KR101492989B1 - PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis - Google Patents
PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis Download PDFInfo
- Publication number
- KR101492989B1 KR101492989B1 KR20130030873A KR20130030873A KR101492989B1 KR 101492989 B1 KR101492989 B1 KR 101492989B1 KR 20130030873 A KR20130030873 A KR 20130030873A KR 20130030873 A KR20130030873 A KR 20130030873A KR 101492989 B1 KR101492989 B1 KR 101492989B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- chinese cabbage
- primer set
- hrm
- analysis
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
Abstract
본 발명은 HRM 분석기술을 이용한 배추작물의 내서성 연관 PCR 프라이머, 상기 프라이머 세트를 포함하는 고온 스트레스 저항성 및 감수성 배추를 선별하기 위한 HRM 분석용 PCR 키트, 및 상기 프라이머 세트와 배추로부터 추출한 전체 DNA 시료를 혼합하여 PCR을 수행하여 증폭된 시료를 이용하여 HRM(High resolution melting) 분석을 수행하는 단계를 포함하는, 고온 스트레스 저항성 및 감수성 배추 선별방법에 관한 것이다. 본 발명에 따른 프라이머 세트는 배추 작물의 고온 스트레스 저항성 및 감수성에 연관 유전 인자의 유무를 표현형 및 DNA 염기서열 분석 없이 확인할 수 있는 HRM 분석용 PCR 프라이머 세트로서, 상기 프라이머 세트를 이용하여 92계통과 93계통의 고온 저항성 및 감수성 연관 유전자형을 빠른 시간에 적은 비용으로 구분할 수 있어 배추 품종 개발 및 육종을 효율적으로 개선할 수 있다. The present invention relates to an endogenous PCR primer of a Chinese cabbage crop using HRM analysis technology, a PCR kit for HRM analysis for selecting high temperature stress resistance and susceptible Chinese cabbage including the primer set, and a whole DNA sample And performing high resolution melting (HRM) analysis using the amplified sample. The present invention also relates to a method for selecting high temperature stress resistant and susceptible Chinese cabbage. The primer set according to the present invention is a PCR primer set for HRM analysis which can confirm the presence or absence of a related genetic factor in the high temperature stress resistance and susceptibility of a Chinese cabbage without a phenotype and DNA sequence analysis. High temperature resistance and susceptibility related genotypes of strains can be distinguished at a short time and at a low cost, so that the development and breeding of cabbage varieties can be improved efficiently.
Description
본 발명은 HRM 분석기술을 이용한 고온 스트레스 저항성 및 감수성 배추 선별용 프라이머 세트에 관한 것이다. The present invention relates to a primer set for screening high-temperature stress-resistant and susceptible Chinese cabbage using HRM analysis technology.
전통육종 방법을 사용하여 새로운 품종을 개발할 때 원하는 형질을 표현형 검정과정으로 선발하게 된다. 하지만 표현형 검정이 어렵거나 긴 시간을 요구하기도 한다. 또한 선발과정에서 원치 않는 형질도 같이 도입될 수 있다. 그러므로 육종과정에서 선발과 제거는 여러 형질에서 동시에 이루어져야 하지만 많은 표현형의 동시검정은 어려운 과제이다. 이러한 부분에서 분자마커의 개발은 표현형 검정 단계를 마커 확인으로 대신할 수 있다. 따라서 표현형 검정의 단계를 쉽고 빠르게 진행할 수 있는 분자마커의 개발이 품종개발 기술 확립에 필수적이다.When a new breed is developed using the traditional breeding method, the desired trait is selected as a phenotyping test. However, phenotype testing can be difficult or time-consuming. In addition, unwanted traits can be introduced in the selection process. Therefore, selection and elimination in the breeding process should be done simultaneously in different traits, but simultaneous testing of many phenotypes is a difficult task. The development of molecular markers in these areas can replace the phenotyping step with marker validation. Therefore, the development of molecular markers that can easily and quickly carry out the step of phenotyping test is essential for establishing the breeding technology.
배추작물에 있어서 고온 스트레스에 저항성을 가지는 유전자에 위치하거나 또는 가까이 인접한 분자마커의 개발은 전통육종 기술에 분자마커 활용 기술을 접목하여 빠른 시간에 적은 비용으로 품종을 개발할 수 있는 장점을 가지므로 반드시 개발되어야 할 분야이다. The development of molecular markers located in or near to genes resistant to high-temperature stress in Chinese cabbage crops has the advantage of developing varieties at a low cost in a short period of time by incorporating molecular marker utilization techniques into traditional breeding techniques. It is an area that should be.
한편, HRM(high resolution melting) 분석 기술은 핵산 서열에서의 변이를 확인하기 위해 사용된 상대적으로 새로운 포스트 PCR 분석 방법이다. 이 방법은 PCR 해리곡선에서 작은 차이를 감지하는 것을 기초로 한다. 이것은 RT-PCR 기기와 연결되어 사용된 염료를 갖는 보다 개선된 dsDNA에 의해 가능하게 된다. dsDNA의 온도에 따른 해리 정도의 차이를 HRM 분석을 위해, 특이적으로 고안된 소프트웨어를 사용하여 데이터를 분석하고 처리한다. 본 발명에서는 고온 스트레스 저항성 및 감수성 배추를 선별하기 위해서 HRM 분석을 사용하였다. On the other hand, high resolution melting (HRM) analysis technology is a relatively new post-PCR analysis method used to identify variations in nucleic acid sequences. This method is based on detecting small differences in the PCR dissociation curve. This is made possible by the improved dsDNA with the dye used in conjunction with the RT-PCR instrument. The difference in degree of dissociation according to the temperature of dsDNA is analyzed and processed using specially designed software for HRM analysis. In the present invention, HRM analysis was used to select hot stress resistant and susceptible Chinese cabbage.
본 발명자는 선행연구를 통해서 확인된 배추 내서성 연관 Z08-420 염기서열을 이용하여 배추 고온 저항성 계통, 92와 고온 감수성 계통, 93의 염기서열을 분석하여 비교한 후 총 4개의 단일염기서열다형성(single nucleotide polymorphism, SNP) 위치를 확인하고 이들 다형성 지역을 포함하여 PCR 증폭이 가능한 프라이머 세트 Ht-2-1(서열번호 5 및 6)과 Ht-2-2(서열번호 7 및 8)를 완성하게 되었다.
The present inventors analyzed the nucleotide sequences of the Chinese cabbage high temperature resistant strain, 92 and the high temperature susceptible strain, 93 using the Chinese cabbage-associated Z08-420 nucleotide sequence identified through previous studies, and found a total of four single nucleotide polymorphisms (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOS: 7 and 8) capable of PCR amplification including these polymorphic regions in order to confirm single nucleotide polymorphism (SNP) .
본 발명의 목적은 서열번호 5 및 6 또는 서열번호 7 및 8의 염기서열로 구성된 고온 스트레스 저항성 및 감수성 배추 선별용 프라이머 세트를 제공하는 것이다. It is an object of the present invention to provide a set of primers for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8.
본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 고온 스트레스 저항성 및 감수성 배추를 선별하기 위한 HRM 분석용 PCR 키트를 제공하는 것이다. It is another object of the present invention to provide a PCR kit for HRM analysis for screening high temperature stress resistant and susceptible Chinese cabbages comprising the primer set.
본 발명의 또 다른 목적은 상기 프라이머 세트를 이용하여 HRM(High resolution melting)을 통해 고온 스트레스 저항성 및 감수성 배추 선별방법을 제공하는 것이다. It is still another object of the present invention to provide a high-temperature stress resistance and susceptible Chinese cabbage screening method through HRM (High Resolution Melting) using the primer set.
본 발명은 서열번호 5 및 6 또는 서열번호 7 및 8의 염기서열로 구성된 고온 스트레스 저항성 및 감수성 배추 선별용 프라이머 세트를 제공한다. The present invention provides a set of primers for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOs: 5 and 6 or SEQ ID NOs: 7 and 8.
또한, 본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 고온 스트레스 저항성 및 감수성 배추를 선별하기 위한 HRM 분석용 PCR 키트를 제공한다. Another object of the present invention is to provide a PCR kit for HRM analysis for selecting high temperature stress resistant and susceptible Chinese cabbages comprising the primer set.
또한, 본 발명의 다른 목적은 상기 프라이머 세트를 이용하여 HRM(High resolution melting) 분석기술을 통해 고온 스트레스 저항성 및 감수성배추 선별방법을 제공한다. Another object of the present invention is to provide a high-stress resistance and susceptible Chinese cabbage screening method using a high resolution melting (HRM) analysis technique using the primer set.
또한, 본 발명의 다른 목적은 서열번호 3 또는 4의 염기서열, 또는 이의 상보적인 염기서열로 구성된 고온 스트레스 저항성 또는 감수성 배추 선별용 프로브를 제공한다. Another object of the present invention is to provide a probe for screening a high temperature stress resistant or susceptible Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 3 or 4, or a complementary base sequence thereof.
또한, 본 발명의 또 다른 목적은 서열번호 3 또는 4의 염기서열로 이루어진 폴리뉴클레오타이드, 그에 의해 코딩되는 폴리펩다이드 또는 그의 cDNA를 포함하는 고온 스트레스 저항성 및 감수성 배추 선별용 마이크로어레이를 제공한다.
Still another object of the present invention is to provide a microarray for screening high-temperature stress-tolerant and susceptible Chinese cabbage comprising a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 or 4, a polypeptide encoded thereby, or a cDNA thereof.
본 발명의 프라이머 세트는 배추 작물의 고온 스트레스 저항성 및 감수성에 연관 유전 인자의 유무를 표현형 및 DNA 염기서열 분석 없이 확인할 수 있는 HRM 분석용 PCR 프라이머 세트로서, 상기 프라이머 세트를 이용하여 92계통과 93계통의 고온 저항성 및 감수성 연관 유전자형을 빠른 시간에 적은 비용으로 구분할 수 있어 배추 품종 개발 및 육종을 효율적으로 개선할 수 있다.
The primer set of the present invention is a PCR primer set for HRM analysis that can confirm the presence or absence of a related genetic factor in the high temperature stress resistance and susceptibility of a Chinese cabbage without a phenotype and DNA base sequence analysis. Using the primer set, 92 system and 93 system The high temperature resistance and susceptibility related genotypes can be distinguished at a short time and at a low cost, and the development and breeding of cabbage can be efficiently improved.
도 1은 서열번호 3의 염기서열을 이용한 배추 고온 저항성 계통(92 계통)의 염기서열을 나타낸 도이다. 붉은 색 및 굵은 글자는 단일염기 다형성 위치 표시(SNP)를 나타낸다. W는 A 및 T, M은 A 및 C, R은 A 및 G를 나타낸다.
도 2는 서열 번호 4의 염기서열을 이용한 배추 고온 저항성 계통(92 계통) 및 감수성 계통(93 계통)의 염기서열을 나타낸 도이다. 붉은 색 및 굵은 글자는 단일염기 다형성 위치 표시를 나타낸다. W는 A 및 T, M은 A 및 C, R은 A 및 G를 나타낸다.
도 3은 서열번호 5 및 6의 염기서열로 구성된 프라이머 세트를 이용하여 배추 고온 저항성 및 감수성 유전자형을 HRM 기술을 이용한 분석 결과를 나타낸 도이다.
도 4는 서열번호 7 및 8의 염기서열로 구성된 프라이머 세트를 이용하여 배추 고온 저항성 및 감수성 유전자형을 HRM 기술을 이용한 분석 결과를 나타낸 도이다.1 is a diagram showing the nucleotide sequence of a Chinese cabbage high temperature resistant strain (line 92) using the nucleotide sequence of SEQ ID NO: 3. Red and bold letters indicate single nucleotide polymorphism locus (SNP). W represents A and T, M represents A and C, and R represents A and G.
2 is a diagram showing the nucleotide sequences of the Chinese cabbage high temperature resistant strain (line 92) and susceptible line (line 93) using the nucleotide sequence of SEQ ID NO: 4. Red and bold letters indicate single nucleotide polymorphic loci. W represents A and T, M represents A and C, and R represents A and G.
FIG. 3 is a graph showing the results of analysis using the HRM technique for the Chinese cabbage resistance and susceptibility genotypes using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6.
FIG. 4 is a graph showing the results of analysis using the HRM technique for the Chinese cabbage resistance and susceptibility genotypes using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 7 and 8.
본 발명은 서열번호 5 및 6, 또는 서열번호 7 및 8의 HRM(high resolution melting) 분석기술을 이용한 고온 스트레스 저항성 및 감수성 배추 선별용 프라이머 세트를 제공한다.The present invention provides a primer set for high temperature stress tolerance and susceptible Chinese cabbage using the high resolution melting (HRM) analysis technique of SEQ ID NOs: 5 and 6, or SEQ ID NOs: 7 and 8.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명에서는 배추 내서성 저항성 계통(92)와 내서성 감수성 계통(93) 및 92와 93계통의 교배로 생성된 91종류의 F2 집단의 내서성 QTL +분석을 통해서 확인된 내서성 저항성 연관 DNA 염기서열(Z08-420; 서열번호 3 및 4)을 이용하여 92계통의 염기서열(서열번호 3)과 93계통의 염기서열(서열번호 4)을 비교 분석하였다. 이를 통하여 확인된 총 4개의 단일염기서열다형성 위치를 확인하고 이들 단일염기다형성 지역을 포함하여 PCR 증폭이 가능한 프라이머 세트 Ht-2-1(서열번호 5 및 6)과 Ht-2-2(서열번호 7 및 8)를 제조하였다. 상기 프라이머 세트를 이용하여 92계통과 93계통의 전체 DNA를 대상으로 PCR 증폭하였으며, HRM 기술을 이용하여 고온 저항성 및 감수성 연관 유전자형을 구분할 수 있는 프라이머 세트를 완성하였다. 상기 프라이머 세트 및 마커는 내서성 배추 품종 육성에 있어서 선발분자를 탐색하기 위한 PCR 키트 또는 분자마커로 이용될 수 있음을 확인하였다. In the present invention, the resistance to internal resistance of the Chinese cabbage resistance gene (92), the resistance gene of internal resistance (93), and 91 kinds of F2 groups generated by the hybridization of 92 and 93 strains (SEQ ID NO: 3) and the nucleotide sequence of 93 lines (SEQ ID NO: 4) were compared and analyzed using the sequences (Z08-420; SEQ ID NOS: 3 and 4) (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOs: 5 and 6) that can be amplified by PCR, including these single nucleotide polymorphisms, 7 and 8). Using the above primer sets, PCR amplification was performed on whole DNAs of 92 and 93 strains, and a primer set capable of distinguishing high temperature resistance and susceptibility related genotypes using HRM technology was completed. It was confirmed that the primer set and the marker can be used as a PCR kit or a molecular marker for searching for a selection molecule in the cultivation of endosperm cabbage cultivars.
본 발명에서 사용하는 용어인 '프라이머'란 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(DNA 중합효소 또는 역전사 효소) 및 상이한 4가지 dNTP(deoxynucleoside triphosphate)의 존재하에서 DNA 합성을 개시할 수 있다.As used herein, the term 'primer' refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different dNTPs (deoxynucleoside triphosphate) at appropriate buffer solutions and temperatures.
프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다. 본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속, 철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.
또한, 본 발명의 프라이머 핵산 서열은 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소 (예컨대, 호스래디쉬 옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예컨대, 32P), 형광성 분자, 화학그룹 (예컨대, 바이오틴) 등이 있다.In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish oxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules, chemical groups (such as biotin), and the like.
본 발명에서 "선별"은 특정 표현형을 갖는 배추를 선택하는 것을 의미한다.In the present invention, "screening" means selecting a Chinese cabbage having a specific phenotype.
상기 고온 스트레스 저항성 및 감수성 배추의 선별용 PCR 키트는 상기의 프라이머 세트 이외에, PCR 키트에 포함되는 통상적인 구성성분을 포함할 수 있다. 상기 키트에 포함되는 통상적인 구성성분은 반응완충액, 중합효소, dNTP(dATP, dCTP, dGTP 및 dTTP) 및 Mg2+와 같은 조인자 등일 수 있다. 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, E. coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, 및 Pyrococcus furiosus (Pfu)를 포함한다. 상기 중합효소 대부분은 박테리아 그 자체로부터 분리될 수 있고 또는 상업적으로 구입할 수 있다. 또한, 본 발명에 이용되는 중합효소는 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다. 중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다.The PCR kit for screening the high temperature stress-tolerant and susceptible Chinese cabbage may include, in addition to the above-described primer set, conventional components included in the PCR kit. Typical components included in the kit may be reaction buffers, polymerases, dNTPs (dATP, dCTP, dGTP and dTTP), and joins such as Mg 2+ . A variety of DNA polymerases can be used in the amplification step of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu) . Most of these enzymes can be isolated from the bacteria itself or commercially available. In addition, the polymerase used in the present invention can be obtained from cells expressing high levels of the cloning gene encoding the polymerase. When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component.
증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서, 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.
또한 본 발명은Also,
1) 서열번호 5 및 6 또는 서열번호 7 및 8의 염기서열로 구성된 프라이머와 배추로부터 추출한 전체 DNA 시료를 혼합하여 PCR을 수행하는 단계; 및1) performing PCR by mixing primers consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8 and whole DNA samples extracted from Chinese cabbage; And
2) 상기 1)단계의 증폭된 시료를 이용하여 HRM(High resolution melting)을 수행하는 단계;를 포함하는, 고온 스트레스 저항성 및 감수성 배추 선별방법을 제공한다.2) performing HRM (High-resolution melting) using the amplified sample of step 1), and a method for selecting high-temperature stress-resistant and susceptible Chinese cabbage.
또한 본 발명은 서열번호 3 및 4의 염기서열, 또는 이의 상보적인 염기서열로 구성된 고온 스트레스 저항성 및 감수성 배추 선별용 프로브로 이용될 수 있다. 본 발명에서 '프로브'란 혼성화 프로브를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 이를 이용하여, 배추의 게놈 DNA를 추출하여, 상기 서열번호 3 또는 4의 염기서열 또는 이의 상보적인 염기서열을 프로브로, 배추의 게놈 DNA와 혼성화 시킬 수 있다. 고온 스트레스 저항성 배추의 경우, 상기 서열번호 3 또는 4의 염기서열에 의하여 혼성화되는 배추를 고온 스트레스 저항성 배추로 결정할 수 있다.The present invention can also be used as a probe for high temperature stress resistance and susceptible Chinese cabbage comprising the nucleotide sequences of SEQ ID NOS: 3 and 4, or a complementary base sequence thereof. In the present invention, 'probe' refers to a hybridization probe, and refers to an oligonucleotide capable of binding sequence-specifically to the complementary strand of a nucleic acid. Using this, the genomic DNA of the Chinese cabbage can be extracted, and the nucleotide sequence of SEQ ID NO: 3 or 4 or a complementary base sequence thereof can be hybridized with the genome DNA of the Chinese cabbage as a probe. In the case of high temperature stress resistant Chinese cabbage, the Chinese cabbage hybridized by the nucleotide sequence of SEQ ID NO: 3 or 4 can be determined by high temperature stress resistant Chinese cabbage.
본 발명에서, SNP (Single Nucleotide Polymorphism)는 개인과 개인간의 DNA에 존재하는 한 염기쌍(single base-pair variation)의 차이로, DNA 서열 다형성(polymorphism) 중에서 가장 많이 존재하는 형태이다.In the present invention, SNP (Single Nucleotide Polymorphism) is the most common form of DNA sequence polymorphism due to a difference in single base-pair variation in DNA between individuals and individuals.
서열번호 3 또는 4의 염기서열은 다형성 서열(polymorphic sequence)이다. 다형성 서열이란 폴리뉴클레오티드 서열 중에서 SNP를 나타내는 다형성 부위(polymorphic site)를 포함하는 서열을 말한다. 상기 폴리뉴클레오티드는 DNA 또는 RNA가 될 수 있다.The nucleotide sequence of SEQ ID NO: 3 or 4 is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a SNP in a polynucleotide sequence. The polynucleotide may be DNA or RNA.
또한, 본 발명의 상기 서열번호 3 또는 4의 염기서열 또는 이의 상보적인 염기서열을 포함하는 마이크로어레이를 제공할 수 있다. 본 발명에 따른 마이크로어레이는 당분야의 당업자에게 알려져 있는 통상적인 방법에 의해 제조될 수 있다.In addition, a microarray comprising the nucleotide sequence of SEQ ID NO: 3 or 4 or the complementary base sequence of the nucleotide sequence of the present invention can be provided. The microarray according to the present invention can be produced by a conventional method known to those skilled in the art.
예컨대, 상기 뉴클레오티드는 아미노 실란(amino-silane), 폴리-L-리신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 기판 상에 고정될 수 있다. 또한, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 및 플라스틱으로 이루어진 군에서 선택될 수 있다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법은 압전(piezoelectric) 방식을 이용한 마이크로피펫팅법(micropipetting), 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용할 수 있다.For example, the nucleotide can be immobilized on a substrate coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde. In addition, the substrate may be selected from the group consisting of a silicon wafer, glass, quartz, metal, and plastic. The method of immobilizing the polynucleotide on a substrate may be a micropipetting method using a piezoelectric method or a method using a pin-type spotter.
이하, 본 발명을 실시예에 의거하여 보다 구체적으로 설명한다. 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.
[실시예 1] 고온 스트레스 저항성 배추 선별을 위한 마커의 제조Example 1 Preparation of Markers for Selection of Hot Stress-Resistant Chinese Cabbage
1. 고온 스트레스 저항성 계통(92) 및 감수성 계통(93) 배추의 전체 DNA 추출1. High temperature stress resistance system (92) and susceptible line (93) Whole DNA extraction of Chinese cabbage
92와 93계통의 개체에서 배추 잎을 채취 후 동결건조 후 CTAB(Cetyl trimethylammonium bromide) 방법을 이용하여 DNA를 추출하였다. The leaves of the cabbage were harvested from 92 and 93 individuals and then lyophilized and extracted with CTAB (Cetyl trimethylammonium bromide) method.
보다 구체적으로, 상기 채취된 92 계통 및 93 계통의 배추잎을 분쇄기로 15 분간 분쇄시킨 후 추출 방법은 분쇄기로 15분 분쇄시켜준 후 수조에서 65℃로 10분 예열하였다. 여기에, 5M 암모늄아세테이트 250㎕를 넣어준 후 원심분리를 10분간 실시하였다. 상층액만 취한 후 차가운 에탄올 900㎕를 넣었다. 이렇게 추출한 -70℃에 10분간 두었다. 원심분리 10분 후에 알코올로 건조시킨 뒤 증류수를 넣었다. 이렇게 추출한 DNA를 분광 측정기를 이용하여 농도를 측정하고, 최종농도를 10ng/㎕로 희석시켰다.
More specifically, the harvested 92-line and 93-line Chinese cabbage leaves were pulverized by a pulverizer for 15 minutes, followed by pulverization with a pulverizer for 15 minutes, followed by preheating at 65 ° C for 10 minutes in a water bath. To this was added 250 5 of 5M ammonium acetate, followed by centrifugation for 10 minutes. Only the supernatant was taken and 900 차 of cold ethanol was added. The thus-extracted extract was placed at -70 ° C for 10 minutes. After 10 minutes of centrifugation, it was dried with alcohol and then distilled water was added. The concentration of the DNA thus extracted was measured using a spectrophotometer, and the final concentration was diluted to 10 ng / μl.
2. 추출된 92 계통 및 93 DNA 계통 배추의 PCR 증폭2. PCR amplification of extracted 92 strains and 93 DNA-based cabbages
서열번호 1의 프라이머(CCTGTCATAGTTAGCTACCC) 및 서열번호 2의 프라이머 (TGGGAGGAGAGCCAGTTTC)를 이용하여 92와 93계통의 전체 DNA를 이용하여 PCR로 증폭하였다. PCR 반응은 총량 15㎕(증류수 6.02㎕, dNTP(10mM) 0.4㎕, Etaq 중합효소 1 Unit, 10x etaq 완충용액 1.5㎕, 프라이머(0.7μM) 2㎕, DNA 30ng를 이용하여 PCR을 수행하였다. PCR 프로그램은 95℃ 3분, 95℃ 20초, 52℃ 30초, 72℃ 1분 수행하였으며 40번 반복 수행하였다. 상기 프라이머 서열을 포함한 본 발명의 PCR 프라이머와 배추 고온 저항성 및 감수성 마커 염기서열 Z08-420의 서열을 표 1에 나타내었다. The primers (CCTGTCATAGTTAGCTACCC) of SEQ ID NO: 1 and the primers of SEQ ID NO: 2 (TGGGAGGAGAGCCAGTTTC) were amplified by PCR using whole DNA of 92 and 93 lines. PCR was carried out using a total amount of 15 μl (6.02 μl of distilled water, 0.4 μl of dNTP (10 mM), 1 unit of Etaq polymerase, 1.5 μl of 10 × etaq buffer, 2 μl of primer (0.7 μM) The PCR was performed at 95 ° C. for 3 minutes, at 95 ° C. for 20 seconds, at 52 ° C. for 30 seconds, and at 72 ° C. for 1 minute, and the PCR primer of the present invention including the above primer sequence and the Chinese cabbage high temperature resistance and susceptibility marker sequence Z08- 420 are shown in Table 1. < tb > < TABLE >
3. 증폭된 DNA의 염기서열 분석3. Sequence analysis of amplified DNA
증폭된 92와 93 PCR DNA를 이용하여 염기서열을 분석하였으며, 이의 결과를 도 1 및 도 2에 나타내었다.The nucleotide sequences of the amplified 92 and 93 PCR DNA were analyzed and the results are shown in FIGS. 1 and 2. FIG.
도 1 및 도 2에 나타낸 바와 같이, 총 4곳의 위치에서 단일염기다형성(SNP) 위치가 확인되었다. 하지만 92 계통의 경우 모든 4 지역에서 두 종류의 염기서열이 존재하고, 같은 위치의 93계통의 경우는 단일 염기서열이 존재함을 확인하였다.
As shown in Figures 1 and 2, single nucleotide polymorphism (SNP) positions were identified at four locations in total. However, it was confirmed that two kinds of nucleotide sequences exist in all four regions in the case of the 92 strain, and single nucleotide sequences exist in the case of the 93 strain in the same position.
[실시예 2] 본 발명의 프라이머 세트를 이용한 HRM(high resolution melting) 분석[Example 2] HRM (high resolution melting) analysis using the primer set of the present invention
HRM 분석을 위해 Ht-2-1(서열목록 5 및 6)과 Ht-2-2(서열목록 7 및 8) 프라이머 세트를 이용하여 PCR 증폭을 수행하였다. PCR 조건은 총량 15㎕(증류수 6.02㎕, dNTP(10mM) 0.4㎕, Etaq 중합효소 1 유닛(Unit), 10 X 에탄올 완충용액 1.5㎕, 프라이머(0.7μM) 2㎕, DNA 30ng를 이용하여 PCR을 수행하였다. PCR 프로그램은 95℃ 3분, 95℃ 20초, 52℃ 30초, 72℃ 1분 수행하였으며, 40번 반복 수행하였다. PCR 증폭 후 형광물질 0.3μL의 에바그린 염색제(evagreen dye)를 첨가한 후 라이트 스캐너(Light Scanner)(Idaho Technology Inc. USA)를 이용하여 HRM 분석을 수행하였다. 샘플은 섭씨 50℃에서 95℃로 온도가 증가하면서 해리속도(melting rate)(0.1 oC s-1)의 형광 정도를 측정하였다. 이의 결과를 도 3 및 4에 나타내었다. 도 3 및 도 4에 나타난 바와 같이, 본 발명의 Ht-2-1 프라이머 세트(서열번호 5 및 6) 및 Ht-2-2 프라이머 세트(서열번호 7 및 8)를 통해 92계통과 93계통에서 고온 저항성 및 감수성 연관 유전자형의 구분이 가능함을 확인하였다.PCR amplification was performed using Ht-2-1 (SEQ ID NOS: 5 and 6) and Ht-2-2 (SEQ ID NOS: 7 and 8) primer sets for HRM analysis. PCR conditions were as follows: PCR was performed using a total amount of 15 μl (6.02 μl of distilled water, 0.4 μl of dNTP (10 mM), 1 unit of Etaq Polymerase, 1.5 μl of 10 × ethanol buffer, 2 μl of primer (0.7 μM) PCR was performed at 95 ° C for 3 minutes, at 95 ° C for 20 seconds, at 52 ° C for 30 seconds, and at 72 ° C for 1 minute, and repeated 40 times. After PCR amplification, 0.3 μl of the fluorescent material, evagreen dye, HRM analysis was carried out using a light scanner (Idaho Technology Inc. USA) after the addition of the sample. The sample was heated at a melting rate of 0.1 o C s- the degree of fluorescence 1) were measured. results thereof are shown in Figures 3 and 4. as shown in Figs. 3 and 4, Ht-2-1 primer set of the present invention (SEQ ID NO: 5 and 6) and Ht- 2-2 primer set (SEQ ID NOS: 7 and 8), it is possible to distinguish between high temperature resistance and susceptibility related genotypes in 92 and 93 strains Respectively.
<110> Dongguk University Industry-Academic Cooperation Foundation <120> PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis <130> DK-1.105P <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chinese cabbage PCR forward primer <400> 1 cctgtcatag ttagctaccc 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> chinese cabbage PCR forward primer <400> 2 tgggaggaga gccagtttc 19 <210> 3 <211> 348 <212> DNA <213> chinese cabbage 92 marker sequence <400> 3 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agwatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg mggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac taccmatrtg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 4 <211> 348 <212> DNA <213> chinese cabbage 93 marker sequence <400> 4 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agaatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg cggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac tacccatatg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 5 atcttggccc agcacggcc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 reverse primer <400> 6 tgggaggaga gccagtttc 19 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 7 ttccttttgg gatcttggct g 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 8 tgggaggaga gccagtttc 19 <110> Dongguk University Industry-Academic Cooperation Foundation <120> PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis <130> DK-1.105P <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chinese cabbage PCR forward primer <400> 1 cctgtcatag ttagctaccc 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> chinese cabbage PCR forward primer <400> 2 tgggaggaga gccagtttc 19 <210> 3 <211> 348 <212> DNA <213> chinese cabbage 92 marker sequence <400> 3 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agwatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg mggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac taccmatrtg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 4 <211> 348 <212> DNA <213> chinese cabbage 93 marker sequence <400> 4 tcctttgacc aaacgacatc tacccaatct ttaagctctt cccgcggccg cagcacctcc 60 catgtggttg acgacctgaa agaatgtaac ggagaatcac cagctatcca ttcataatca 120 tcattcacat caacaggaag aggcaaacta atagtagtaa gataagtatg gagttcaact 180 tccttttggg atcttgggtg cggcagcgac caaacagagt catttattgc gtcagccacc 240 acagcattct tccttatcct cagagatctt ggcccagcac tacccatatg ttcgattaac 300 tgaccgaggg gcgtccatac gtcgaaccag aaactggtcc tcctccca 348 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 5 atcttggccc agcacggcc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 reverse primer <400> 6 tgggaggaga gccagtttc 19 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 7 ttccttttgg gatcttggct g 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HT-2-1 forward primer <400> 8 tgggaggaga gccagtttc 19
Claims (7)
2) 상기 1)단계의 증폭된 시료를 이용하여 HRM(High resolution melting) 분석을 수행하는 단계;를 포함하는, 고온 스트레스 저항성 및 감수성 배추 선별방법.1) performing PCR by mixing primers consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6 or SEQ ID NOS: 7 and 8 and whole DNA samples extracted from Chinese cabbage; And
2) performing high resolution melting (HRM) analysis using the amplified sample of step 1).
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20130030873A KR101492989B1 (en) | 2013-03-22 | 2013-03-22 | PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20130030873A KR101492989B1 (en) | 2013-03-22 | 2013-03-22 | PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140116314A KR20140116314A (en) | 2014-10-02 |
KR101492989B1 true KR101492989B1 (en) | 2015-02-13 |
Family
ID=51990239
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR20130030873A KR101492989B1 (en) | 2013-03-22 | 2013-03-22 | PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101492989B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102082987B1 (en) * | 2018-10-08 | 2020-02-28 | 경희대학교 산학협력단 | Primer set for discriminating cultivars of onion and method for cultivars of onion using HRM analysis |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20120121499A (en) * | 2011-04-27 | 2012-11-06 | 한국생명공학연구원 | Biomarker for early selection of heat tolerant line in Brassica oleracea and uses thereof |
-
2013
- 2013-03-22 KR KR20130030873A patent/KR101492989B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20120121499A (en) * | 2011-04-27 | 2012-11-06 | 한국생명공학연구원 | Biomarker for early selection of heat tolerant line in Brassica oleracea and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
KR20140116314A (en) | 2014-10-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108112258A (en) | Connection in the liquid phase measures | |
CN108291253A (en) | Method for variant detection | |
KR101834565B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Sanmaru-1 and use thereof | |
KR101997679B1 (en) | CAPS Marker for Identification of Lentinula edodes Cultivar Sanmaru 2ho and use thereof | |
KR101906037B1 (en) | CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Chunjang-3 and use thereof | |
KR101823353B1 (en) | Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit | |
CN102758007A (en) | Probe for detecting mutation in exon 12 of NPM1 gene and use thereof | |
KR102265417B1 (en) | Primer for multiple analysis of single nucleotide polymorphism | |
KR101739876B1 (en) | LAMP based methods and kits for detecting single base changes in target nucleic acids using allele or mutation specific primers | |
CN102471771A (en) | Target sequence amplification method, polymorphism detection method, and reagents for use in the methods | |
KR101492989B1 (en) | PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis | |
JP2009100653A (en) | Polynucleotide containing single nucleotide polymorphism (snp), snp marker used for discriminating species of rice and comprising the polynucleotide, and method for discriminating species of rice by the snp analysis | |
KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
CN106520948B (en) | Reverse probe, kit and detection method for visually detecting single nucleotide polymorphism sites in gene sequence | |
KR102458440B1 (en) | Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set | |
KR101282924B1 (en) | PCR primer for detecting Salmonella | |
KR102296889B1 (en) | Molecular marker for selecting Gray leaf spot resistant or susceptible tomato cultivar and selection method using the same molecular marker | |
KR101481734B1 (en) | Microsatellite marker of Korean Astragalus mongholicus and primer set for amplifying the same | |
KR101395645B1 (en) | RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance | |
CN102712922A (en) | Probes for detection of polymorphisms of c-kit gene, and use thereof | |
KR101798478B1 (en) | Method for detecting rapidly Aspergillus flavus strain producing aflatoxin and detection kit | |
Kim et al. | Easy method for discriminating the origins of manila clam Ruditapes philippinarum with a dual-labelled PNA-probe-based melting curve analysis | |
KR102604102B1 (en) | Marker derived from complete sequencing of chloroplast genome of Paeonia genus, primer set for discrimination of Paeonia genus and uses thereof | |
CN111334562A (en) | Nucleic acid amplification method and kit containing modified primer | |
KR101673293B1 (en) | Primer sets for determining identity of rice, method of determining identity of rice using the same and kit using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20180130 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20190201 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20200115 Year of fee payment: 6 |