KR101492989B1 - PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis - Google Patents

Abstract

The present invention relates to an endogenous PCR primer of a Chinese cabbage crop using HRM analysis technology, a PCR kit for HRM analysis for selecting high temperature stress resistance and susceptible Chinese cabbage including the primer set, and a whole DNA sample And performing high resolution melting (HRM) analysis using the amplified sample. The present invention also relates to a method for selecting high temperature stress resistant and susceptible Chinese cabbage. The primer set according to the present invention is a PCR primer set for HRM analysis which can confirm the presence or absence of a related genetic factor in the high temperature stress resistance and susceptibility of a Chinese cabbage without a phenotype and DNA sequence analysis. High temperature resistance and susceptibility related genotypes of strains can be distinguished at a short time and at a low cost, so that the development and breeding of cabbage varieties can be improved efficiently.

Description

(PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis)

The present invention relates to a primer set for screening high-temperature stress-resistant and susceptible Chinese cabbage using HRM analysis technology.

When a new breed is developed using the traditional breeding method, the desired trait is selected as a phenotyping test. However, phenotype testing can be difficult or time-consuming. In addition, unwanted traits can be introduced in the selection process. Therefore, selection and elimination in the breeding process should be done simultaneously in different traits, but simultaneous testing of many phenotypes is a difficult task. The development of molecular markers in these areas can replace the phenotyping step with marker validation. Therefore, the development of molecular markers that can easily and quickly carry out the step of phenotyping test is essential for establishing the breeding technology.

The development of molecular markers located in or near to genes resistant to high-temperature stress in Chinese cabbage crops has the advantage of developing varieties at a low cost in a short period of time by incorporating molecular marker utilization techniques into traditional breeding techniques. It is an area that should be.

On the other hand, high resolution melting (HRM) analysis technology is a relatively new post-PCR analysis method used to identify variations in nucleic acid sequences. This method is based on detecting small differences in the PCR dissociation curve. This is made possible by the improved dsDNA with the dye used in conjunction with the RT-PCR instrument. The difference in degree of dissociation according to the temperature of dsDNA is analyzed and processed using specially designed software for HRM analysis. In the present invention, HRM analysis was used to select hot stress resistant and susceptible Chinese cabbage.

The present inventors analyzed the nucleotide sequences of the Chinese cabbage high temperature resistant strain, 92 and the high temperature susceptible strain, 93 using the Chinese cabbage-associated Z08-420 nucleotide sequence identified through previous studies, and found a total of four single nucleotide polymorphisms (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOS: 7 and 8) capable of PCR amplification including these polymorphic regions in order to confirm single nucleotide polymorphism (SNP) .

It is an object of the present invention to provide a set of primers for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8.

It is another object of the present invention to provide a PCR kit for HRM analysis for screening high temperature stress resistant and susceptible Chinese cabbages comprising the primer set.

It is still another object of the present invention to provide a high-temperature stress resistance and susceptible Chinese cabbage screening method through HRM (High Resolution Melting) using the primer set.

The present invention provides a set of primers for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOs: 5 and 6 or SEQ ID NOs: 7 and 8.

Another object of the present invention is to provide a PCR kit for HRM analysis for selecting high temperature stress resistant and susceptible Chinese cabbages comprising the primer set.

Another object of the present invention is to provide a high-stress resistance and susceptible Chinese cabbage screening method using a high resolution melting (HRM) analysis technique using the primer set.

Another object of the present invention is to provide a probe for screening a high temperature stress resistant or susceptible Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 3 or 4, or a complementary base sequence thereof.

Still another object of the present invention is to provide a microarray for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 or 4, a polypeptide encoded thereby, or a cDNA thereof.

The primer set of the present invention is a PCR primer set for HRM analysis that can confirm the presence or absence of a related genetic factor in the high temperature stress resistance and susceptibility of a Chinese cabbage without a phenotype and DNA base sequence analysis. Using the primer set, 92 system and 93 system The high temperature resistance and susceptibility related genotypes can be distinguished at a short time and at a low cost, and the development and breeding of cabbage can be efficiently improved.

1 is a diagram showing the nucleotide sequence of a Chinese cabbage high temperature resistant strain (line 92) using the nucleotide sequence of SEQ ID NO: 3. Red and bold letters indicate single nucleotide polymorphism locus (SNP). W represents A and T, M represents A and C, and R represents A and G.
2 is a diagram showing the nucleotide sequences of the Chinese cabbage high temperature resistant strain (line 92) and susceptible line (line 93) using the nucleotide sequence of SEQ ID NO: 4. Red and bold letters indicate single nucleotide polymorphic loci. W represents A and T, M represents A and C, and R represents A and G.
FIG. 3 is a graph showing the results of analysis using the HRM technique for the Chinese cabbage resistance and susceptibility genotypes using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6.
FIG. 4 is a graph showing the results of analysis using the HRM technique for the Chinese cabbage resistance and susceptibility genotypes using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 7 and 8.

The present invention provides a primer set for high temperature stress tolerance and susceptible Chinese cabbage using the high resolution melting (HRM) analysis technique of SEQ ID NOs: 5 and 6, or SEQ ID NOs: 7 and 8.

Hereinafter, the present invention will be described in detail.

In the present invention, the resistance to internal resistance of the Chinese cabbage resistance gene (92), the resistance gene of internal resistance (93), and 91 kinds of F2 groups generated by the hybridization of 92 and 93 strains (SEQ ID NO: 3) and the nucleotide sequence of 93 lines (SEQ ID NO: 4) were compared and analyzed using the sequences (Z08-420; SEQ ID NOS: 3 and 4) (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOs: 5 and 6) that can be amplified by PCR, including these single nucleotide polymorphisms, 7 and 8). Using the above primer sets, PCR amplification was performed on whole DNAs of 92 and 93 strains, and a primer set capable of distinguishing high temperature resistance and susceptibility related genotypes using HRM technology was completed. It was confirmed that the primer set and the marker can be used as a PCR kit or a molecular marker for searching for a selection molecule in the cultivation of endosperm cabbage cultivars.

As used herein, the term 'primer' refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different dNTPs (deoxynucleoside triphosphate) at appropriate buffer solutions and temperatures.

Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish oxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (such as biotin), and the like.

In the present invention, "screening" means selecting a Chinese cabbage having a specific phenotype.

The PCR kit for screening the high temperature stress-tolerant and susceptible Chinese cabbage may include, in addition to the above-described primer set, conventional components included in the PCR kit. Typical components included in the kit may be reaction buffers, polymerases, dNTPs (dATP, dCTP, dGTP and dTTP), and joins such as Mg ²⁺ . A variety of DNA polymerases can be used in the amplification step of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu) . Most of these enzymes can be isolated from the bacteria itself or commercially available. In addition, the polymerase used in the present invention can be obtained from cells expressing high levels of the cloning gene encoding the polymerase. When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component.

All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.

Also,

1) performing PCR by mixing primers consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8 and whole DNA samples extracted from Chinese cabbage; And

2) performing HRM (High-resolution melting) using the amplified sample of step 1), and a method for selecting high-temperature stress-resistant and susceptible Chinese cabbage.

The present invention can also be used as a probe for high temperature stress resistance and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOS: 3 and 4, or a complementary base sequence thereof. In the present invention, 'probe' refers to a hybridization probe, and refers to an oligonucleotide capable of binding sequence-specifically to the complementary strand of a nucleic acid. Using this, the genomic DNA of the Chinese cabbage can be extracted, and the nucleotide sequence of SEQ ID NO: 3 or 4 or a complementary base sequence thereof can be hybridized with the genome DNA of the Chinese cabbage as a probe. In the case of high temperature stress resistant Chinese cabbage, the Chinese cabbage hybridized by the nucleotide sequence of SEQ ID NO: 3 or 4 can be determined by high temperature stress resistant Chinese cabbage.

In the present invention, SNP (Single Nucleotide Polymorphism) is the most common form of DNA sequence polymorphism due to a difference in single base-pair variation in DNA between individuals and individuals.

The nucleotide sequence of SEQ ID NO: 3 or 4 is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a SNP in a polynucleotide sequence. The polynucleotide may be DNA or RNA.

In addition, a microarray comprising the nucleotide sequence of SEQ ID NO: 3 or 4 or the complementary base sequence of the nucleotide sequence of the present invention can be provided. The microarray according to the present invention can be produced by a conventional method known to those skilled in the art.

For example, the nucleotide can be immobilized on a substrate coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde. In addition, the substrate may be selected from the group consisting of a silicon wafer, glass, quartz, metal, and plastic. The method of immobilizing the polynucleotide on a substrate may be a micropipetting method using a piezoelectric method or a method using a pin-type spotter.

Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.

Example 1 Preparation of Markers for Selection of Hot Stress-Resistant Chinese Cabbage

1. High temperature stress resistance system (92) and susceptible line (93) Whole DNA extraction of Chinese cabbage

The leaves of the cabbage were harvested from 92 and 93 individuals and then lyophilized and extracted with CTAB (Cetyl trimethylammonium bromide) method.

More specifically, the harvested 92-line and 93-line Chinese cabbage leaves were pulverized by a pulverizer for 15 minutes, followed by pulverization with a pulverizer for 15 minutes, followed by preheating at 65 ° C for 10 minutes in a water bath. To this was added 250 5 of 5M ammonium acetate, followed by centrifugation for 10 minutes. Only the supernatant was taken and 900 차 of cold ethanol was added. The thus-extracted extract was placed at -70 ° C for 10 minutes. After 10 minutes of centrifugation, it was dried with alcohol and then distilled water was added. The concentration of the DNA thus extracted was measured using a spectrophotometer, and the final concentration was diluted to 10 ng / μl.

2. PCR amplification of extracted 92 strains and 93 DNA-based cabbages

The primers (CCTGTCATAGTTAGCTACCC) of SEQ ID NO: 1 and the primers of SEQ ID NO: 2 (TGGGAGGAGAGCCAGTTTC) were amplified by PCR using whole DNA of 92 and 93 lines. PCR was carried out using a total amount of 15 μl (6.02 μl of distilled water, 0.4 μl of dNTP (10 mM), 1 unit of Etaq polymerase, 1.5 μl of 10 × etaq buffer, 2 μl of primer (0.7 μM) The PCR was performed at 95 ° C. for 3 minutes, at 95 ° C. for 20 seconds, at 52 ° C. for 30 seconds, and at 72 ° C. for 1 minute, and the PCR primer of the present invention including the above primer sequence and the Chinese cabbage high temperature resistance and susceptibility marker sequence Z08- 420 are shown in Table 1. < tb > < TABLE >

SEQ ID NO: designation Base sequence SEQ ID NO: 1 Forward PCR primer CCTGTCATAGTTAGCTACCC SEQ ID NO: 2 Reverse PCR primer TGGGAGGAGAGCCAGTTTC SEQ ID NO: 3 Chinese cabbage high temperature resistance marker sequence 1 SEQ ID NO: 4 Cabbage high-sensitivity marker base sequence 2 SEQ ID NO: 5 Ht-2-1 forward primer ATCTTGGCCCAGCACGGCC SEQ ID NO: 6 Ht-2-1 reverse primer TGGGAGGAGAGCCAGTTTC SEQ ID NO: 7 Ht-2-2 forward primer TTCCTTTTGGGATCTTGGCTG SEQ ID NO: 8 Ht-2-2 reverse primer TGGGAGGAGAGCCAGTTTC

3. Sequence analysis of amplified DNA

The nucleotide sequences of the amplified 92 and 93 PCR DNA were analyzed and the results are shown in FIGS. 1 and 2. FIG.

As shown in Figures 1 and 2, single nucleotide polymorphism (SNP) positions were identified at four locations in total. However, it was confirmed that two kinds of nucleotide sequences exist in all four regions in the case of the 92 strain, and single nucleotide sequences exist in the case of the 93 strain in the same position.

[Example 2] HRM (high resolution melting) analysis using the primer set of the present invention

PCR amplification was performed using Ht-2-1 (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOS: 7 and 8) primer sets for HRM analysis. PCR conditions were as follows: PCR was performed using a total amount of 15 μl (6.02 μl of distilled water, 0.4 μl of dNTP (10 mM), 1 unit of Etaq Polymerase, 1.5 μl of 10 × ethanol buffer, 2 μl of primer (0.7 μM) PCR was performed at 95 ° C for 3 minutes, at 95 ° C for 20 seconds, at 52 ° C for 30 seconds, and at 72 ° C for 1 minute, and repeated 40 times. After PCR amplification, 0.3 μl of the fluorescent material, evagreen dye, HRM analysis was carried out using a light scanner (Idaho Technology Inc. USA) after the addition of the sample. The sample was heated at a melting rate of 0.1 ^o C s- the degree of fluorescence ¹⁾ were measured. results thereof are shown in Figures 3 and 4. as shown in Figs. 3 and 4, Ht-2-1 primer set of the present invention (SEQ ID NO: 5 and 6) and Ht- 2-2 primer set (SEQ ID NOS: 7 and 8), it is possible to distinguish between high temperature resistance and susceptibility related genotypes in 92 and 93 strains Respectively.

<110> Dongguk University Industry-Academic Cooperation Foundation <120> PCR primer set related to heat stress tolerance in Chinese          cabbage using HRM analysis <130> DK-1.105P <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chinese cabbage PCR forward primer <400> 1 cctgtcatag ttagctaccc 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> chinese cabbage PCR forward primer <400> 2 tgggaggaga gccagtttc 19 <210> 3 <211> 348 <212> DNA <213> chinese cabbage 92 marker sequence <400> 3 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agwatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg mggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac taccmatrtg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 4 <211> 348 <212> DNA <213> chinese cabbage 93 marker sequence <400> 4 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agaatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg cggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac tacccatatg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 5 atcttggccc agcacggcc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 reverse primer <400> 6 tgggaggaga gccagtttc 19 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 7 ttccttttgg gatcttggct g 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 8 tgggaggaga gccagtttc 19

Claims (7)

A set of primers for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOs: 5 and 6, or SEQ ID NOs: 7 and 8. The method according to claim 1, wherein the base sequence amplified by the nucleotide sequence of SEQ ID NO: 5 or 6 or SEQ ID NO: 7 or 8 is the nucleotide sequence of SEQ ID NO: 3 or 4, Primer set. A PCR kit for HRM analysis for screening high temperature stress resistant and susceptible Chinese cabbages comprising the primer set of claim 1. 1) performing PCR by mixing primers consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8 and whole DNA samples extracted from Chinese cabbage; And
2) performing high resolution melting (HRM) analysis using the amplified sample of step 1). 3, 4, or a complementary base sequence thereof. 6. The high-temperature stress and susceptible Chinese cabbage screening probe according to claim 5, wherein the nucleotide sequence of SEQ ID NO: 3 or 4 is a base sequence amplified by a primer consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2. A microarray for high temperature stress-tolerant and susceptible Chinese cabbage comprising nucleotides consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4.

Images