KR101886379B1 - Method for detecting rapidly yeast growing in presence of a carbonic acid and detection kit - Google Patents

Abstract

The present invention relates to a method for rapidly detecting yeast capable of growing in the presence of carbonic acid using a real-time PCR technique and a detection kit and, more specifically, to a real-time PCR technique using primer sets of SEQ ID NOs: 1 to 3 and probes of SEQ ID NOs: 4 to 8. By using the real-time PCR, it is possible to rapidly detect Saccharomyces cerevisiae, Schizosaccharomyces spp., Zygosaccharomyces spp., and Dekkera spp. which are yeast strains capable of growing in the presence of carbonic acid.

Description

Technical Field [0001] The present invention relates to a method for rapidly detecting a yeast capable of growing in a carbonic acid condition,

The present invention relates to a rapid detection method and a detection kit for yeast capable of growing in a carbonic acid condition using a Real-Time PCR technique, more specifically, to a primer set of SEQ ID Nos: 1 to 3 and a Real -Time PCR technique. Using Real-Time PCR, the Saccharomyces cerevisiae strain Saccharomyces , a yeast strain capable of growing under carbonic acid conditions, cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp .), Zygosaccharomyces spp ., and Te Keraton spp (Dekkera spp .) can be simultaneously detected quickly.

Carbonated beverages have high acidity and low oxygen content due to the nature of the product. There are few microorganisms that can grow under these conditions, and yeast is a typical example. Currently, there are about 900 kinds of yeast, but not all yeast can grow under carbonation conditions. If the carbonated beverage is contaminated by a yeast capable of growing in a carbonated condition, problems such as swelling of the product, generation of odor and discoloration of the product may occur.

Davenport divides yeast into four groups of yeast that can be detected in a soft drink manufacturing plant. Group 1 is a yeast strain resistant to osmotic pressure (carbonic conditions), strong fermentation ability, and preservatives. Dekkera anomala), having Mosquera Brewer swelren sheath (Dekkera bruxellensis), having Mosquera or denae sheath (Dekkera naardenensis ), Saccharomyces cerevisiae , Schizosaccharomyces pombe , Zygosaccharomyces cerevisiae , A bar with a point (Zygosaccharomyces bailii), Jai Mai Kosaka access Service porous (Zygosaccharomyces bisporus ), Zygosaccharomyces Rentas ( Zygosaccharomyces lentus ), Zygosaccharomyces Include low when (Zygosaccharomyces rouxii).

Here, even if the yeast belonging to Group 1 exists only in one cell in the product, it is possible to grow the product, which may lead to swelling and odor generation of the product and discoloration of the product. Group 2, Group 3 and Group 4 are indicator bacteria for hygienic management of factories, divided by yeast, which is impossible to grow in the product.

Korean Patent No. 10-1562491 and No. 10-1498768 relate to a method for detecting a specific strain using real-time PCR. In a real-time PCR (polymerase chain reaction), a thermal cycler and a spectroscopic fluorescence spectrometer are integrated It is a device that analyzes the amount of target DNA (target DNA) by monitoring the production process of PCR amplification product in real time. Real-time PCR does not require electrophoresis for confirmation of PCR amplification products, and it is a method that is more rapid and quantitative that can quantify more precisely by comparing amplification products in the region where amplification occurs exponentially. Indeed, it is an important tool used for accurate quantification of target genes in samples from gene expression, gene copy assays, genotyping, and so on.

The yeast of Group 1 mentioned above should be controlled so as not to exist in the raw materials and the production line. The above yeasts can be cultured on PDA medium through raw material and line swap. However, when the number of yeast colonies grown on the medium is not morphologically identifiable, all the colonies are identified. It is not realistic as hygiene management plan because it is time and expense. Therefore, we have developed a real-time PCR method that can qualitatively test the yeast that can grow in carbonic acid condition at once.

Therefore, the present inventors prepared a new primer set capable of simultaneously detecting yeast capable of growing under carbonic acid conditions, and designed a specific probe on the basis of the prepared primer set. As a result, real-time PCR was carried out. As a result, In Saccharomyces cerevisiae strains ( Saccharomyces cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp.), my process in strain with Xi Kosaka (Zygosaccharomyces spp.), and Te Keraton spp (Dekkera spp .) at the same time can be confirmed accurately. Thus, the present invention has been completed.

Accordingly, the present invention provides a method for rapidly detecting four yeasts capable of growing under carbonic acid conditions.

In addition, the present invention is to provide a kit for detecting four yeasts capable of growing under carbonic acid conditions.

In order to solve the above-mentioned problems, the present invention provides a method for producing a DNA probe, comprising the steps of: (a) extracting a genomic DNA from a sample; (b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID NOS: 1 to 3, and the probes of SEQ ID NOS: 4 to 8; And (c) performing a real-time PCR reaction under carbonic acid conditions.

The present invention also provides a kit for detecting yeast capable of growing under carbonic acid conditions, comprising the primer set of SEQ ID NOS: 1 to 3 and the probes of SEQ ID NOS: 4 to 8.

The present invention is a representative yeast strain capable of growing under carbonic conditions such as carbonated beverages. Saccharomyces cerevisiae strain Saccharomyces cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp .), Zygosaccharomyces spp ., and Te Keraton spp (Dekkera spp .) in the carbonated food can be quickly checked, and thus it can be usefully used for confirming the presence or absence of contaminants in the carbonated food.

Figure 1 is a schematic representation of the Saccharomyces cerevisiae strain cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp . ) , And Zygosaccharomyces spp . , And & lt ; RTI ID = 0.0 & gt ; Dekkera strain spp .).
Fig. 2 is a graph showing the activity of Saccharomyces cerevisiae strain S. cerevisiae ) were tested for real-time PCR.
Fig. 3 shows the results obtained by measuring spp .).
Fig. 4 is a graph showing the activity of the strain Shizosaccharomyces spp . ) In the real-time PCR.
FIG. 5 is a graph showing the activity of the strain Zygosaccharomyces spp . ) In the real-time PCR.
FIG. 6 is a graph showing the results of real-time PCR for Dekkera spp ., Which was detected using the method described in APPLIED AND ENVIRONMENTAL MICROBIOLOGY (Dec. 2003, p. 7430-7434) Test results.
FIG. 7 shows the results of detection using Saccharomyces cerevisiae strain ( Saccharomyces cerevisiae), which was detected using the method described in the prior art (APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2005, p. 6823-6830) S. cerevisiae ).

Hereinafter, the present invention will be described in more detail as an embodiment.

The present invention relates to a strain of Saccharomyces cerevisiae cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp . ) , Zygosaccharomyces spp . , And Dekkera strain . spp) extracting genomic DNA from, (a) sample (sample) in order to rapidly detect a possible growth of yeast from one or more conditions selected from the group consisting of carbonate; (b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID NOS: 1 to 3, and the probes of SEQ ID NOS: 4 to 8; And (c) performing a real-time PCR reaction.

As used herein, the term " primer " refers to a nucleic acid sequence having a short free 3 'terminal hydroxyl group that can form base pairs with a complementary template and serves as a starting point for template strand copying Quot; means a short nucleic acid sequence. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different dNTPs (deoxynucleoside triphospate) at appropriate buffer solutions and temperatures.

Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis.

In the present invention, the primers comprising the nucleotide sequences of SEQ ID NOS: 1 to 3 each include a nucleotide sequence having a sequence homology of 95% or more. For example, when the primer is 20 bp, two or more of the 20 bp errors result in a poorer melting temperature than 5 ° C. However, if only one is wrong, the annealing temperature If you experiment a little down, you will get equal results.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, " capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin) have.

In the present invention, " probe " means a nucleic acid fragment consisting of several to several hundred bases capable of specifically binding to a nucleotide sequence and is labeled to confirm the presence or absence of a specific nucleic acid. The probe can be produced in the form of an oligonucleotide probe, a short-chain DNA probe, a double-stranded DNA probe, an RNA probe, etc., and can be labeled with biotin, FITC, rhodamine, DIG or the like or labeled with radioisotope.

In the probe of the present invention, a fluorescent reporter dye may be labeled at the 5 'end and a quencher may be labeled at the 3' end.

More preferably, the fluorescent substance labeled at the 5'-end is selected from the group consisting of 6-carboxyfluorescein (FAM), hexachloro-6-carboxyfluorescein (HEX) Tetrachloro-6-carboxyfluorescein, and Cyanine-5 (Cy5).

The quenching agents labeled at the 3'-end were: Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3 (BHQ-3), 5-Carboxytetramethylrhodamine Quencher 1 (DDQ1), EBQ and deep dark Quencher 2 (DDQ2).

Each fluorescent substance labeled at the 5'-end and the 3'-end of the probe may exhibit a mutual interference phenomenon. Thus, in the state where the probe is bound to the target base sequence existing in the sample, the fluorescent substance at the 5'-end is inhibited by the fluorescent energy of the 3'-terminal and the color development is restricted. In the case of performing the polymerase chain reaction, End of the fluorescent substance is liberated and the inhibition by the fluorescent substance at the 3'-terminal is released, so that the fluorescent substance undergoes the color development reaction.

In the present invention, SEQ ID NO: 1 represents Saccharomyces cerevisiae , Schizosaccharomyces sp. spp . ), And The strain Zygosaccharomyces spp . ), SEQ ID NO: 2 is a primer for amplifying the Saccharomyces cerevisiae strain ( Saccharomyces S. cerevisiae , Zygosaccharomyces sp. spp . ) , And Mosquera, Te, and primers for amplifying sp (Dekkera spp.), The SEQ ID NO: 3 primer for amplifying My process sp (Schizosaccharomyces spp.) To a progenitor saccharide.

In addition, SEQ ID NO: 4 of the present invention will in the probe for detecting the three Levy MY process jiae strains (Saccharomyces cerevisiae) as a saccharide, SEQ ID NO: 5 is Te Mosquera sp (Dekkera spp .), SEQ ID NOS: 6 and 7 are probes for detection of Schizosaccharomyces sp. spp . ).

Also provided is a detection kit for a yeast capable of growing under a carbonic acid condition comprising the primer set of SEQ ID NOs: 1 to 3 and the probes of SEQ ID NOs: 4 to 8 of the present invention.

The kit of the present invention can use the components used in the PCR composition in addition to the primers of SEQ ID NOs: 1 to 3 and the probes of SEQ ID NOS: 4 to 8. Examples of the components of the composition include reaction buffer solutions, dNTPs, Mg2 + ions, and DNA polymerase.

The buffer solution for reaction may be 1 to 10 mM TrisHCl, 10 to 40 mM KCl (pH 9.0), and the dNTPs may be selected from dATP, dTTP, dGTP, and dCTP.

The kit may include stabilizers and / or non-reactive dyes for improving experimental convenience, stabilization, and reactivity.

The detection method and the detection kit according to the present invention are representative yeasts capable of growing under carbonic conditions such as carbonated beverages. Saccharomyces cerevisiae , Schizosaccharomyces sp. spp . ) , Zygosaccharomyces strain spp . ) , And Dekkera strain spp .) can be detected at the same time, and the presence or absence of carbonic acid contaminants in the carbonated food can be detected with high sensitivity and specificity.

Hereinafter, the present invention will be described in more detail with reference to Examples, Experimental Examples and Comparative Examples. These examples are provided only for illustrating the present invention more specifically, and the scope of the present invention is not limited by these examples according to the gist of the present invention.

Example  1: Homology  analysis

Saccharomyces cerevisiae strains cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp . ) , Zygosaccharomyces spp . , & Lt ; RTI ID = 0.0 > And Dekkera strain spp .) was selected for the detection of large subunit ribosomal RNA gene as a target gene and the homology analysis of the standard sequence of each representative yeast was performed. The results are shown in FIG. 1, and detailed sequence information is shown in the following Table 1 As shown in Fig.

Sequence information Name Accession number Name Accession number Dekkera  bruxellensis DQ406715 Saccharomyces  cerevisiae KP070750 Dekkera  bruxellensis DQ406716 Saccharomyces  cerevisiae KP966895 Dekkera  bruxellensis KY107599 Saccharomyces  cerevisiae KX377686 Dekkera  bruxellensis KY107603 Saccharomyces
round KX588256 Dekkera  bruxellensis KY107604 Zygosaccharomyces
bailii FR690851 Dekkera  bruxellensis KY107605 Zygosaccharomyces
lentus KY110250 Dekkera  bruxellensis KY107608 Zygosaccharomyces
mellis LN849086 Dekkera  bruxellensis KY107610 Zygosaccharomyces
rouxii KX377686 Dekkera  bruxellensis KY107613 schizosaccharomyces
japonicus AB566264 Dekkera  bruxellensis KY107614 schizosaccharomyces
japonicus EU523635 Dekkera  bruxellensis KY107615 schizosaccharomyces
japonicus KT767194 Dekkera  bruxellensis AM850055 schizosaccharomyces
japonicus KY109594 Dekkera  bruxellensis FR853167 schizosaccharomyces
japonicus KY109596 Dekkera  bruxellensis HE964967 schizosaccharomyces
japonicus KY109598 Dekkera  bruxellensis HF547277 schizosaccharomyces
japonicus XR 845621 Dekkera  bruxellensis JX094787 schizosaccharomyces
japonicus XR 845623 Dekkera  bruxellensis KM236198 schizosaccharomyces
japonicus XR 845625 Dekkera anomala U84244 schizosaccharomyces
japonicus XR 845627 Dekkera anomala FJ805786 schizosaccharomyces
cryophilus GU470882 Dekkera anomala KY107597 schizosaccharomyces
octosporus KY109599 Dekkera anomala KF790763 schizosaccharomyces
octosporus KY109560 Dekkera anomala KF790781 schizosaccharomyces
octosporus KY109561 Dekkera anomala KF790784 schizosaccharomyces
octosporus XR 001203012 Dekkera anomala KF790801 schizosaccharomyces
octosporus XR 001203016 Dekkera anomala KY107595 schizosaccharomyces
pumice JQ804983 Dekkera anomala KY107596 schizosaccharomyces
pumice KF278469 Dekkera anomala KY107598 schizosaccharomyces
pumice KP190156 Saccharomyces  cerevisiae KX588255 schizosaccharomyces
pumice LC021488 Saccharomyces  cerevisiae KM885965 schizosaccharomyces
pumice LC170432

Example  2: primer  And Of the probe  making

The synthesis of the primer set for the detection of the strains which survived under the carbonic acid condition was synthesized using oligo synthesis service of Bioneer (Daejeon, Korea). In the case of the fluorescent probe, it was modified with FAM, CY5 and EBQ, Buffer and refrigerated until the experiment.

At this time, the Tm value of primer and probe sequence was analyzed using oligoanalyzer 3.1, a web-based program provided by IDT.

primer SEQ ID NO: Sequence * (5 '-> 3') designation Length GC% Tm One CAAGTASAGTGATSGAAAGATGAAAAGAAC SaScZyDe forward primer 30 36.7 56.1 2 AACYGATGCTGGCCCAGT SaZyDe reverse primer 18 58.3 58.5 3 CRRAAACTGATGCTGACCTACC Sc reverse primer 22 50 55.7 * S: C / G, Y: C / T, R: A / G, K: G / T

Probe SEQ ID NO: 5 'formula Sequence * (5 '-> 3') 3 'formula Length GC% Tm Remarks
(Specificity) 4 FAM AGGGGAATCTCGCATTTC EBQ 18 50 52.2 Sa probe 5 CY5 CTCGTGGATGGGTGCACC EBQ 18 66.7 58.8 De probe 6 FAM AGACAGTGCACTCTGAACCTA EBQ 21 47.6 55.4 Sc-1 probe 7 FAM AGRCKATGCACTCTGAACCTGT EBQ 22 50 58.2 Sc-2 probe 8 CY5 TGRGGGAATCTCGCAGCTC EBQ 19 60.5 58.3 Zy probe * S: C / G, Y: C / T, R: A / G, K: G / T

Example  3: primer  And Of the probe  Identification of specificity

(1) Extraction of genomic DNA from microorganisms

For yeast gene amplification experiments that can be grown under carbon conditions, the yeasts listed in Table 2 below were purchased from the BRC (Jeongeup, Korea). After culturing according to the provided information, DNA extraction kit of Jinol (Seoul, Korea) was used to extract and refrigerated until the experiment.

Strain for specificity experiment turn Strain name KCTC number One Dekkera anomala 7528 2 Dekkera bruxellensis 7532 3 Dekkera bruxellensis 17337 4 Schizosaccharomyces pumice 27259 5 Schizosaccharomyces pumice  there is. pumice 7522 6 Zygosaccharomyces bailii 7539 7 Zygosaccharomyces lentus 17633 8 Zygosaccharomyces rouxii 17748 9 Saccharomyces cerevisiae 17298

(2) Real-Time PCR  Perform( primer  And Of the probe  Performance evaluation)

Using the primers and probes of Tables 2 and 3 prepared in Example 2 and the DNA fragments of the microorganisms of Table 4 prepared in Example 3, the reaction composition liquid of Table 5 was prepared and used. The 2X Real-time PCR Master Mix was a product of JEES Biotech. The analytical instrument was performed using Exicycler 96 real-time PCR instrument from Pioneer (Korea). The prepared reaction mixture solution was repeated 40 times under the temperature condition shown in Table 6 below, and the negative / positive determination was confirmed based on the Ct value.

Reaction formulation for Real-Time PCR Composition Additive amount 2X Real-time PCR Master Mix 10 μl Forward Primer (100 uM) 0.1 μl Revers Primer (100 uM) 0.1 μl Probe (100 uM) 0.05 μl Template DNA 1 μl Nucelase Free Water 8.75 μl Total Volume 20 μl

Denaturation 95 ° C, 5 min 40 cycles Denaturation 95 ° C, 15 sec Annealing & Extension
(Data collection) 58 ° C, 60 sec

Denaturation 95 ° C, 5 min 40 cycles Denaturation 95 ° C, 60 sec Annealing 58 C, 45 sec Extension 72 ° C, 7 sec

Denaturation 95 ° C, 10 min 40 cycles Denaturation 95 ° C, 15 sec Annealing 60 ° C, 60 sec

The results are shown in Figs. 2 to 5.

Fig. 2 is a graph showing the activity of Saccharomyces cerevisiae strain cerevisiae ), Fig. 3 shows the result of real-time PCR test on the genus Tekkera ( Dekkera spp.) the Real-time PCR test results for, 4 progenitor saccharide as MY process sp (Schizosaccharomyces spp.) the Real-time PCR test results. Fig. 5 is my process in strains with Xi Kosaka for (Zygosaccharomyces spp . ).

Example  4: Specificity comparison evaluation

Experiments were conducted based on the results of previous studies (APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2003, p. 7430-7434) for the comparative evaluation of the specificity of experimental conditions designed in the present invention. Specifically, the same DNA used in Example 3 was used as a template using primers (DBRUXF 5-G GATGGGTGCACCTGGTTTACAC-3, DBRUXR 5-GAAGGGCCACATTCACGAACCCCG-3 '). The temperature condition was applied to the ABI 7500 fast instrument under the condition of Table 7, and 1X SybrGreen master mix was added for fluorescence confirmation. The same microbe DNA as that used in Example 3 was used as a template, The results are shown in Fig.

In addition, experiments were conducted based on the results of previous studies (APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2005, p. 6823-6830) for the comparative evaluation of the specificity of experimental conditions designed in the present invention. Specifically, 1X SybrGreen master mix was added to confirm the fluorescence under the temperature condition of Table 8 using primers SC1d (5'-ACATATGAAGTATGTTTCTATATAACGGGTG-3 ') and SC1r (5'-TGGTGCTGGTGCGGATCTA-3' The microorganism DNA used the same DNA as used in Example 3 as a template, and the amplification result was as shown in FIG. 6 and 7, amplification of yeast strains capable of growing under carbonic conditions as well as other yeast strains was confirmed.

As a result, it was confirmed that the specificity of the primer and probe conditions designed in the detection method according to the present invention is better than those of the third and fourth embodiments.

Therefore, the present invention is a representative yeast that can be grown under carbonic conditions such as carbonated beverages, and Saccharomyces cerevisiae strain cerevisiae), my process in a progenitor strain Saccharomyces (Schizosaccharomyces spp . ) , Zygosaccharomyces spp . , And Dekkera strain spp .) in the carbonated foods can be quickly confirmed, and it can be usefully used to confirm the presence or absence of contaminants in the carbonated food.

<110> Lotte Chilsung Beverage Co., Ltd. <120> Method for detecting rapidly growing in presence of a          carbonic acid and detection kit <130> DP-2017-0113 <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SaScZyDe forward primer <400> 1 caagtasagt gatsgaaaga tgaaaagaac 30 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SaZyDe reverse primer <400> 2 aacygatgct ggcccagt 18 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sc reverse primer <400> 3 crraaactga tgctgaccta cc 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sa probe <400> 4 aggggaatct cgcatttc 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> De probe <400> 5 ctcgtggatg ggtgcacc 18 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Sc-1 probe <400> 6 agacagtgca ctctgaacct a 21 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sc-2 probe <400> 7 agrckatgca ctctgaacct gt 22 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Zy probe <400> 8 tgrgggaatc tcgcagctc 19

Claims (9)

A method for rapid detection of a yeast capable of growing in a carbonic acid condition comprising the steps of:
(a) extracting a genomic DNA from a sample;
(b) preparing a real-time polymerase chain reaction solution containing the extracted genomic DNA, the primer set of SEQ ID NOS: 1 to 3, and the probes of SEQ ID NOS: 4 to 8; And
(c) performing a real-time PCR reaction,
Saccharomyces cerevisiae , Schizosaccharomyces spp. , Zygosaccharomyces spp. , And the like can be used as the yeast capable of growing under the carbonic acid condition . A method for the rapid detection of yeast capable of growing under carbonic conditions, which is Dekkera spp .
The method according to claim 1,
The detection method includes the steps of: Saccharomyces cerevisiae , Schizosaccharomyces spp. , Zygosaccharomyces spp. , And A method for the rapid detection of a yeast capable of growing under carbonic conditions, characterized by simultaneously detecting Dekkera spp .
The method according to claim 1, wherein said SEQ ID NO: 1 is Saccharomyces cerevisiae , Schizosaccharomyces spp. , And & lt ; RTI ID = 0.0 &gt; The strain Zygosaccharomyces spp .),
SEQ ID NO: 2 is Saccharomyces cerevisiae strain cerevisiae ), The strain Zygosaccharomyces spp . ), And A primer for amplifying the Dekkera spp .
SEQ ID NO: 3 is a strain of the genus Schizosaccharomyces spp.) the rapid detection method capable of growing the yeast in acid conditions, which is characterized in that the primer for amplification.
The method according to claim 1, wherein the sequence number 4 is a probe for detecting Saccharomyces cerevisiae ,
SEQ ID NO: 5 is a strain of the genus TEKERA spp .),
SEQ ID NOS: 6 and 7 show that the strain Shizosaccharomyces spp . Wherein the probe is a probe for detecting yeast.
The method according to claim 1, wherein the probe is labeled with a fluorescent reporter dye at the 5 'end and a quencher at the 3' end.
The method of claim 5, wherein the fluorescent colorant is selected from the group consisting of 6-carboxyfluorescein (FAM), hexachloro-6-carboxyfluorescein (HEX), tetrachloro-6-carboxyfluorescein Tetrachloro-6-carboxyfluorescein, and Cyanine-5 (Cy5). 2. The method of claim 1, wherein the yeast is selected from the group consisting of tetrachloro-6-carboxyfluorescein and Cyanine-5.
6. The method of claim 5, wherein the quencher is selected from the group consisting of Black Hole Quencher 1 (BHQ-1), Black Hole Quencher 2 (BHQ-2), Black Hole Quencher 3 (BHQ-3), 5-Carboxytetramethylrhodamine 1 (DDQ1), EBQ, and deep dark quencher 2 (DDQ2).
A Saccharomyces cerevisiae strain, a Schizosaccharomyces spp . Strain , which is a yeast capable of growing in a carbonic acid condition, comprising the primer set of SEQ ID Nos. 1 to 3 and the probes of SEQ ID Nos: 4 to 8 , .), my process in strains with Xi Kosaka (Zygosaccharomyces spp.) And Detection kit of Dekkera spp .
9. The detection kit according to claim 8, wherein the kit comprises a buffer solution for reaction, dNTPs, Mg2 + ions, and a DNA polymerase.

Images