KR101823353B1 - Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit - Google Patents

Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit Download PDF

Info

Publication number
KR101823353B1
KR101823353B1 KR1020160113322A KR20160113322A KR101823353B1 KR 101823353 B1 KR101823353 B1 KR 101823353B1 KR 1020160113322 A KR1020160113322 A KR 1020160113322A KR 20160113322 A KR20160113322 A KR 20160113322A KR 101823353 B1 KR101823353 B1 KR 101823353B1
Authority
KR
South Korea
Prior art keywords
seq
gene
toxin
botulinum toxin
clostridium perfringens
Prior art date
Application number
KR1020160113322A
Other languages
Korean (ko)
Inventor
이종서
임대환
Original Assignee
롯데푸드 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 롯데푸드 주식회사 filed Critical 롯데푸드 주식회사
Priority to KR1020160113322A priority Critical patent/KR101823353B1/en
Application granted granted Critical
Publication of KR101823353B1 publication Critical patent/KR101823353B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00Nucleic acid detection characterised by assay method
    • C12Q2561/113Real time assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/101Interaction between at least two labels
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

The present invention relates to a detection kit for quickly detecting botulinum toxin (BOTOX) A, B, and E and Clostridium perfringens alpha toxin genes causing food poisoning at the same time and a detection method thereof. More specifically, the present invention relates to real-time polymerase chain reaction (PCR) technique using the probes of SEQ ID NOS: 9 to 12 and primer sets of SEQ ID NOS: 1 to 8. The real-time PCR technique can be used to confirm Clostridium bacterium and Clostridium perfringens, which are Clostridium strains generating food poisoning toxins in food products at the same time.

Description

보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법 및 검출 키트{Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit}TECHNICAL FIELD [0001] The present invention relates to botulinum toxin A, B, E and Clostridium perfringens alpha toxin and detection kit,

본 발명은 식중독을 불러 일으키는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 신속하게 검출하는 검출방법 및 검출키트에 관한 것으로, 보다 구체적으로 서열번호 1 내지 8의 프라이머 세트, 및 서열번호 9 내지 12의 프로브를 이용한 Real-Time PCR 기법에 관한 것이다. The present invention relates to a detection method and a detection kit for rapidly detecting botulinum toxin A, B, E, and Clostridium perfringens alpha toxin genes that cause food poisoning, and more particularly, And Real-Time PCR techniques using the probes of SEQ ID NOS: 9-12.

클로스트리디움 보툴리눔균(Clostridium botulinum)은 신경독소를 생성하여 이를 섭취할 경우 운동신경 말단의 아세틸콜린 분비를 억제시켜 마비를 일으킨다. 이는 혐기성 균으로 아포를 생성하기 때문에 쉽게 사멸되지 않고 혐기조건에서 증식하여 독소를 생성한다. Clostridium botulinum produces a neurotoxin which, when ingested, inhibits acetylcholine secretion at the motor nerve endings and causes paralysis. It is an anaerobic bacterium that produces apo, so it does not die easily but grows in anaerobic conditions to produce toxins.

이러한 보툴리눔균은 A~G 신경독소를 생성하며, 신경독소 A, B, E는 식품매개 질환을 일으키며, C는 조류에게서 신경독소 D는 포유동물에게 질병을 일으킨다.These botulinum neurotoxins produce A ~ G neurotoxins, neurotoxins A, B and E cause foodborne illnesses, and C neurons in birds cause disease to mammals.

아울러, 클로스트리디움 퍼프린젠스(Clostridium perfringens)는 일반적으로 식품매개를 통하여 감염되며, alpha 독소 유전자의 유무를 이용하여 검출한다.In addition, Clostridium perfringens is generally infected through food-borne pathways and detects the presence or absence of the alpha toxin gene.

현재 식품공전법에는 클로스트리디움 보툴리눔 시험법이 명시되어 있으며 그 방법이 증균 배양부터 독소 확인 실험까지 30일~40일 가량 소요 되며 그 비용도 한 샘플당 300만원 내외가 소요되어 현장에서 예방차원으로 활용하기에 무리가 따른다.Clostridium botulinum test method is specified in Food Code, and it takes about 30 ~ 40 days from enrichment culture to toxin confirmation experiment, and the cost is about 3 million won per sample. It takes a lot of effort to use it.

상기 언급한 클로스트리디움 퍼프린젠스(Clostridium perfringens)와 클로스트리디음 보툴리눔(Clostridium botulium) 균주는 둘 다 절대 혐기성 포자 형성 균으로 비슷한 환경에서 생육할 수 있으므로 동시에 검출하여 클로스트리디움 보툴리눔 독소 A, B, E에 의한 식품사고를 예방할 수 있다.Both of Clostridium perfringens and Clostridium botulium strains mentioned above can be grown in the same environment as an absolute anaerobic spore bacterium, so that they are simultaneously detected to detect Clostridium botulinum toxin A, B , E can prevent food accidents.

한국 공개특허 제2016-56209호는 보툴리눔균 신경독소 C, D 독소의 탐지 및 검출을 위한 프라이머 세트를 제공한다.Korean Patent Publication No. 2016-56209 provides a primer set for detection and detection of botulinum neurotoxin C, D toxin.

본 기술은 분자생물학적 분석법을 이용하여 보툴리눔균 신경독소 A, B, E와 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 검출할 수 있도록 고안하여 간단한 증균 과정만 거치면 식품매개 감염증 중 대표적인 클로스트리디움 속의 2종 미생물을 특이적으로 확인할 수 있다. This technology is designed to detect botulinum neurotoxin A, B, E and Clostridium perfringens alpha toxin gene simultaneously using molecular biology analysis, and if simple mutagenesis is performed, a representative Clostridium genus Two microorganisms can be identified specifically.

한국 공개특허 제2016-56209호Korean Patent Publication No. 2016-56209

본 발명자들은 보툴리눔 신경독소 A, B, E와 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 검출하기 위해, 새로운 프라이머 세트를 제작하고, 이를 바탕으로 특이적인 프로브를 디자인하여 Real-time PCR을 수행한 결과, 4개의 유전자를 동일한 온도 조건에서 Real-time PCR 수행하여 동시에 검출할 수 있다는 것을 확인함으로써 본 발명은 완성하였다.The inventors constructed a new primer set to simultaneously detect the botulinum neurotoxin A, B, and E and the Clostridium perfringens alpha toxin gene, and performed a real-time PCR by designing a specific probe based thereon As a result, it was confirmed that four genes could be simultaneously detected by real-time PCR under the same temperature condition, thereby completing the present invention.

따라서, 본 발명은 보툴리눔 독소 A, B, E와 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법을 제공하는 것이다. Accordingly, the present invention provides a method for rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene.

또한, 본 발명은 보툴리눔 독소 A, B, E와 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 검출 키트를 제공하는데 있다.The present invention also provides a kit for detecting botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene.

위와 같은 과제를 해결하기 위해, 본 발명은 (a) 시료(sample)로부터 유전체 DAN(primer)를 추출하는 단계; (b) 상기 추출된 유전체 DNA, 서열번호 1 내지 8의 프라이머 세트, 및 서열번호 9 내지 12의 프로브를 포함하는 실시간 중합효소연쇄반응(Real-Time Polymerase Chain Reaction)액을 제조하는 단계; 및 (c) 실시간 중합효소연쇄반응을 수행하는 단계를 포함하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법을 제공한다.In order to solve the above problems, the present invention provides a method of manufacturing a semiconductor device, comprising: (a) extracting a dielectric DAN (primer) from a sample; (b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID Nos. 1 to 8, and the probes of SEQ ID Nos. 9 to 12; And (c) performing a real-time PCR reaction. The present invention provides a method for rapid detection of botulinum toxin A, B, E, and Clostridium perfringens alpha toxin gene.

또한 본 발명은 서열번호 1 내지 8의 프라이머 세트 및 서열번호 9 내지 12의 프로브를 포함하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 검출 키트를 제공한다.The present invention also provides a kit for detecting botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene comprising the primer set of SEQ ID NOs: 1 to 8 and the probes of SEQ ID NOs: 9 to 12.

본 발명은 식중독을 불러 일으키는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 신속하게 검출할 수 있어, 식품에 클로스트리디움 속 균주인 클로스트리디움 퍼프린젠스 (Clostridium botulium) 및 클로스트리디움 퍼프린젠스(Clostridium perfringens) 균주 존재 유무를 확인하는데 유용하게 이용할 수 있다.The present invention can simultaneously detect botulinum toxin A, B, E, and Clostridium perfringens alpha toxin gene causing food poisoning, so that Clostridium botulium < RTI ID = 0.0 > ) And Clostridium perfringens strains in the presence of the strain.

도 1은 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 프라이머 세트의 합성에서 이용된 NCBI 데이터베이스의 access number KM233166(보툴리눔 독소 A 합성 유전자 서열), AB665557(보툴리눔 독소 B 합성 유전자 서열), JX424539(보툴리눔 독소 E 합성 유전자 서열), CP010993(퍼프린젠스 cpa 합성 유전자 서열)의 유전자 정보이다.
도 2는 도 1의 보툴리눔 독소 A 유전자에 대한 Real-time PCR 시험결과이다.
도 3은 도 1의 보툴리눔 독소 B 유전자에 대한 Real-time PCR 시험결과이다.
도 4는 도 1의 보툴리눔 독소 E 유전자에 대한 Real-time PCR 시험결과이다.
도 5는 도 1의 클로스트리디움 퍼프린젠스 cpa 합성 유전자에 대한 Real-time PCR 시험결과이다.
도 6은 도 1의 합성 유전자에 대한 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 검출한 Real-time PCR 시험결과이다.
Figure 1 shows the accession number KM233166 (botulinum toxin A synthetase sequence), AB665557 (botulinum toxin B synthetase gene) of the NCBI database used in the synthesis of botulinum toxin A, B, E and primer sets of Clostridium perfringens alpha toxin gene Sequence), JX424539 (botulinum toxin E synthetic gene sequence), CP010993 (puffin gene cpa synthetic gene sequence).
Fig. 2 shows the result of real-time PCR of the botulinum toxin A gene of Fig.
Fig. 3 shows the result of real-time PCR test on the botulinum toxin B gene of Fig.
Fig. 4 shows the result of Real-time PCR test on the botulinum toxin E gene of Fig.
FIG. 5 shows the results of real-time PCR test on the Clostridium perfringens cpa synthetic gene of FIG. 1. FIG.
FIG. 6 is a result of a real-time PCR test simultaneously detecting the botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene in the synthetic gene of FIG.

이하, 본 발명을 하나의 구현 예로서 더욱 상세하게 설명하면 다음과 같다.Hereinafter, the present invention will be described in more detail as an embodiment.

본 발명은 식중독을 불러 일으키는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시에 신속한 검출을 위해, (a) 시료(sample)로부터 유전체 DAN(primer)를 추출하는 단계; (b) 상기 추출된 유전체 DNA, 서열번호 1 내지 8의 프라이머 세트, 및 서열번호 9 내지 12의 프로브를 포함하는 실시간 중합효소연쇄반응(Real-Time Polymerase Chain Reaction)액을 제조하는 단계; 및 (c) 실시간 중합효소연쇄반응을 수행하는 단계를 포함하는 검출방법을 제공한다.The present invention relates to a method for simultaneous rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin genes causing food poisoning, comprising the steps of: (a) extracting a genomic DAN (primer) from a sample; (b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID Nos. 1 to 8, and the probes of SEQ ID Nos. 9 to 12; And (c) performing a real-time PCR reaction.

본 발명에서 사용하는 용어인 “프라이머”란 짧은 자유 3'말단 수산화기를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(DNA 중합효소 또는 역전사 효소) 및 상이한 4가지 dNTP (deoxynucleoside triphospate)의 존재하에서 DNA합성을 개시할 수 있다.As used herein, the term " primer " refers to a nucleic acid sequence having a short free 3 'terminal hydroxyl group that can form base pairs with a complementary template and serves as a starting point for template strand copying Quot; means a short nucleic acid sequence. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different dNTPs (deoxynucleoside triphospate) at appropriate buffer solutions and temperatures.

프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis.

본 발명에서 상기 서열번호 1 내지 8의 염기서열을 포함하는 프라이머는 각각 서열 상동성이 95% 이상인 염기서열을 포함하는 개념이다. 예를 들어, 프라이머가 20bp인 경우, 20bp 중 2개 이상 틀리면 용융 온도(melting temperature)의 감소가 5도 이상이 되므로 결과가 좋지 않게 나타나지만, 1개만 틀릴 경우에는 PCR 과정에서 열처리(annealing) 온도를 약간 내려 실험 할 경우 동등한 결과를 얻을 수 있기 때문이다.In the present invention, the primers comprising the nucleotide sequences of SEQ ID NOS: 1 to 8 each include a nucleotide sequence having a sequence homology of 95% or more. For example, when the primer is 20 bp, two or more of the 20 bp errors result in a poorer melting temperature than 5 ° C. However, if only one is wrong, the annealing temperature If you experiment a little down, you will get equal results.

본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성금속, 철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다.The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

또한, 본 발명의 프라이머 핵산 서열은 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소 (예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자, 화학그룹(예를 들어, 바이오틴) 등이 있다.In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin) have.

본 발명에서 “프로브”란 염기서열과 특이적으로 결합할 수 있는 수개 내지 수백 개의 염기로 이루어진 핵산단편을 의미하며 라벨링되어 있어 특정 핵산 존재여부를 확인 할 수 있다. 프로브는 올리고뉴클레오타이드프로브, 단쇄 DNA 프로브, 이중쇄 DNA 프로브, RNA 프로브 등의 형태로 제작될 수 있고 비오틴, FITC, 로다민, DIG 등으로 표지되거나 방사선 동위 원소 등으로 표지될 수 있다.In the present invention, " probe " means a nucleic acid fragment consisting of several to several hundred bases capable of specifically binding to a nucleotide sequence and is labeled to confirm the presence or absence of a specific nucleic acid. The probe can be produced in the form of an oligonucleotide probe, a short-chain DNA probe, a double-stranded DNA probe, an RNA probe, etc., and can be labeled with biotin, FITC, rhodamine, DIG or the like or labeled with radioisotope.

본 발명의 프로브는 5` 말단에 형광발색제(fluorescent reporter dye)가 표지되고 3` 말단에는 소광제(quencher)가 표지될 수 있다. In the probe of the present invention, a fluorescent reporter dye may be labeled at the 5 'end and a quencher may be labeled at the 3' end.

더욱 바람직하게는 상기 5'-말단에 표지되는 형광발색체는 6-카르복시플루오레세인(6-carboxyfluorescein, FAM), 2,7-디메톡시-4,5-디클로로-6-카복시플루오루세인(2,7-dimethoxy-4,5-dichloro-6-carboxyfluoroscein, JOE), 5-카르복시테트라메틸로다민 (5-Carboxytetramethylrhodamine, TAMRA), 및 시아닌-5(Cyanine-5, Cy5)으로 이루어진 군에서 선택된다.More preferably, the fluorescent substance labeled at the 5'-end is 6-carboxyfluorescein (FAM), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein 5-carboxyfluorescein, JOE), 5-carboxytetramethylrhodamine (TAMRA), and cyanine-5 (Cyanine-5, Cy5) do.

상기 3'-말단에 표지되는 소광제는 Excellent Bioneer Quencher(EBQ), Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3(BHQ-3), 5-Carboxytetramethylrhodamine (TAMRA), deep dark Quencher 1 (DDQ1), 및 deep dark Quencher 2(DDQ2)로 이루어진 군에서 선택된다.The quenching agents labeled at the 3'-end were: Excellent Bioneer Quencher (EBQ), Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3 Carboxytetramethylrhodamine (TAMRA), deep dark Quencher 1 (DDQ1), and deep dark Quencher 2 (DDQ2).

프로브의 5'-말단 및 3'-말단에 표지된 각각의 형광물질은 상호 간섭 현상을 나타내는 것 일 수 있다. 이에 따라, 프로브가 시료에 존재하는 표적 염기서열에 결합된 상태에서는 3'-말단의 형광물질 에너지에 의해 5'-말단의 형광물질이 억제되어 발색이 제한되고, 중합효소 연쇄반응의 수행시 프로브가 분해되면서 5'-말단의 형광물질이 유리되면서 3'-말단의 형광물질에 의한 억제가 해제되어 형광물질이 발색 반응을 하게 된다.Each fluorescent substance labeled at the 5'-end and the 3'-end of the probe may exhibit a mutual interference phenomenon. Thus, in the state where the probe is bound to the target base sequence existing in the sample, the fluorescent substance at the 5'-end is inhibited by the fluorescent energy of the 3'-terminal and the color development is restricted. In the case of performing the polymerase chain reaction, End of the fluorescent substance is liberated and the inhibition by the fluorescent substance at the 3'-terminal is released, so that the fluorescent substance undergoes the color development reaction.

본 발명에서의 서열번호 1 및 2는 도 1에 나타낸 보툴리눔 독소 A 합성 유전자의 염기서열(access number: KM233166)을 포함한다. SEQ ID NOS: 1 and 2 in the present invention include a base sequence (accession number: KM233166) of the botulinum toxin A synthetic gene shown in Fig.

본 발명에서의 서열번호 3 및 4는 보툴리눔 독소 B 합성 유전자의 염기서열(access number: AB665557)을 포함한다.SEQ ID NOS: 3 and 4 in the present invention include the accession number (AB665557) of the botulinum toxin B synthetic gene.

본 발명에서의 서열번호 5 및 6은 보툴리눔 독소 E 합성 유전자의 염기서열(access number: JX424539)을 포함한다.SEQ ID NOS: 5 and 6 in the present invention include the accession number (JX424539) of the botulinum toxin E synthetic gene.

본 발명에서의 서열번호 7 및 8은 클로스트리디움 퍼프린젠스 cpa 합성 유전자 서열(access number: CP010993)을 포함한다.SEQ ID NOS: 7 and 8 in the present invention include Clostridium perfringens cpa synthetic gene sequence (access number: CP010993).

본 발명에서의 서열번호 9는 보툴리눔 독소 A 유전자에 특이적으로 결합하고, 서열번호 10은 보툴리눔 독소 B 유전자에 특이적으로 결합하며, 서열번호 11은 보툴리눔 독소 E 유전자에 특이적으로 결합하고, 서열번호 12는 클로스트리디움 퍼프린젠스 alpha 독소 유전자에 특이적으로 결합하는 프로브이다.SEQ ID NO: 9 in the present invention specifically binds to the botulinum toxin A gene, SEQ ID NO: 10 specifically binds to the botulinum toxin B gene, SEQ ID NO: 11 specifically binds to the botulinum toxin E gene, No. 12 is a probe that specifically binds to Clostridium perfringens alpha toxin gene.

또한 본 발명 서열번호 1 내지 8의 프라이머 세트 및 서열번호 9 내지 12의 프로브를 포함하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 검출 키트를 제공한다.Also provided is a kit for detecting botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene comprising a primer set of SEQ ID NOs: 1 to 8 of the present invention and a probe of SEQ ID NOs: 9 to 12.

본 발명의 상기 키트는 서열번호 1 내지 8의 프라이머 및 서열번호 9 내지 12의 프로브 이외에 PCR 조성물에 사용되는 성분을 사용할 수 있으며, 이러한 조성물의 성분의 비제한적인 예로는 반응용 완충용액, dNTPs, Mg2+이온, DNA 중합효소가 포함될 수 있다.The kit of the present invention can use the components used in the PCR composition in addition to the primers of SEQ ID Nos: 1 to 8 and the probes of SEQ ID Nos. 9 to 12, and non-limiting examples of components of such a composition include reaction buffer solutions, dNTPs, Mg2 + ions, and DNA polymerase.

상기 반응용 완충용액은 1∼10mM TrisHCl, 10∼40mM KCl(pH 9.0)을 사용할 수 있으며, 상기 dNTPs는 dATP, dTTP, dGTP, dCTP 중에서 선택된 어느 하나 이상을 사용할 수 있다.The buffer solution for reaction may be 1 to 10 mM TrisHCl, 10 to 40 mM KCl (pH 9.0), and the dNTPs may be selected from dATP, dTTP, dGTP, and dCTP.

상기 키트에는 실험상의 편의, 안정화 및 반응성 향상을 위해 안정화제 및/또는 비반응성 염료 등를 포함할 수 있다.The kit may include stabilizers and / or non-reactive dyes for improving experimental convenience, stabilization, and reactivity.

본 발명에 따른 검출방법 및 검출키트는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 존재 여부를 높은 민감도와 특이성으로 검출할 수 있고, 나아가 클로스트리디움 퍼프린젠스 (Clostridium botulium) 및 클로스트리디움 퍼프린젠스(Clostridium perfringens)의 존재 여부를 판단할 수 있다.Detection method and detection kit according to the present invention, a botulinum toxin A, B, E and Clostridium perfringens alpha for the presence of the toxin gene can be detected with high sensitivity and specificity, and further Clostridium perfringens (Clostridium botulium and Clostridium perfringens in the presence or absence of the bacteria .

이하, 실시예, 실험예 및 비교예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 예에 의해 제한되지 않는다.Hereinafter, the present invention will be described in more detail with reference to Examples, Experimental Examples and Comparative Examples. These examples are provided only for illustrating the present invention more specifically, and the scope of the present invention is not limited by these examples according to the gist of the present invention.

실시예 1: 프라이머 및 프로브의 제작Example 1: Preparation of primers and probes

보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자 검출을 위해 각각의 특이적인 유전자를 합성하여 양성대조군 및 성능평가를 위한 주형으로 사용하였다. 구체적으로 프라이머 세트의 합성에는 염기서열 분석을 통해 NCBI 데이터 베이스에 등록된 등록번호(access number) KM233166, AB665557, JX424539, CP010993 정보를 이용하였다(도 1 참조). For the detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin genes, each specific gene was synthesized and used as a positive control and a template for performance evaluation. Specifically, for the synthesis of the primer set, the accession numbers KM233166, AB665557, JX424539, and CP010993 registered in the NCBI database through base sequence analysis were used (see FIG. 1).

도 1의 유전자의 합성과 하기 표 1 및 2의 프라이머와 프로브의 제작은 파이오니아사(pioneer, 한국)의 올리고 합성 서비스를 이용하여 합성하였고, 형광프로브의 경우 FAM, CY5, JOE, TAMRA, EBQ로 수식하여 최종 농도가 100uM이 되도록 멸균증류수를 첨가하여 준비하였으며, 증폭 실험 전까지 냉장보관하였다.The synthesis of the gene of FIG. 1 and the preparation of the primers and probes of Tables 1 and 2 were performed using oligo synthesis service of Pioneer, Korea. In the case of fluorescent probes, FAM, CY5, JOE, TAMRA and EBQ Sterilized distilled water was added so as to have a final concentration of 100 μM, and the suspension was refrigerated until the experiment.

이때 프라이머와 프로브 서열의 Tm 값 분석은 IDT사에서 제공하는 web-based 프로그램인 oligoanalyzer 3.1을 이용하였다.At this time, the Tm value of primer and probe sequence was analyzed using oligoanalyzer 3.1, a web-based program provided by IDT.

프라이머(primer)Primer 서열번호SEQ ID NO: 5’ 수식5 'formula 염기서열Base sequence 명칭designation 3‘ 수식3 'formula 길이Length GC%GC% TmTm 증폭산물Amplification product 1One -- CTCAATACATTAGATTTAGCCCAGACTCAATACATTAGATTTAGCCCAGA TA forward primerTA forward primer -- 2525 3636 52.452.4 108108 22 -- CYGCTGGATCTGTAGCAAATCYGCTGGATCTGTAGCAAAT TA reverse primerTA reverse primer -- 2020 47.547.5 53.853.8 33 -- AGTAATCCAGGAGAAGTGGAGAGTAATCCAGGAGAAGTGGAG TB forward primerTB forward primer -- 2121 47.647.6 53.353.3 133133 44 -- AGCCTTCCCTTGATGCAAAAGCCTTCCCTTGATGCAAA TB reverse primerTB reverse primer -- 1919 47.447.4 54.854.8 55 -- CCATATTTAGGGAATGATAATACTCCAGCCATATTTAGGGAATGATAATACTCCAG TE forward primerTE forward primer -- 2121 35.735.7 53.153.1 9494 66 -- TGTSTTGGMTACCATTTGAGATGTSTTGGMTACCATTTGAGA TE reverse primerTE reverse primer -- 1919 40.540.5 52.752.7 77 -- ACTCCATATCATCCTGCTAATGTTACTCCATATCATCCTGCTAATGTT Alpha forward primerAlpha forward primer -- 2828 37.537.5 53.853.8 113113 88 -- TTGCAACCTRCTGTGTTTATTTTTGCAACCTRCTGTGTTTATTT Alpha reverse primerAlpha reverse primer -- 2121 34.134.1 52.252.2

프로브(probe)The probe 서열번호SEQ ID NO: 5’ 수식5 'formula 염기서열Base sequence 3‘ 수식3 'formula 길이Length GC%GC% TmTm 증폭산물Amplification product 비고
(특이성)
Remarks
(Specificity)
99 FAMFAM CAAATCCTCTTTTAGGTGCAGGCCAAATCCTCTTTTAGGTGCAGGC EBQEBQ 2323 47.847.8 56.456.4 108108 TA probeTA probe 1010 CY5CY5 ATTTGGACCTGGGCCAGTTTATTTGGACCTGGGCCAGTTT EBQEBQ 2020 5050 57.357.3 133133 TB probeTB probe 1111 JOEJOE TGGTGATGCATCAGCAGTTGAGATGGTGATGCATCAGCAGTTGAGA EBQEBQ 2020 47.847.8 58.758.7 9494 TE probeTE probe 1212 TAMRATAMRA ACTGCCGTTGATAGCGCAGGAACTGCCGTTGATAGCGCAGGA EBQEBQ 2323 57.157.1 61.461.4 113113 Alpha probeAlpha probe

실시예 2: 프라이머 및 프로브의 성능평가Example 2: Performance evaluation of primer and probe

상기 실시예 1에서 준비한 표 1 및 2의 프라이머 및 프로브와 도 1의 합성 유전자를 이용하고, 하기 표 3의 반응 조성액을 조제하여 사용하였다. 2X Real-time PCR Master Mix는 제이에스바이오테크사의 제품을 사용하였다. 분석기기는 파이오니아사(pioneer, 한국)의 Exicycler 96 real-time PCR 장비를 이용하여 진행하였다. 준비된 반응 조성액은 하기 표 4의 온도 조건으로 37번 반복하여 실험을 진행하였으며, 음/양성 판정은 Ct 값 기준으로 확인하였다. 이때 보툴리눔 독소 A, B, E, cpa의 경우 합성 유전자를 10^7 ~ 10^1 copies로 정량하여 준비하고 이를 주형으로 사용하여 측정하였다. Using the primers and probes of Tables 1 and 2 prepared in Example 1 and the synthetic gene of FIG. 1, the reaction composition liquid of Table 3 was prepared and used. The 2X Real-time PCR Master Mix was a product of JEES Biotech. The analytical instrument was performed using Exicycler 96 real-time PCR instrument from Pioneer (Korea). The prepared reaction mixture solution was repeated 37 times under the temperature conditions shown in Table 4, and the negative / positive determination was confirmed based on the Ct value. For the botulinum toxin A, B, E, and cpa, 10 ~ 7 ~ 10 ^ 1 copies of the synthetic gene were prepared and used as a template.

Real-Time PCR 실험을 위한 반응 조성액Reaction formulation for Real-Time PCR 구 성 물Composition 첨 가 량Additive amount 2X Real-time PCR Master Mix2X Real-time PCR Master Mix 10 ul10 μl Forward Primer(100uM)Forward Primer (100 uM) 0.1 ul0.1 μl Revers Primer(100uM)Revers Primer (100 uM) 0.1 ul0.1 μl Probe (100uM)Probe (100 uM) 0.05 ul0.05 μl Template DNATemplate DNA 2 ul2 μl Nucelase Free WaterNucelase Free Water 7.75 ul7.75 μl Total VolumeTotal Volume 20 ul20 μl

DenaturationDenaturation 95 ℃, 5 min95 ° C, 5 min 40 cycles40 cycles DenaturationDenaturation 95 ℃, 10 sec95 ° C, 10 sec Annealing & Extension (Data collection)Annealing & Extension (Data collection) 55 ℃, 45 sec55 C, 45 sec

이에 대한 결과는 도 2 내지 도 5에 나타내었다. 보툴리눔 독소 A, B의 경우 10^1 copies까지 검출이 가능하였다(도면 2 및 3 참조). 보툴리눔 독소 E의 경우 10^2 copies까지 검출이 가능하였다(도면 4 참조). 클로스트리디움 퍼프린젠스 alpha 독소의 경우 10^1 copies까지 검출이 가능하였다(도면 5 참조). The results are shown in Figs. 2 to 5. Botulinum toxin A and B were detectable up to 10 ^ 1 copies (see Figures 2 and 3). Botulinum toxin E was detectable up to 10 ^ 2 copies (see Figure 4). Clostridium perfringens alpha toxin was detectable up to 10 ^ 1 copies (see Figure 5).

실시예 3: Real-Time PCR 수행Example 3 Real-Time PCR Performed

보툴리눔 독소 A, B, E, 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자를 동시 검출하기 위해 도 1에 나타낸 합성 유전자를 10^5 copies가 되도록 주형을 준비하고, 이를 실시예 1과 동일한 조건으로 Real-Time PCR을 수행하였다. 실험 결과, 보툴리눔 독소 A, B, E, 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자가 동시에 증폭됨을 확인하였다(도면 6 참조). In order to simultaneously detect the botulinum toxin A, B, E, and Clostridium perfringens alpha toxin genes, a template was prepared to have 10 5 copies of the synthetic gene shown in FIG. 1, -Time PCR was performed. As a result, it was confirmed that the botulinum toxin A, B, E, and Clostridium perfringens alpha toxin genes were simultaneously amplified (see FIG. 6).

<110> LOTTE FOODS CO.,LTD. <120> Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit <130> DP-2016-0376 <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TA forward primer <400> 1 ctcaatacat tagatttagc ccaga 25 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TA reverse primer <400> 2 cygctggatc tgtagcaaat 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TB forward primer <400> 3 agtaatccag gagaagtgga g 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TB reverse primer <400> 4 agccttccct tgatgcaaa 19 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TE forward primer <400> 5 ccatatttag ggaatgataa tactccag 28 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TE reverse primer <400> 6 tgtsttggmt accatttgag a 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Alpha forward primer <400> 7 actccatatc atcctgctaa tgtt 24 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Alpha reverse primer <400> 8 ttgcaacctr ctgtgtttat tt 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TA probe <400> 9 caaatcctct tttaggtgca ggc 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TB probe <400> 10 atttggacct gggccagttt 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TE probe <400> 11 tggtgatgca tcagcagttg aga 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Alpha probe <400> 12 actgccgttg atagcgcagg a 21 <110> LOTTE FOODS CO., LTD. <120> Method for detecting rapidly botulium toxin A, B, E and          Clostridium perfringens alpha toxin and detection kit <130> DP-2016-0376 <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TA forward primer <400> 1 ctcaatacat tagatttagc ccaga 25 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TA reverse primer <400> 2 cygctggatc tgtagcaaat 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TB forward primer <400> 3 agtaatccag gagaagtgga g 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TB reverse primer <400> 4 agccttccct tgatgcaaa 19 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TE forward primer <400> 5 ccatatttag ggaatgataa tactccag 28 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TE reverse primer <400> 6 tgtsttggmt accatttgag a 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Alpha forward primer <400> 7 actccatatc atcctgctaa tgtt 24 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Alpha reverse primer <400> 8 ttgcaacctr ctgtgtttat tt 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TA probe <400> 9 caaatcctct tttaggtgca ggc 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TB probe <400> 10 atttggacct gggccagttt 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TE probe <400> 11 tggtgatgca tcagcagttg aga 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Alpha probe <400> 12 actgccgttg atagcgcagg a 21

Claims (8)

하기 단계를 포함하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
(a) 시료(sample)로부터 유전체 DNA를 추출하는 단계;
(b) 상기 추출된 유전체 DNA, 서열번호 1 내지 8의 프라이머 세트, 및 서열번호 9 내지 12의 프로브를 포함하는 실시간 중합효소연쇄반응(Real-Time Polymerase Chain Reaction)액을 제조하는 단계; 및
(c) 실시간 중합효소연쇄반응을 수행하는 단계.
A method for rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene comprising the steps of:
(a) extracting a genomic DNA from a sample;
(b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID Nos. 1 to 8, and the probes of SEQ ID Nos. 9 to 12; And
(c) performing a real-time PCR reaction.
제 1 항에 있어서, 상기 서열번호 1 및 2는 보툴리눔 독소 A 합성 유전자의 염기서열을 포함하며,
상기 서열번호 3 및 4는 보툴리눔 독소 B 합성 유전자의 염기서열을 포함하고,
상기 서열번호 5 및 6은 보툴리눔 독소 E 합성 유전자의 염기서열을 포함하고,
상기 서열번호 7 및 8은 클로스트리디움 퍼프린젠스 alpha 합성 유전자의 염기서열을 포함하는 것을 특징으로 하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
[Claim 2] The method according to claim 1, wherein the nucleotide sequence of the botulinum toxin A synthetic gene is SEQ ID NOS: 1 and 2,
SEQ ID NOS: 3 and 4 contain the nucleotide sequence of the botulinum toxin B synthetic gene,
SEQ ID NOS: 5 and 6 contain the nucleotide sequence of the botulinum toxin E synthetic gene,
Wherein the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 comprises the nucleotide sequence of Clostridium perfringens alpha synthase gene, and the method for rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene.
제 1 항에 있어서, 상기 서열번호 9는 보툴리눔 독소 A 유전자에 특이적으로 결합하고,
상기 서열번호 10은 보툴리눔 독소 B 유전자에 특이적으로 결합하며,
상기 서열번호 11은 보툴리눔 독소 E 유전자에 특이적으로 결합하고,
상기 서열번호 12는 클로스트리디움 퍼프린젠스 alpha 독소 유전자에 특이적으로 결합하는 것을 특징으로 하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
The method according to claim 1, wherein the sequence number 9 specifically binds to the botulinum toxin A gene,
SEQ ID NO: 10 specifically binds to the botulinum toxin B gene,
SEQ ID NO: 11 specifically binds to the botulinum toxin E gene,
Wherein said SEQ ID NO: 12 specifically binds to Clostridium perfringens alpha toxin gene. 11. A method for rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene.
제 1 항에 있어서, 상기 프로브는 5` 말단에 형광발색제(fluorescent reporter dye)가 표지되고 3` 말단에는 소광제(quencher)가 표지된 것을 특징으로 하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
The method according to claim 1, wherein the probe is labeled with a fluorescent reporter dye at the 5 'end and a quencher at the 3' end. The botulinum toxin A, B, E and Clostridium Rapid Detection of Puffrin Genes alpha Toxin Gene.
제 4 항에 있어서, 상기 형광발색제는 6-카르복시플루오레세인(6-carboxyfluorescein, FAM), 2,7-디메톡시-4,5-디클로로-6-카복시플루오루세인(2,7-dimethoxy-4,5-dichloro-6-carboxyfluoroscein, JOE), 5-카르복시테트라메틸로다민 (5-Carboxytetramethylrhodamine, TAMRA), 및 시아닌-5(Cyanine-5, Cy5)으로 이루어진 군에서 선택되는 것을 특징으로 하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
5. The method of claim 4, wherein the fluorescent colorant is selected from the group consisting of 6-carboxyfluorescein (FAM), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein, Carboxytetramethylrhodamine (TAMRA), and cyanine-5 (Cyanine-5, Cy5), which is selected from the group consisting of 4,5-dichloro-6-carboxyfluoroscein, JOE, A method for rapid detection of toxin A, B, E and Clostridium perfringens alpha toxin gene.
제 4 항에 있어서, 상기 소광제는 Excellent Bioneer Quencher(EBQ), Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3(BHQ-3), 5-Carboxytetramethylrhodamine (TAMRA), deep dark Quencher 1 (DDQ1), 및 deep dark Quencher 2(DDQ2)로 이루어진 군으로부터 선택되는 것을 특징으로 하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 신속한 검출방법.
5. The method of claim 4, wherein the quencher is selected from the group consisting of Excellent Bioneer Quencher (EBQ), Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3 (TAMRA), deep dark Quencher 1 (DDQ1), and deep dark Quencher 2 (DDQ2). The rapid detection of botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene Way.
서열번호 1 내지 8의 프라이머 세트 및 서열번호 9 내지 12의 프로브를 포함하는 보툴리눔 독소 A, B, E 및 클로스트리디움 퍼프린젠스 alpha 독소 유전자의 검출 키트.
A kit for detecting botulinum toxin A, B, E and Clostridium perfringens alpha toxin gene comprising the primer set of SEQ ID NOs: 1 to 8 and the probes of SEQ ID NOs: 9 to 12.
제 7 항에 있어서, 상기 키트는 반응용 완충용액, dNTPs, Mg2+이온, 및 DNA 중합효소를 포함하는 검출 키트.8. The detection kit according to claim 7, wherein the kit comprises a reaction buffer solution, dNTPs, Mg2 + ions, and a DNA polymerase.
KR1020160113322A 2016-09-02 2016-09-02 Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit KR101823353B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160113322A KR101823353B1 (en) 2016-09-02 2016-09-02 Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160113322A KR101823353B1 (en) 2016-09-02 2016-09-02 Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit

Publications (1)

Publication Number Publication Date
KR101823353B1 true KR101823353B1 (en) 2018-01-31

Family

ID=61082853

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160113322A KR101823353B1 (en) 2016-09-02 2016-09-02 Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit

Country Status (1)

Country Link
KR (1) KR101823353B1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148548A (en) * 2016-08-31 2016-11-23 青海省畜牧兽医科学院 A kind of can detect bacillus perfringens, clostridium hemolyticum and the multiple PCR detection kit of Type B Nuo Weishi clostridium and application thereof simultaneously
CN111983240A (en) * 2020-08-27 2020-11-24 天津大学 Visual detection method for clostridium perfringens alpha toxin
KR102200925B1 (en) * 2019-07-30 2021-01-13 대한민국(질병관리청장) Method of testing genes in real-time pcr for rapid detecting 15 species of bio terror phatogens and subspecies phatogens comprising clostridium botulinum neurotoxin a
KR102438962B1 (en) * 2022-02-25 2022-09-01 국방과학연구소 Primer set and TaqMan probe optimized for detection toxin genes of Ricin, Staphylococcal enterotoxin B, or Clostridium botulinum A using TaqMan Multiplex real-time PCR
KR102467600B1 (en) * 2022-05-13 2022-11-16 국방과학연구소 Primer sets for detecting toxin agents, and method for detecting toxin agents using the same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
APPLIED AND ENVIRONMENTAL MICROBIOLOGY., vol.67, no.12, p.5694-5699 (2001.12)
Indian J Med Res 128., pp 206-208 (2008.08)
Letters in Applied Microbiology., vol.25, p.186-190 (1997)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148548A (en) * 2016-08-31 2016-11-23 青海省畜牧兽医科学院 A kind of can detect bacillus perfringens, clostridium hemolyticum and the multiple PCR detection kit of Type B Nuo Weishi clostridium and application thereof simultaneously
KR102200925B1 (en) * 2019-07-30 2021-01-13 대한민국(질병관리청장) Method of testing genes in real-time pcr for rapid detecting 15 species of bio terror phatogens and subspecies phatogens comprising clostridium botulinum neurotoxin a
CN111983240A (en) * 2020-08-27 2020-11-24 天津大学 Visual detection method for clostridium perfringens alpha toxin
CN111983240B (en) * 2020-08-27 2023-11-21 天津大学 Visual detection method for clostridium perfringens alpha toxin
KR102438962B1 (en) * 2022-02-25 2022-09-01 국방과학연구소 Primer set and TaqMan probe optimized for detection toxin genes of Ricin, Staphylococcal enterotoxin B, or Clostridium botulinum A using TaqMan Multiplex real-time PCR
KR102467600B1 (en) * 2022-05-13 2022-11-16 국방과학연구소 Primer sets for detecting toxin agents, and method for detecting toxin agents using the same

Similar Documents

Publication Publication Date Title
KR101823353B1 (en) Method for detecting rapidly botulium toxin A, B, E and Clostridium perfringens alpha toxin and detection kit
CN101883866A (en) Detect the method for nucleic acid by while isothermal duplication nucleic acid and signal probe
US11434533B2 (en) Method for detecting target nucleic acid and nucleic acid probe used therein
CN102844447A (en) Food-poisoning bacteria detection carrier, and method for detecting food-poisoning bacteria
Wu et al. Single-base mismatch discrimination by T7 exonuclease with target cyclic amplification detection
CN102933720B (en) Method for generating a double stranded nucleic acid with a single stranded overhang
KR101288035B1 (en) Primer set for discrimination of Brucella
WO2011015356A1 (en) Nucleic acids and methods for the detection of enterobacter sakazakii (cronobacter spp.)
Van Doorn et al. Robust detection and identification of multiple oomycetes and fungi in environmental samples by using a novel cleavable padlock probe-based ligation detection assay
KR101282924B1 (en) PCR primer for detecting Salmonella
KR101798478B1 (en) Method for detecting rapidly Aspergillus flavus strain producing aflatoxin and detection kit
KR102388060B1 (en) Composition for distinguishing between Mycobacterium tuberculosis and Beijing family Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis using the same
KR20190041314A (en) Oligonucleotide set for detection of chikungunya virus and uses thereof
US7267943B1 (en) Methods for detecting bacteriophage MS2
KR101977377B1 (en) Method for detecting rapidly Alicyclobacillus producing guaiacol and detection kit
KR101670934B1 (en) Primer set for detection of Clostridium botulinum, composition, and kit comprising the same
GB2549799A (en) A multiplex assay for the sensitive and specific detection and differentiation of Clostridium difficile
EP3523447B1 (en) A method for the detection of legionella
KR101492989B1 (en) PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis
KR101886379B1 (en) Method for detecting rapidly yeast growing in presence of a carbonic acid and detection kit
CN107110864B (en) Method for detecting the presence of highly virulent strains of clostridium difficile
AU2015289612B2 (en) Sequences and their use for detection of Listeria monocytogenes
KR101518561B1 (en) Development of species-specific PCR method for detection of Acinetobacter species
US7642082B1 (en) Methods for determining the presence of staphylococcal enterotoxin A gene in a sample
KR102322080B1 (en) Real time pcr primers for detection of genetically modified soybean

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant