1에 기재된 프라이머 세트 1 내지 6을 이용하여 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸과 닭을 포함하는 가축의 세균성 질병 주요 원인균들에 적용한 멀티플렉스 PCR 결과이다.
도 6은 표 1에 기재된 프라이머 세트 1 내지 6을 이용하여 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸과 상기 4종의 살모넬라와 같은 서브스페시스(Subspecies)에 속하는 살모넬라 하이델베르그(Heidelberg), 센프텐베르그(Senftenberg) 및 인판티스(Infantis) 에 적용한 멀티플렉스 PCR 결과이다.FIG. 1 is a schematic diagram showing the genomic positions of Salmonella enteritidis, Tipimurium, Galinarum and Pullum of each primer set shown in Table 1. FIG.
Figure 2 shows the results of PCR alone using the primer sets 1 to 3 described in Table 1.
Figure 3 shows the results of PCR alone using the primer sets 4 to 6 described in Table 1.
Figure 4 shows the results of performing multiplex PCR using primer sets 1 to 6 described in Table 1.
FIG. 5 shows multiplex PCR results applied to major bacterial bacterial pathogens of livestock including Salmonella enteritidis, Tipimurium, Galinarum, and Pullulum and chickens using the primer sets 1 to 6 described in Table 1. FIG.
FIG. 6 shows Salmonella Heidelberg belonging to Subspecies, such as Salmonella enteritidis, Tipimurium, Galinarum and Pullulum and the four Salmonella, using the primer sets 1 to 6 described in Table 1. FIG. Multiplex PCR results applied to, Senftenberg and Infantis.

본 발명은 서열번호 1 내지 12의 염기서열로 이루어진 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 프라이머 세트를 제공한다. 구체적인 프라이머 서열은 하기 표 1에 나타내었다. The present invention is for the simultaneous detection of Salmonella enteritidis (Salmonella enteritidis), Salmonella typhymurium (Salmonella typhymurium), Salmonella gallinarum (Salmonella gallinarum) and Salmonella pullorum consisting of the base sequence of SEQ ID NOS: 1-12 Provide a primer set. Specific primer sequences are shown in Table 1 below.

프라이머세트Primer set 서열번호SEQ ID NO: 5'→ 3' 염기서열5 '→ 3' sequence 증폭산물의 크기Size of amplification product 1One 1One AATTATCGCCACGTTCGGGCAATTATCGCCACGTTCGGGC 694bp694bp 22 TTTAGGTTTGGCGGCGCTACTTTAGGTTTGGCGGCGCTAC 22 33 GCGCGTCCACCACAGATAACGCGCGTCCACCACAGATAAC 517bp517 bp 44 CGGTCCATCATCCGACGGAACGGTCCATCATCCGACGGAA 33 55 TGTAGCGGGTCATAGTGGCTGTGTAGCGGGTCATAGTGGCTG 432bp432bp 66 CCAGTCACCTCCGCCAAACTCCAGTCACCTCCGCCAAACT 44 77 TGAAAAACAGCAGAAGAAGCTGAAAAACAGCAGAAGAAGC 326bp326 bp 88 GAACAGTGTTTCCCTGTCCTGAACAGTGTTTCCCTGTCCT 55 99 TGGTGGTGTAGCCACTGTCCTGGTGGTGTAGCCACTGTCC 204bp204 bp 1010 GCAGTGAAAGTACCTGCTGGCGCAGTGAAAGTACCTGCTGGC 66 1111 GGACGTCATTGTCACTAACCGGACGTCATTGTCACTAACC 103bp103 bp 1212 TATTAATCCAGCCCCCTTC TATTAATCCAGCCCCCTTC

본 발명에서 사용하는 용어인 “프라이머”란 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(DNA 중합효소 또는 역전사 효소) 및 상이한 4가지 dNTP (deoxynucleoside triphospate)의 존재 하에서 DNA합성을 개시할 수 있다.The term "primer" used in the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form complementary templates and base pairs, and is used for copying template strands. By a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) at appropriate buffers and temperatures.

본 발명의 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.The primers of the present invention may incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.

본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속, 철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

또한, 본 발명의 프라이머 핵산 서열은 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소 (예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자, 화학그룹 (예를 들어, 바이오틴) 등이 있다.In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioisotopes (eg 32 P), fluorescent molecules, chemical groups (eg biotin), and the like. There is this.

본 발명의 프라이머는 본 분야에서 올리고뉴클레오타이를 합성할 수 있는 것으로 공지된 임의의 방법, 예를 들면 자동 DNA 합성기 (예, 바이오서치, 어플라이드 바이오시스템TM 등으로 구입할 수 있는 것)를 사용하여 합성할 수도 있다.Primers of the present invention uses (one that can be purchased for example, Bio-Search, Applied Biosystems TM, etc.) any method known to be capable of oligonucleotides synthesized nucleoside tie in the art, for example, automatic DNA synthesizer You can also synthesize.

본 발명에 따른 프라이머는 세균에서 변이가 쉬운 유전영역인 플라스미드(Plasmid)를 제외하고, 잘 보존된 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸의 게놈을 기초하여 합성된 것으로, 특이적으로 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 검출할 수 있다. The primer according to the present invention was synthesized based on the genomes of well-conserved Salmonella enteritidis, Typhimurium, Galinarum and Pullum, with the exception of Plasmid, a genetic region that is easily mutated in bacteria. Salmonella enteritidis, Typhimurium, Galinarum and Pulumum can be detected.

특정 유전자 검출을 위한 PCR기법은 한 쌍의 프라이머(Forward 프라이머와 Reverse 프라이머)를 이용하게 되는데, 이들 프라이머의 설계 시 프라이머의 A, G, C, T 함량비, 프라이머의 복합체(dimer)형성 방지 등 여러 가지 제약이 따르며, 그 외에 단독 PCR 반응조건에 있어서 주형(template) DNA의 양, 프라이머의 농도, dNTP의 농도, 반응온도, 반응시간 등의 조건이 적정해야 한다. 특히, 본 발명과 같이, 여러 쌍의 PCR 프라이머를 혼합하여 한번의 PCR을 수행함으로써, 시료로부터 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸를 동시에 확인하는 멀티플렉스 PCR 반응에서는, 6쌍의 프라이머 모두 공통의 반응조건이 설정되어야 하므로 프라이머의 설계 시 단독 PCR의 경우보다 적정 조건이 더욱 엄격하게 요구되며, 반응완료 후 겔상에서 증폭된 유전자산물의 구별을 위해 유전자 산물의 크기가 각각 구별이 되어야 하는 제약이 존재한다. 특히, 반응조건의 설정에 있어서 6쌍의 프라이머 모두에 대한 비특이 증폭을 제거하기 위한 온도 설정과 프라이머 접촉시간 설정이 매우 어려운 과정이며, 멀티플렉스 PCR 수행을 위한 조성 조건에서 각 조성물의 농도 설정이 매우 어려운 과정이다. The PCR technique for detecting a specific gene uses a pair of primers (forward primers and reverse primers). When designing these primers, A, G, C, and T content ratios of primers, and prevention of dimer formation of primers are used. There are various restrictions. In addition, the conditions such as the amount of template DNA, primer concentration, dNTP concentration, reaction temperature, and reaction time should be appropriate in a single PCR reaction condition. In particular, as in the present invention, in a multiplex PCR reaction in which multiple pairs of PCR primers are mixed and a single PCR is performed to simultaneously identify Salmonella enteritidis, Tipimurium, Galinarum and Pullum, 6 pairs. Since the common reaction conditions should be set for all primers, proper conditions are more strictly required in designing the primers than for PCR alone, and the size of the gene products must be distinguished to distinguish the gene products amplified on the gel after completion of the reaction. There is a constraint. In particular, it is very difficult to set the temperature and primer contact time to remove non-specific amplification for all six pairs of primers in setting reaction conditions. It's a very difficult process.

본 발명의 서열번호 1 내지 12의 염기서열로 이루어진 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 프라이머 세트는 멀티플렉스 PCR 기법에 적합하도록 개발된 것으로서, 1회의 PCR 수행으로 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 동시에 고감도로 검출할 수 있다. Simultaneous detection of Salmonella enteritidis, Salmonella typhymurium, Salmonella gallinarum and Salmonella pullorum consisting of the nucleotide sequences of SEQ ID NOS: 1-12 of the present invention The primer set was developed to be suitable for the multiplex PCR technique, and can detect Salmonella enteritidis, Tippimurium, Galinarum and Pululum at the same time with high sensitivity in one PCR.

본 발명에서 사용하는 용어인 “검출”은 시료에서 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum)을 분리하여 식별할 수 있는 것을 의미한다.The term "detection" used in the present invention is identified by separating Salmonella enteritidis, Salmonella typhymurium, Salmonella gallinarum and Salmonella pullorum from a sample. It means you can do it.

또한, 본 발명은 상기의 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 조성물을 제공한다. In addition, the present invention Salmonella enteritidis ( Salmonella) comprising the above primer set enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum and Salmonella The composition for simultaneous detection of pullorum ) is provided.

본 발명의 검출용 조성물은 당 분야에서 널리 사용되는 다른 구성 성분 또는 장치를 추가로 포함하여 PERV 검출용 키트로 응용, 제작될 수 있다. 구체적인 예로서, 프라이머 세트 및, 추가적으로 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제와 같은 효소, 멸균수 등을 포함하여 PCR용 키트로 제작될 수 있다. 또 다른 예로서, DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 DNA 칩용 키트로 제작될 수 있다. 본 발명의 프라이머 세트 및 검출용 조성물은 DNA를 증폭시킬 수 있는 모든 반응 방법에 이용될 수 있다. 그 예로, PCR (polymerase chain reaction), TMA(transcription-mediated amplification), NASBA (nucleic acid sequence-based amplification), 3SR (self-sustained sequence replication), LCR (ligase chain reaction), SDA (strand displacement amplification) 및 고리매개등온증폭 (Loop-Mediated Isothermal Amplification, LAMP)등이 포함될 수 있다. The detecting composition of the present invention may be applied and manufactured as a kit for detecting PERV, further including other components or devices widely used in the art. As a specific example, a primer set and, additionally, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase, sterile water, and the like can be prepared into a kit for PCR. As another example, the kit may be manufactured as a kit for a DNA chip containing essential elements necessary for carrying out the DNA chip. The primer set and the composition for detection of the present invention can be used in all reaction methods capable of amplifying DNA. Examples include polymerase chain reaction (PCR), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), ligand chain reaction (LCR), and strand displacement amplification (SDA). And Loop-Mediated Isothermal Amplification (LAMP).

또한, 본 발명은 상기 조성물을 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 키트를 제공한다.In addition, the present invention Salmonella enteritidis ( Salmonella) comprising the composition enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella kit for simultaneous detection of pullorum ).

또한 본 발명은, (a) 시료로부터 게놈 DNA를 추출하는 단계 및 (b) 추출된 게놈 DNA를 주형으로 하고, 상기 프라이머 세트를 이용하여 PCR을 수행하는 단계;를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 을 동시에 검출하는 방법을 제공한다. In another aspect, the present invention, Salmonella enteritidis ( Salmonella) comprising the steps of (a) extracting genomic DNA from a sample and (b) using the extracted genomic DNA as a template, and performing PCR using the primer set; enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum and Salmonella Pullorum ) provides a method to detect simultaneously.

본 발명의 검출 방법 중 (a) 단계의 게놈 DNA의 분리는 당업계에 공지된 통상의 방법에 따라 실시될 수 있다. 본 발명의 검출 방법 중 (b)단계에서는, 당업계에 공지된 PCR (Polymerase Chain Reaction)방법을 모두 이용할 수 있다. PCR은 예를 들면, 미국특허 제4,683,195호; 미국특허 제4,683,194호; Saiki et al. Science, 1985, vol.230, pp.1350-1354; Scharf et al. Science, 1986, vol.324, pp.163-166; Kogan et al. New Engl. J. Med., vol.317, pp.986-990 등에 개시되어 있다. PCR은 통상적으로 (1) DNA의 변성 (denaturation); (2) 프라이머의 결합 (annealing); (3) DNA의 합성 (polymerization or elongation) 단계로 이루어져 있다. 본 발명에서 DAN의 변성은 당업계에 공지된 바와 같이 약 80 내지 96℃에서 가열함으로써 달성될 수 있으며 높은 온도일수록 단일 가닥 DNA 로의 분리(변성)가 용이하지만, 온도가 지나치게 높으면 DNA 중합효소의 활성에 영향을 미칠 수 있으므로 적합한 온도를 설정하여야 한다. 이렇게 분리된 단일가닥 DNA (즉, 주형)에 대한 프라이머의 결합은 통상적으로 37 내지 65℃에서 진행되지만, 상기 온도는 프라이머의 GC 함량 및 크기 등 여러 가지 요인에 따라 달라질 수 있다. 주형에 프라이머가 결합하게 되면 상기 프라이머의 말단으로부터 주형에 상보적인 뉴클레오타이드가 순차적으로 결합하여 DNA 합성이 일어나게 되는데, 통상적으로 60 내지 75℃에서 실행한다. 본 발명에서 DNA의 변성, 어닐링, DNA의 합성 단계를 25 내지 40회, 바람직하게는 30회 수행하는 것이 적합하다.Isolation of the genomic DNA of step (a) of the detection method of the present invention can be carried out according to conventional methods known in the art. In step (b) of the detection method of the present invention, all PCR (Polymerase Chain Reaction) methods known in the art can be used. PCR is described, for example, in US Pat. No. 4,683,195; US Patent No. 4,683,194; Saiki et al. Science, 1985, vol. 230, pp. 1350-1354; Scharf et al. Science, 1986, vol. 324, pp. 163-166; Kogan et al. New Engl. J. Med., Vol. 317, pp. 986-990 and the like. PCR typically involves (1) denaturation of DNA; (2) annealing of primers; (3) DNA synthesis (polymerization or elongation) step. The denaturation of DAN in the present invention can be achieved by heating at about 80 to 96 ℃ as known in the art and the higher the temperature is easier to separate (denaturation) into single-stranded DNA, but if the temperature is too high activity of the DNA polymerase The proper temperature should be set. The binding of the primer to the isolated single-stranded DNA (ie, template) is typically performed at 37 to 65 ° C, but the temperature may vary depending on various factors such as the GC content and size of the primer. When the primer is bound to the template, nucleotides complementary to the template are sequentially bound from the ends of the primers, thereby causing DNA synthesis, which is typically performed at 60 to 75 ° C. In the present invention, it is suitable to perform denaturation, annealing, and synthesis of DNA 25 to 40 times, preferably 30 times.

본 발명에 있어서, PCR은 DNA의 합성에 적합한 조건에서 수행하는 것이 바람직할 것이다. 일반적으로 PCR은 약 pH 7 내지 9, 바람직하게는 약 pH 8의 완충용액에서 수행한다. 본 발명에서는 HEPES 또는 글리신-NaOH를 포함하는 완충용액 및 인산완충용액 등이 이용될 수 있으며, Tris-HCl을 10 내지 100mM의 농도로 함유하는 완충용액을 이용하는 것이 특히 바람직하다. 본 발명에서 상기 완충용액은 1가의 염(salt)을 약 10mM 내지 60mM의 농도로 함유할 수도 있다. 일반적으로 이용되는 1가의 염에는 KCl, NaCl 및 (NH4)2SO4 등이 포함되지만, 이에 제한되는 것은 아니다.In the present invention, it will be preferable to perform PCR under conditions suitable for the synthesis of DNA. In general, PCR is performed in a buffer solution of about pH 7 to 9, preferably about pH 8. In the present invention, a buffer solution containing HEPES or glycine-NaOH, a phosphate buffer solution, and the like may be used, and it is particularly preferable to use a buffer solution containing Tris-HCl at a concentration of 10 to 100 mM. In the present invention, the buffer solution may contain a monovalent salt at a concentration of about 10 mM to 60 mM. Commonly used monovalent salts include, but are not limited to, KCl, NaCl and (NH 4) 2 SO 4.

상기 PCR 반응물의 한 성분으로서 데옥시뉴클레오타이드 트리포스페이트 dATP, dCTP, dGTP 및 dTTP는 목적한 특정 유전자의 서열을 목적한 양까지 증폭하기에 충분한 양으로 PCR 반응물에 첨가되어야 한다. dNTPs는 바람직하게는 약 0.75 내지 4.0mM의 농도로, 더욱 바람직하게는 약 2.0 내지 3.0mM의 농도로 PCR 반응물에 첨가할 수 있다.Deoxynucleotide triphosphate dATP, dCTP, dGTP and dTTP as a component of the PCR reaction should be added to the PCR reaction in an amount sufficient to amplify the sequence of the specific gene of interest to the desired amount. dNTPs may be added to the PCR reaction preferably at a concentration of about 0.75 to 4.0 mM, more preferably at a concentration of about 2.0 to 3.0 mM.

상기 PCR 반응물에는 프라이머의 말단으로부터 주형 DNA의 염기서열에 대하여 상보적인 뉴클레오타이드를 순차적으로 연결시키는 반응을 촉매하는 DNA 중합효소가 포함되어야 할 것이다. 본 발명에서는 당업계에 공지된 DNA 중합효소가 모두 이용될 수 있으며, 그러한 예에는 E.coli DNA 중합효소, E.coli DNA 중합효소의 Klenow 단편, T4 DNA 중합효소 등이 포함된다. 그러나 통상적으로 PCR은 고온에서 실행되기 때문에 본 발명에서 이용되는 DNA 중합효소는 고온에서 안정한 성질을 보유한 것이 바람직하다. 본 발명에 따른 PCR에서는 당업계에 공지된 열에 안정한 DNA 중합효소가 모두 이용될 수 있으며, Taq 중합효소, 예를 들면 Amplitaq-gold 효소를 이용하는 것이 특히 바람직하다.The PCR reaction product should include a DNA polymerase that catalyzes the reaction of sequentially connecting nucleotides complementary to the nucleotide sequence of the template DNA from the end of the primer. In the present invention, all DNA polymerases known in the art may be used, and examples thereof include E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase, T4 DNA polymerase and the like. However, since PCR is usually performed at a high temperature, the DNA polymerase used in the present invention preferably has a stable property at a high temperature. In the PCR according to the present invention, all thermally stable DNA polymerases known in the art may be used, and it is particularly preferable to use Taq polymerase, for example, Amplitaq-gold enzyme.

또한 본 발명의 검출 방법은, (c) 상기 (b)단계에서 증폭된 산물을 검출하는 단계;를 더 포함할 수 있다. 상기 (c) 단계는 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기 및 형태별로 분리할 수 있으며, 바람직하게는 전기영동을 이용하여 검출한다. '전기영동'은 전기장에서 특정 물질을 크기 및 전하에 따라 분리하는 방법을 의미하는 것으로, 통상적으로 특정 물질을 음극에 로딩하고 전기장을 적용시켜서 상기 물질이 양극으로 이동하면서 분리되도록 유도한다. 뉴클레오타이드로 이루어진 물질의 전기영동에는 일반적으로 아가로스, 아가로스-아크릴아미드 또는 폴리아크릴아미드 겔 등이 이용될 수 있지만 이에 제한되는 것은 아니다. 전술한 전기영동에 이용되는 겔의 제조 및 염색방법은 당업계에 공지되어 있다. 예를 들어서 에티듐 브로마이드(Ethidium Bromide)를 이용한 아가로스 겔의 염색방법은 Boerwinkle et al. PNAS, 1989, vol.86, pp.212-216에 개시되어 있다. 또한, 은을 이용한 폴리아크릴아미드 겔의 염색방법은 (1) Goldman et al. Electrophoresis, 1982, vol.3, pp.24-26; (2) Marshall, Electrophoresis, 1983, vol.4, pp.269-272; (3) Tegelstrom, Electrophoresis, vol.7, pp.226-229 및 (4) Allen et al. Bio Technique, 1989, vol.7, pp.736-744 등에 개시되어 있다.In addition, the detection method of the present invention may further comprise (c) detecting the product amplified in step (b). The step (c) may separate the DNA of the PCR product by size and shape according to a method well known in the art, and preferably detect it using electrophoresis. 'Electrophoretic' refers to a method of separating a specific material in an electric field according to size and charge, and typically, a specific material is loaded on a cathode and an electric field is applied to induce the material to move while moving to the anode. For electrophoresis of a material consisting of nucleotides, agarose, agarose-acrylamide or polyacrylamide gel or the like may be generally used, but is not limited thereto. Methods of preparing and staining gels used for the aforementioned electrophoresis are known in the art. For example, a method for staining agarose gel using ethidium bromide is described by Boerwinkle et al. PNAS, 1989, vol. 86, pp. 212-216. In addition, a method of dyeing a polyacrylamide gel using silver is (1) Goldman et al. Electrophoresis, 1982, vol. 3, pp. 24-26; (2) Marshall, Electrophoresis, 1983, vol. 4, pp. 269-272; (3) Tegelstrom, Electrophoresis, vol. 7, pp. 226-229 and (4) Allen et al. Bio Technique, 1989, vol. 7, pp. 736-744 and the like.

본 발명의 검출 방법은 특정 목적을 위한 공지의 다른 과정과 결합될 수 있다. 예를 들어, 증폭 산물의 분리 (또는 정제)는 증폭과정에 후속될 수 있다. 상기 과정은 겔 전기영동, 컬럼 크로마토그래피, 친화성 크로마토그래피 또는 혼성화에 의해 실시될 수 있다. 또한, 본 발명의 증폭 산물은 클로닝용 담체에 삽입될 수 있다.
The detection method of the present invention can be combined with other procedures known for specific purposes. For example, separation (or purification) of the amplification products may follow the amplification process. The above procedure can be carried out by gel electrophoresis, column chromatography, affinity chromatography or hybridization. In addition, the amplification products of the present invention can be inserted in a carrier for cloning.

이하, 본 발명을 실시예에 의거하여 보다 구체적으로 설명한다. 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.

실시예Example 1.  One. 프라이머primer 디자인 design

National Center for Biotechnology Information 홈페이지에 등록되어있는 살모넬라들의 게놈 서열을 분석하여, 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 효과적이고, 신속하게 검출하기 위한 특이적인 PCR 프라이머를 디자인하였다 (표1).
By analyzing the genome sequence of Salmonella, which is registered on the National Center for Biotechnology Information homepage, we designed specific PCR primers for the effective and rapid detection of Salmonella enteritidis, Typhimurium, Gallinarum, and Pullulum. One).

실시예Example 2.  2. 프라이머primer 특이도 확인 Specificity check

살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 검출하기 위한 PCR 프라이머의 특이도 확인을 위하여, 표 1에서 제시한 각 프라이머 세트별로 PCR을 수행하였다. 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸 각각을 메콩키아가 배지(McConkey agar medium)에서 배양한 후, 게놈 DNA를 추출하였다. 표 2에 명기된 PCR 조성으로 PCR 반응은 95℃에서 5분간 열처리를 한 후, 95℃에서 30초간 DNA를 변성시키는 단계(denaturation); 58℃에서 5초간 프라이머와 접촉시키는 단계(annealing); 72℃에서 40초간 DNA를 합성하는 단계(extension)를 총 30회 반복하여 PCR 증폭을 실시하며, 마지막 DNA 합성단계는 72℃에서 5분간 실시하였다. 반응이 끝난 PCR 증폭 산물을 브로모에티듐(EtBr)이 포함된 1.5%의 아가로즈 겔에서 전기영동을 실시하여 증폭산물을 확인하였다 (도 2 및 도 3). 증폭산물의 크기는 표 1에 제시되어 있다. In order to confirm the specificity of the PCR primers for detecting Salmonella enteritidis, Typhimurium, Galinarum and Pullum, PCR was performed for each primer set shown in Table 1. Salmonella enteritidis, Typhimurium, Galinarum and Pululum were each incubated in Meconki agar medium, followed by genomic DNA extraction. PCR reaction with the PCR composition specified in Table 2, the heat treatment for 5 minutes at 95 ℃, denature DNA for 30 seconds at 95 ℃ (denaturation); Contacting with primers for 5 seconds at 58 ° C .; PCR amplification was carried out by repeating the synthesis of DNA for 40 seconds at 72 ° C. for 30 seconds, and the final DNA synthesis step was performed at 72 ° C. for 5 minutes. PCR amplification products after the reaction was subjected to electrophoresis on 1.5% agarose gel containing bromothidium (EtBr) to confirm the amplification products (Fig. 2 and 3). The size of the amplification product is shown in Table 1.

반응 혼합물Reaction mixture 10 × buffer (25mM MgCl2)10 × buffer (25mM MgCl 2 ) 22 dNTP (각 2mM)dNTP (2mM each) 22 프라이머 세트Primer set 1One 10 pmol10 pmol 22 33 44 55 66 주형 DNATemplate DNA 50 ng50 ng Taq 폴리머라제Taq polymerase 1 unit1 unit 총 20㎕20 μl total

도 2의 레인 1은 100 bp 크기의 표지 DNA size marker, 레인 2 내지 5는 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 1에 의해 증폭된 694 bp 크기의 증폭산물, 레인 6 내지 9는 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 2에 의해 증폭된 517 bp 크기의 증폭산물, 레인 10 내지 13은 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 3에 의해 증폭된 432 bp 크기의 증폭산물을 나타낸 것이다. 또한, 도 3의 레인 1은 100 bp 크기의 표지 DNA size marker, 레인 2 내지 5는 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 4에 의해 증폭된 326 bp 크기의 증폭산물, 레인 6 내지 9는 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 5에 의해 증폭된 204 bp 크기의 증폭산물, 레인 10 내지 13은 살모넬라 엔테리티디스(KCCM 12021), 살모넬라 티피뮤리움(ATCC 14028), 살모넬라 갈리나룸(ATCC 9184), 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 프라이머 세트 6에 의해 증폭된 103 bp 크기의 증폭산물을 나타낸 것이다Lane 1 of FIG. 2 is a 100 bp sized DNA marker, lanes 2 to 5 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028), Salmonella gallinarum (ATCC 9184), Salmonella pullulum ( 694 bp amplified product amplified by primer set 1 from genomic gene of ATCC 19945, lanes 6 to 9 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028), Salmonella gallinarum (ATCC 9184) ), A 517 bp amplified product amplified by primer set 2 from the genome gene of Salmonella pullulum (ATCC 19945), lanes 10 to 13 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028), It shows a 432 bp amplification product amplified by primer set 3 from the genome genes of Salmonella gallinarum (ATCC 9184) and Salmonella pullulum (ATCC 19945). In addition, lane 1 of FIG. 3 is a 100 bp sized DNA marker, lanes 2 to 5 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028), Salmonella gallinarum (ATCC 9184), Salmonella pullo 326 bp amplified product amplified by primer set 4 from the genomic gene of RUM (ATCC 19945), lanes 6 to 9 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028), Salmonella gallinarum ( ATCC 9184), a 204 bp amplified product amplified by primer set 5 from the genome gene of Salmonella pullulum (ATCC 19945), lanes 10 to 13 are Salmonella enteritidis (KCCM 12021), Salmonella typhimurium (ATCC 14028). ), Amplified by 103 bp amplified by primer set 6 from the genome genes of Salmonella gallinarum (ATCC 9184) and Salmonella pullulum (ATCC 19945).

이러한 실험 결과는 도 1에 나타난 모식도와 일치하며, 이를 통해 각 PCR 프라이머 세트가 매우 특이적으로 작용하는 것을 확인하였다.
These experimental results are consistent with the schematic diagram shown in Figure 1, through which it was confirmed that each PCR primer set is very specific.

실시예Example 3. 멀티플렉스  3. Multiplex PCRPCR 을 통한 특이성 확인Specificity through

살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸을 한번에 검출할 수 있는 멀티플렉스 PCR을 표1에서 제시한 각 프라이머 세트를 이용하여, 표 3에 기재된 PCR 조성으로 수행하였다. 멀티플렉스 PCR 반응은 95℃에서 5분간 열처리를 한 후, 95℃에서 30초간 DNA를 변성시키는 단계(denaturation); 58℃에서 5초간 프라이머와 접촉시키는 단계(annealing); 72℃에서 40초간 DNA를 합성하는 단계(extension)를 총 30회 반복하여 PCR 증폭을 실시하며, 마지막 DNA 합성단계는 72℃에서 5분간 실시하였다. 반응이 끝난 PCR 증폭 산물을 브로모에티듐(EtBr)이 포함된 1.5%의 아가로즈 겔에서 전기영동을 실시하여 증폭산물을 확인하였다 (도 4). 증폭산물의 크기는 표 1에 제시되어 있다. Multiplex PCR capable of detecting Salmonella enteritidis, Typhimurium, Galinarum, and Pullulum at one time was performed with the PCR compositions shown in Table 3, using each primer set shown in Table 1. The multiplex PCR reaction is subjected to heat treatment at 95 ° C. for 5 minutes, followed by denaturation of DNA at 95 ° C. for 30 seconds; Contacting with primers for 5 seconds at 58 ° C .; PCR amplification was carried out by repeating the synthesis of DNA for 40 seconds at 72 ° C. for 30 seconds, and the final DNA synthesis step was performed at 72 ° C. for 5 minutes. After the reaction, the PCR amplification product was subjected to electrophoresis on 1.5% agarose gel containing bromoetidium (EtBr) to confirm the amplification product (FIG. 4). The size of the amplification product is shown in Table 1.

반응 혼합물Reaction mixture 10 × buffer (25mM MgCl2)10 × buffer (25mM MgCl 2 ) 22 dNTP (각 2mM)dNTP (2mM each) 22 프라이머 세트Primer set 1One 5 pmol5 pmol 22 각 3 pmol3 pmol each 33 44 10 pmol10 pmol 55 5 pmol5 pmol 66 10 pmol10 pmol 주형 DNATemplate DNA 50 ng50 ng Taq 폴리머라제Taq polymerase 1 unit1 unit 총 20㎕20 μl total

도 4에서, 레인 1은 100 bp 크기의 표지 DNA size marker, 레인 2는 살모넬라 엔테리티디스(KCCM 12021)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 432, 326, 204, 103 bp 크기의 증폭산물, 레인 3은 살모넬라 티피뮤리움(ATCC 14028)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 517, 326, 103 bp 크기의 증폭산물, 레인 4는 살모넬라 갈리나룸(ATCC 9184)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 204 bp 크기의 증폭산물, 레인 5는 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 204 bp 크기의 증폭산물을 나타낸 것이다In FIG. 4, lane 1 is a 100 bp marker DNA size marker, lane 2 is 694, 432, 326, 204, 103 bp amplified by six pairs of primer sets from the genome gene of Salmonella enteritidis (KCCM 12021). Amplification product of size 3, lane 3 is a 694, 517, 326, 103 bp amplification product amplified by 6 sets of primers from the genome gene of Salmonella typhimurium (ATCC 14028), lane 4 is Salmonella gallinarum (ATCC) 694, 204 bp amplified product amplified by 6 pairs of primer sets from genomic gene of 9184, lane 5 is 694, 326 amplified by 6 sets of primers from genomic gene of Salmonella pullulum (ATCC 19945). , Amplification products of 204 bp are shown.

이러한 실험 결과는 도 1에 나타난 모식도와 일치하며, 이를 통해 각 PCR 프라이머 세트가 멀티플렉스 PCR 조건에서 매우 특이적으로 작용하는 것을 확인하였다.
This experimental result is consistent with the schematic diagram shown in Figure 1, through which it was confirmed that each PCR primer set is very specific in the multiplex PCR conditions.

실시예Example 4. 살모넬라 및 기타  4. Salmonella and others 세균성질병의Bacterial diseases 주요  main 원인균간의Causative agent 검출 특이성 확인 Detection specificity confirmation

닭을 포함하는 가축의 세균성질병의 주요 원인균들과 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸 등 상기 4종의 살모넬라와의 구분이 가능한 지 확인하기 위하여, 실시예 3과 동일한 방법으로 멀티플렉스 PCR을 수행하였다. In order to check whether the main causes of bacterial diseases of livestock including chickens and Salmonella enteritidis, Typhimurium, Galinarum and Pulumum can be distinguished from the four kinds of Salmonella, in the same manner as in Example 3 Multiplex PCR was performed.

표1에서 각 프라이머 세트를 이용하여, 표 3에 기재된 PCR 조성으로 수행하였다. 이 때 반응이 끝난 PCR 증폭 산물을 브로모에티듐(EtBr)이 포함된 1.5%의 아가로즈 겔에서 전기영동을 실시하여 증폭산물을 확인하였다 (도 5). 증폭산물의 크기는 표 1에 제시되어 있다. Each primer set in Table 1 was used to perform the PCR compositions described in Table 3. At this time, the amplified product was confirmed by performing electrophoresis on the finished PCR amplification product in 1.5% agarose gel containing bromoetidium (EtBr) (FIG. 5). The size of the amplification product is shown in Table 1.

도 5에서, 레인 1은 100 bp 크기의 표지 DNA size marker, 레인 2는 살모넬라 엔테리티디스(KCCM 12021)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 432, 326, 204, 103 bp 크기의 증폭산물, 레인 3은 살모넬라 티피뮤리움(ATCC 14028)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 517, 326, 103 bp 크기의 증폭산물, 레인 4는 살모넬라 갈리나룸(ATCC 9184)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 204 bp 크기의 증폭산물, 레인 5는 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 204 bp 크기의 증폭산물을 나타낸 것이다. 또한, 레인 6은 에스체리카아 콜라이(Escherichia coli, ATCC 25922), 레인 7은 스트렙토코커스 파이오제네스(Streptococcus pyogenes, KCTC 3096), 레인 8은 파스튜렐라 멀토시다(Pasteurella multocida, KVCC-BA0001831), 레인 9는 클로스트리디움 퍼프린젠스 타입A(Clostridium perfringens Type A, KTCC 3269), 레인 10은 클로스트리디움 퍼프린젠스 타입C(Clostridium perfringens Type C, ATCC 3628), 레인 11은 마이코플라즈마 갈리나룸(Mycoplasma gallinarum, ATCC 19708), 레인 12는 마이코플라즈마 시노비애(Mycoplasma synoviae, ATCC 25204) 를 확인한 결과이다.In FIG. 5, lane 1 is a 100 bp marker DNA size marker, lane 2 is 694, 432, 326, 204, 103 bp amplified by six pairs of primer sets from the genome gene of Salmonella enteritidis (KCCM 12021). Amplification product of size 3, lane 3 is a 694, 517, 326, 103 bp amplification product amplified by 6 sets of primers from the genome gene of Salmonella typhimurium (ATCC 14028), lane 4 is Salmonella gallinarum (ATCC) 694, 204 bp amplified product amplified by 6 pairs of primer sets from genomic gene of 9184, lane 5 is 694, 326 amplified by 6 sets of primers from genomic gene of Salmonella pullulum (ATCC 19945). , Amplification products of 204 bp size are shown. Lane 6 also shows Escherichia coli. coli , ATCC 25922), lane 7 is Streptococcus pyogenes (KCTC 3096), lane 8 is Pasteurella multocida ( Pasteurella) multocida, KVCC-BA0001831), lane 9 is Clostridium perfringens type A (Clostridium perfringens Type A, KTCC 3269), lane 10 Clostridium perfringens Type C (Clostridium perfringens Type C, ATCC 3628), lane 11 is Mycoplasma gallinarum gallinarum , ATCC 19708), lane 12 is Mycoplasma synoviae , ATCC 25204).

도 5에 나타낸 바와 같이, 레인 6 내지 레인 12의 세균에서는 본 발명에서 개발된 멀티플렉스 PCR에 의해 증폭산물이 나타나지 않았다. 이를 통해 본 발명의 프라이머가 가축 세균성질병의 주요 원인균들과 구분되어 4종의 살모넬라를 특이적으로 검출할 수 있음을 확인하였다.
As shown in Figure 5, in the bacteria of lanes 6 to 12, the amplification products did not appear by the multiplex PCR developed in the present invention. Through this, it was confirmed that the primer of the present invention can be distinguished from the main causative organisms of livestock bacterial diseases to specifically detect four kinds of Salmonella.

실시예Example 5. 기타 살모넬라와의 검출 특이성 확인 5. Confirmation of detection specificity with other Salmonella

살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸 등 상기 4종의 살모넬라 및 상기 4종의 살모넬라와 같은 서브스페시스에 속하는 살모넬라들과 구분이 가능한 지 확인하기 위하여, 실시예 3과 동일한 방법으로 멀티플렉스 PCR을 수행하였다. The same method as in Example 3 to determine whether Salmonella enteridis, Typhimurium, Galinarum and Pulumum can be distinguished from Salmonella belonging to the four kinds of Salmonella and subspecs such as the four Salmonella Multiplex PCR was performed.

표1에서 각 프라이머 세트를 이용하여, 표 3에 기재된 PCR 조성으로 수행하였다. 이 때 반응이 끝난 PCR 증폭 산물을 브로모에티듐(EtBr)이 포함된 1.5%의 아가로즈 겔에서 전기영동을 실시하여 증폭산물을 확인하였다 (도 6). 증폭산물의 크기는 표 1에 제시되어 있다. Each primer set in Table 1 was used to perform the PCR compositions described in Table 3. At this time, the amplified product was confirmed by performing electrophoresis on the finished PCR amplification product in 1.5% agarose gel containing bromoetidium (EtBr) (FIG. 6). The size of the amplification product is shown in Table 1.

도 6에서, 레인 1은 100 bp 크기의 표지 DNA size marker, 레인 2는 살모넬라 엔테리티디스(KCCM 12021)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 432, 326, 204, 103 bp 크기의 증폭산물, 레인 3은 살모넬라 티피뮤리움(ATCC 14028)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 517, 326, 103 bp 크기의 증폭산물, 레인 4는 살모넬라 갈리나룸(ATCC 9184)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 204 bp 크기의 증폭산물, 레인 5는 살모넬라 풀로룸(ATCC 19945)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 204 bp 크기의 증폭산물, 레인 6은 살모넬라 하이델베르그(Salmonella heidelberg, KVCC-BA0000506)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 103 bp 크기의 증폭산물, 레인 7은 살모넬라 센프텐베르그(Salmonella senftenberg, KVCC-BA0000590)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 103 bp 크기의 증폭산물, 레인 8은 살모넬라 인판티스(Salmonella infantis, KVCC-BA0000469)의 게놈 유전자로부터 6쌍의 프라이머 세트에 의해 증폭된 694, 326, 103 bp 크기의 증폭산물을 나타낸 것이다In FIG. 6, lane 1 is a 100 bp marker DNA size marker, and lane 2 is 694, 432, 326, 204, and 103 bp amplified by six pairs of primer sets from the genome gene of Salmonella enteritidis (KCCM 12021). Amplification product of size 3, lane 3 is a 694, 517, 326, 103 bp amplification product amplified by 6 sets of primers from the genome gene of Salmonella typhimurium (ATCC 14028), lane 4 is Salmonella gallinarum (ATCC) 694, 204 bp amplified product amplified by 6 pairs of primer sets from genomic gene of 9184, lane 5 is 694, 326 amplified by 6 sets of primers from genomic gene of Salmonella pullulum (ATCC 19945). , 204 bp amplification product, lane 6 is a 694, 326, 103 bp amplification product amplified by 6 sets of primers from the genome gene of Salmonella heidelberg (KVCC-BA0000506), lane 7 is Salmonella sen Petenberg ( Salmonella senftenberg, amplification products, lanes 8, of the 694, 326, 103 bp size amplified by the primer set of six pairs from the genome of gene KVCC-BA0000590) is Salmonella Infante tooth (Salmonella infantis, shows the 694, 326, the amplification product of 103 bp size amplified by the primer set of six pairs from the genome of gene KVCC-BA0000469)

이를 통해 본 발명의 프라이머를 이용할 경우, 살모넬라 엔테리티디스, 티피뮤리움, 갈리나룸 및 풀로룸과 같은 서브스페시스에 속하는 살모넬라들과 구분되어 특이적으로 검출할 수 있음을 확인하였다.
Through this, it was confirmed that when using the primer of the present invention, Salmonella belonging to subspecs such as Salmonella enteritidis, Tipimurium, Galinarum and Pullum, can be specifically detected.

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> PCR primer for detecting Salmonella <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 1 aattatcgcc acgttcgggc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 2 tttaggtttg gcggcgctac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 3 gcgcgtccac cacagataac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 4 cggtccatca tccgacggaa 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 5 tgtagcgggt catagtggct g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 6 ccagtcacct ccgccaaact 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 7 tgaaaaacag cagaagaagc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 8 gaacagtgtt tccctgtcct 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 9 tggtggtgta gccactgtcc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 10 gcagtgaaag tacctgctgg c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 11 ggacgtcatt gtcactaacc 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer for Salmonella <400> 12 tattaatcca gcccccttc 19 <110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> PCR primer for detecting Salmonella <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 1 aattatcgcc acgttcgggc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 2 tttaggtttg gcggcgctac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 3 gcgcgtccac cacagataac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 4 cggtccatca tccgacggaa 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 5 tgtagcgggt catagtggct g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 6 ccagtcacct ccgccaaact 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 7 tgaaaaacag cagaagaagc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 8 gaacagtgtt tccctgtcct 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 9 tggtggtgta gccactgtcc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 10 gcagtgaaag tacctgctgg c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 11 ggacgtcatt gtcactaacc 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> Primer for Salmonella <400> 12 tattaatcca gcccccttc 19

Claims (5)

서열번호 1 내지 12의 염기서열로 이루어진 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 프라이머 세트.
Salmonella Entebbe utility consisting of SEQ ID NO: 1 to a 12-nucleotide sequence display (Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella set of primers for simultaneous detection of pullorum ).
제1항의 프라이머 세트를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 조성물.
The Salmonella Entebbe utility including a primer set of claim 1. Display (Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella pullorum ) composition for simultaneous detection.
제2항의 조성물을 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 의 동시 검출용 키트.
The Salmonella Entebbe utility composition of claim 2 comprising a display (Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium , Salmonella gallinarum ) and Salmonella pullorum for the simultaneous detection of the kit.
(a) 시료로부터 게놈 DNA를 추출하는 단계 및 (b) 추출된 게놈 DNA를 주형으로 하고, 제1항의 프라이머 세트를 이용하여 PCR을 수행하는 단계;를 포함하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 을 동시에 검출하는 방법.
(a) extracting genomic DNA from the sample, and (b) the genomic DNA extracted as a template, the primer set of claim 1 by using a step of performing PCR; Display Orientation utility Salmonella containing (Salmonella enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum and Salmonella pullorum ).
제 4항에 있어서, (c) 상기 (b)단계에서 증폭된 산물을 검출하는 단계;를 더 포함하는 것을 특징으로 하는 살모넬라 엔테리티디스(Salmonella enteritidis), 살모넬라 티피뮤리움(Salmonella typhymurium), 살모넬라 갈리나룸(Salmonella gallinarum) 및 살모넬라 풀로룸(Salmonella pullorum) 을 동시에 검출하는 방법.According to claim 4, Salmonella enteritidis ( Salmonella) characterized in that it further comprises; (c) detecting the product amplified in step (b) enteritidis), Salmonella typhimurium (Salmonella typhymurium), Salmonella Galina Room (Salmonella gallinarum), and Salmonella pool room (Salmonella pullorum ).
KR1020110118733A 2011-11-15 2011-11-15 PCR primer for detecting Salmonella KR101282924B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110118733A KR101282924B1 (en) 2011-11-15 2011-11-15 PCR primer for detecting Salmonella

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110118733A KR101282924B1 (en) 2011-11-15 2011-11-15 PCR primer for detecting Salmonella

Publications (2)

Publication Number Publication Date
KR20130055040A true KR20130055040A (en) 2013-05-28
KR101282924B1 KR101282924B1 (en) 2013-07-05

Family

ID=48663623

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110118733A KR101282924B1 (en) 2011-11-15 2011-11-15 PCR primer for detecting Salmonella

Country Status (1)

Country Link
KR (1) KR101282924B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107619872A (en) * 2017-11-10 2018-01-23 四川大学 A kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum
KR20180015945A (en) 2016-08-04 2018-02-14 광운대학교 산학협력단 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device
CN116622872A (en) * 2023-07-05 2023-08-22 江苏省家禽科学研究所 Salmonella gallinarum molecular detection kit and non-diagnostic detection method thereof

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180015945A (en) 2016-08-04 2018-02-14 광운대학교 산학협력단 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device
CN107619872A (en) * 2017-11-10 2018-01-23 四川大学 A kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum
CN107619872B (en) * 2017-11-10 2021-07-16 四川大学 PCR primer and method capable of detecting salmonella and identifying salmonella pullorum
CN116622872A (en) * 2023-07-05 2023-08-22 江苏省家禽科学研究所 Salmonella gallinarum molecular detection kit and non-diagnostic detection method thereof
CN116622872B (en) * 2023-07-05 2023-12-01 江苏省家禽科学研究所 Salmonella gallinarum molecular detection kit and non-diagnostic detection method thereof

Also Published As

Publication number Publication date
KR101282924B1 (en) 2013-07-05

Similar Documents

Publication Publication Date Title
Pestana et al. Early, rapid and sensitive veterinary molecular diagnostics-real time PCR applications
WO2016180037A1 (en) COMPOSITIONS AND METHODS FOR DETECTING PATHOGENS IN RESPIRATORY TRACT INFECTIONs
KR101823353B1 (en) Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit
US7888014B2 (en) Method of detecting Haemophilus influenzae type b, primer set and kit for the use in the method
KR102030244B1 (en) Oligonucleotide set for detection of dengue virus and uses thereof
KR101282924B1 (en) PCR primer for detecting Salmonella
KR101288035B1 (en) Primer set for discrimination of Brucella
WO2012087135A1 (en) Genetic markers specific for clostridium difficile ribotypes 027 (nap01/b1; rt 027) and 078 (nap7/8; rt 078) and their use
JP2005511014A (en) Rapid and specific detection of Campylobacter
KR101373756B1 (en) Primers for molecular identification of Staphylococcus aureus and method for identifying Staphylococcus aureus using the same
WO2021201091A1 (en) Primer set and probe for detecting klebsiella bacteria
KR102209281B1 (en) Simultaneous Pathogen Genes Detection Kit of Porcine Respiratory Complex Syndrome and diagnosis method of using this Detection Kit
CA2590399A1 (en) Methods and compositions for detecting bacillus anthracis
EP2839025B1 (en) Compositions and methods for detection of microorganisms of the mycobacterium avium complex excluding mycobacterium avium paratuberculosis
EP2834369B1 (en) Compositions and methods for detection of mycobacterium avium paratuberculosis
KR101308515B1 (en) Primer set and method for detecting trichomonas vaginalis
Fakruddin et al. Competitiveness of polymerase chain reaction to alternate amplification methods
KR101911017B1 (en) Composition for Detecting Taylorella equigenitalis, Composition for Diagnosing Contagious Equine Metritis Caused by Taylorella equigenitalis Infection, Method of Detecting Taylorella equigenitalis, and Method of Diagnosing Contagious Equine Metritis Caused by Taylorella equigenitalis Infection
JP5110423B2 (en) Microbe identification method, primer used in the method, and identification kit
KR102655121B1 (en) A Primer set for specifically detecting Lactobacillus sakei K040706 and uses thereof
KR101700622B1 (en) A DNA marker for breed discrimination of dog and discriminating method using the same
JP2004344065A (en) Oligonucleotide and method for detecting mycobacterium tuberculosis group using the same
KR101492989B1 (en) PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis
WO2003062463A2 (en) One-step multiplex pcr for the identification and differentiation of campylobacter species
Mohammed et al. Review on polymerase chain reaction and its diagnostic merit over conventional techniques in animal disease

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160627

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180627

Year of fee payment: 6