CN107619872B - PCR primer and method capable of detecting salmonella and identifying salmonella pullorum - Google Patents
PCR primer and method capable of detecting salmonella and identifying salmonella pullorum Download PDFInfo
- Publication number
- CN107619872B CN107619872B CN201711106401.5A CN201711106401A CN107619872B CN 107619872 B CN107619872 B CN 107619872B CN 201711106401 A CN201711106401 A CN 201711106401A CN 107619872 B CN107619872 B CN 107619872B
- Authority
- CN
- China
- Prior art keywords
- salmonella
- pullorum
- pcr
- primer
- seep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a PCR primer and a method capable of detecting salmonella and identifying salmonella pullorum. According to salmonella target sequences (SEQ ID NO.1, NO.2 and NO.3), a pair of specific primers are screened and designed, and comprise a primer SEEP-F and a primer SEEP-R, wherein the nucleotide sequence of the SEEP-F is shown as SEQ ID NO. 7; the nucleotide sequence of SEEP-R is shown in SEQ ID NO. 8. The method comprises the steps of carrying out PCR amplification on a sample to be detected by using the primers to obtain a PCR amplification product; detecting the amplification product by agarose gel electrophoresis or sequencing; the amplification product is 590bp in size, and the sample contains or is candidate to contain salmonella pullorum; if the amplification product is 1394bp or 1400bp in size, the sample contains or is candidate to contain other salmonella. The method can quickly detect the salmonella and identify the salmonella pullorum, and is quicker, simpler and more convenient and lower in cost compared with the traditional salmonella culture, biochemical identification and salmonella pullorum identification methods.
Description
Technical Field
The invention belongs to the technical field of PCR detection, and particularly relates to a PCR primer and a method capable of detecting salmonella and identifying salmonella pullorum.
Background
Salmonella is a zoonosis pathogen with important public health significance, and more than 2500 serotypes are reported at present. The salmonella pullorum can cause pullorum disease, has high mortality rate to chicks, and brings serious economic loss to large-scale chicken farms. Salmonella pullorum is mainly popular among chicks of 2-3 weeks old, but the trend of susceptible day age increase and clinical disease type diversification is generated at present, so that the whole chicken raising period is damaged by the disease. Pullorum chicken usually shows drowsiness, weakness and loss of appetite, gathers into a group, has two wings drooping, gives out sharp screaming when defecating, and has 20-30% of death rate due to white or green excrement attached to anus and periphery. The death rate of 10-20% can be caused in the bred chickens, and the diseased chickens are mostly converted into chronic chickens after the diseased chickens are not completely cured or caused by infection during the brooding period. Adult chickens do not exhibit the characteristics of acute infection, often presenting with asymptomatic infection. Salmonella enteritidis, Salmonella typhimurium and the like in the salmonella can pollute eggs through ovaries and oviducts, the salmonella fixedly planted in intestinal tracts pollutes chicken when the carcass is processed, and the salmonella enters a human food chain and becomes an important pathogen causing death caused by human food poisoning in various countries.
According to the national standard, the salmonella isolation culture method proposed in the food microbiology test (GB 4789.4-2016) is complicated, time-consuming and labor-consuming, and the test result is reported to be about 4-7 days. At present, a whole blood flat plate agglutination test is mainly adopted for monitoring the salmonella pullorum antibody in a breeding farm, but the method needs a large amount of manpower and material resources, has high false positive and is often influenced by manual operation and the like. The scheme for preventing and treating middle and long-term animal epidemic diseases in China (2012 and 2020) proposes that salmonella pullorum reaches the purification standard in chicken farms above the national grand generations in 2015, and all chicken farms in China reach the purification standard in 2020. The establishment of a rapid and accurate salmonella pullorum identification method is urgently needed, and the method has important significance for promoting the purification of the salmonella pullorum in the breeding chicken farm.
With the development of molecular biology technology, the PCR method has become an effective means for rapidly detecting pathogens. The current PCR detection method related to Salmonella pullorum relates to 6 patents. The salmonella pullorum detection primers related to the multiple PCR identification kit for salmonella and five serotypes thereof (with the authorization number of CN201310110380) and the primer group, the kit and the method for identifying salmonella pullorum and salmonella typhi (with the application number of 201510570362.9) can also amplify multiple salmonella serotypes such as Wandsworth, Manchester, Chester, Java, Bareilly and the like, and have poor specificity; the gene ipaJ for detecting the salmonella pullorum, which is selected from the PCR detection primer and the detection method for the salmonella pullorum (application number 201410492056.3) and the PCR detection kit for identifying the salmonella pullorum (application number 201611111312.5), also exists in the salmonella choleraesuis, and is positioned on a small plasmid, so that not all the salmonella pullorum are carried, and the condition of omission is easy to occur; however, tcpS and flhB genes selected from a PCR detection kit for rapidly identifying salmonella of a specific serotype (application No. 201610459944.4) and a PCR detection kit for rapidly identifying salmonella pullorum and salmonella gallinarum (201610628075.3) are not specific to salmonella pullorum, and the detection result cannot be accurately judged as the serotype pullorum. The fliC related to the literature, namely establishment and application of PCR detection technology of Salmonella pullorum (J.zoo-veterinary, 2011,30(6):23-27), is not specific to serotype of pullorum and is easy to interfere with serotypes such as enteritis and the like.
Therefore, a complete genome comparison of salmonella and salmonella pullorum is required, and specific genes of salmonella and salmonella pullorum are screened out, so that specific primers are designed, and a rapid and simple PCR detection method is provided for monitoring salmonella in chicken farms and salmonella pullorum.
Disclosure of Invention
In view of the above, the present invention provides a PCR primer and a method for detecting Salmonella and identifying Salmonella pullorum.
In order to solve the technical problems, the invention discloses a PCR primer capable of detecting salmonella and identifying salmonella pullorum, which comprises a primer SEEP-F and a primer SEEP-R, wherein,
GACAGATGGAAAGCGAGCAC, the nucleotide sequence of which is shown in SEQ ID NO. 7;
GGTGACGACGGTAAAGATAGTG and the nucleotide sequence is shown in SEQ ID NO. 8.
The invention also discloses a PCR method capable of detecting salmonella and identifying salmonella pullorum, which comprises the following steps:
carrying out PCR amplification on a sample to be detected by using the primer to obtain a PCR amplification product; detecting the amplification product by agarose gel electrophoresis or sequencing;
the amplification product is 590bp in size, and the sample contains or is candidate to contain salmonella pullorum;
if the amplification product is 1394bp or 1400bp in size, the sample contains or is candidate to contain other salmonella;
further, the PCR amplification reaction system was 25 μ L: 12.5 μ L of 2 XTaq PCR MasterMix, 8.5 μ L of ddH2O, 2. mu.L of DNA, 1. mu.L each of the primer SEEP-F and the primer SEEP-R.
Further, the PCR amplification reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; 30 seconds at 95 ℃,30 seconds at 57 ℃ for annealing, 40 seconds at 72 ℃ for extension, and 30 cycles; 10min at 72 ℃; storing at 4 ℃.
Compared with the prior art, the invention can obtain the following technical effects:
1) the invention relates to a method for sequencing the whole genome of salmonella pullorum
(GenBank accession Nos. CP012347, CP003786, LK931482,
CP003047, CP006575) and other salmonella serotypes (GenBank accession number salmonella enteritidis: CP 016754; salmonella typhimurium: CP 022168; salmonella gallinarum: CP 019035; salmonella paratyphi type a: CP 000026; salmonella saint paul: CP 019206; salmonella thopson: CP 019196; salmonella dublin: CP 019179; salmonella heidelberg: CP 019176; salmonella newborns: CP 013685; salmonella anatipestifer: CP014665), screening for a specific gene SEEP9120_005890 encoding a putative protein of Salmonella pullorum ATCC 9120 bp, other serotypes of Salmonella pullorum 4767bp, 5580bp or 5589 bp. Specific PCR primers are designed by using Primer Premier 6.0 software, the target fragment of salmonella pullorum is 590bp, and other salmonella is 1394 or 1400 bp. Can identify the salmonella and judge the salmonella pullorum according to the size of the strip.
2) The primer related to the invention is obtained after the whole genome comparative analysis, and the primer-blast is further adopted to carry out on-line comparison on the primer, so that compared with the salmonella pullorum PCR method related to the background technology, the primer-blast PCR method is more accurate and better in specificity, and has no non-specific amplification of other bacteria, and the single PCR identification of the salmonella and the salmonella pullorum is realized.
3) The method disclosed by the invention can be used for rapidly identifying the salmonella pullorum through the PCR method, and is quicker, simpler and more convenient and lower in cost compared with the traditional salmonella culture, biochemical identification and salmonella pullorum identification methods.
Of course, it is not necessary for any one product in which the invention is practiced to achieve all of the above-described technical effects simultaneously.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention and not to limit the invention. In the drawings:
FIG. 1 is a PCR specific assay of the present invention; wherein M is DL2000plus, 1-3 are Salmonella pullorum, 4: salmonella enteritidis, 5: salmonella typhimurium, 6: salmonella indiana, 7: salmonella gallinarum, 8: e.coli, 9: enterococcus, 10: extracting DNA from intestinal contents of healthy chickens;
FIG. 2 is a PCR sensitivity test according to the present invention; wherein, M is DL2000plus, Salmonella pullorum, 1: 108CFU/ml，2：107CFU/ml，3：106CFU/ml，4：105CFU/ml，5：104CFU/ml，6：103CFU/ml，7：102CFU/ml，8：101CFU/ml, 9: negative control; salmonella enteritidis, 10: 108CFU/ml，11：107CFU/ml，12：106CFU/ml，13：105CFU/ml，14：104CFU/ml，15：103CFU/ml，16：102CFU/ml，17：101CFU/ml。
Detailed Description
The following embodiments are described in detail with reference to the accompanying drawings, so that how to implement the technical features of the present invention to solve the technical problems and achieve the technical effects can be fully understood and implemented.
Example 1 construction of a PCR method for detecting Salmonella and identifying Salmonella pullorum:
1. design of specific PCR primers:
the specific gene SEEP9120_005890 of Salmonella pullorum ATCC 9120(GenBank accession number CP012347), and other Salmonella pullorum (SEQ ID NO. 5589) were screened by performing comparative analysis on the currently sequenced whole genome of Salmonella pullorum (GenBank accession numbers CP012347, CP003786, LK931482, CP003047, and CP006575) and other Salmonella serotype (GenBank accession numbers CP 016754; Salmonella typhimurium CP 022168; Salmonella gallinarum: CP 019035; Salmonella paratyphi A: CP 000026; Salmonella saint paul: CP 019206; Salmonella thosponensis: CP 019196; Salmonella dublin: CP 019179; Salmonella haidebergeri: CP 176; Salmonella newborecode: CP 013685; and Salmonella anata CP014665), which encode a putative protein, Salmonella pullorum ATCC 9120(GenBank accession number CP 4767bp (SEQ ID NO.1), and other Salmonella pullorum (SEQ ID NO. 5589) are SEQ ID NO. 5589 or SEQ ID NO. 5589. Specific PCR primers are designed by using Primer Premier 6.0 software, wherein the target fragment of salmonella pullorum is 590bp (SEQ ID NO.4), and other salmonella is 1394bp (SEQ ID NO.5) or 1400bp (SEQ ID NO. 6). Not only can identify salmonella, but also can judge the pullorum serotype according to the size of the strip. The method realizes single PCR identification of salmonella and pullorum serotypes, and is accurate, rapid and good in specificity.
The PCR primer sequences were as follows:
GACAGATGGAAAGCGAGCAC, the nucleotide sequence of which is shown in SEQ ID NO. 7;
GGTGACGACGGTAAAGATAGTG and the nucleotide sequence is shown in SEQ ID NO. 8.
2. Respectively taking genomes of different serotypes of salmonella and other bacteria as templates, and performing PCR amplification; different serotypes of salmonella and other bacteria include: extracting DNA from salmonella pullorum, salmonella enteritidis, salmonella typhimurium, salmonella indiana, salmonella gallinarum, escherichia coli, enterococcus genome DNA and healthy chicken intestinal contents;
the PCR amplification reaction system is 25 mu L: 12.5 μ L of 2 XTaq PCR MasterMix, 8.5 μ L of ddH2O, 2. mu.L of DNA, 1. mu.L each of the upstream and downstream primers (SEEP-F and SEEP-R).
The PCR amplification reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; 30 seconds at 95 ℃,30 seconds at 57 ℃ for annealing, 40 seconds at 72 ℃ for extension, and 30 cycles; 10min at 72 ℃; storing at 4 ℃.
3. Identification of PCR products
mu.L of the PCR product was electrophoretically detected on a 1% agarose gel (GoldView dye added) in 0.5 XTAE buffer, and the results are shown in FIG. 1. The size of the salmonella pullorum amplicon is 590bp, other serological salmonella is 1394bp, and the DNA extracted from escherichia coli, enterococcus DNA and healthy chicken intestinal contents is negative, which shows that the invention can specifically amplify salmonella and distinguish salmonella pullorum according to the size of the strip.
Example 2 sensitivity test
At 101-108CFU/ml Salmonella pullorum, 101-108And extracting DNA (deoxyribonucleic acid) from the CFU/ml salmonella enteritidis by adopting a boiling method as a template, and performing PCR (polymerase chain reaction) amplification. The PCR reaction system and amplification reaction conditions were the same as in example 1. The amplification results are shown in FIG. 2, and it was deduced that the detection limits of Salmonella and Salmonella pullorum were both 103CFU/ml。
Example 3 clinical sample testing
352 parts of chicken samples died of illness are collected from 15 chicken farms in 10 provinces such as Sichuan, Guizhou, Hubei, Anhui and the like in China, aseptically inoculated on a blood plate, 247 strains of various pathogenic bacteria are separated out, bacterial genome DNA is extracted by a boiling method, a PCR amplification system and amplification conditions established according to the invention are detected, negative and positive controls are set, 2 mu L of PCR products are taken to carry out electrophoresis in 1% agarose gel, and then the result is judged: and identifying 66 strains of salmonella, wherein the salmonella pullorum is 25 strains. The biochemical identification and serological typing of the salmonella are carried out according to the national standard' food microbiological examination salmonella test (GB 4789.4-2016), 66 strains of the salmonella are identified from 247 pathogenic bacteria, and 25 strains of the salmonella pullorum are identified by serological typing. The result shows that the coincidence rate of the PCR method identification result of the salmonella and the salmonella pullorum established by the invention and the identification result of the national standard method is 100 percent.
While the foregoing description shows and describes several preferred embodiments of the invention, it is to be understood, as noted above, that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Sichuan university
<120> single PCR rapid identification method of salmonella and pullorum serotype
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4767
<212> DNA
<213> Salmonella pullorum (Salmonella pullorum)
<400> 1
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggaa ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaaccccgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg cgtaccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt ggcgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcgaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaaacta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cagacagcga taaggccagt atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtataac ctacaccttc acccgcccga agctggcggc ggaagcgagc 1080
ggcgctgaca aaagcgtcgt cgataccaac gaaacctggg cgctgttcga ctggaacggc 1140
gccgataacc attgcaatat tctgccggac gccgaacaac tggtgcagat gcgacatgag 1200
cacagcacgc tggcaacgta caccggctgg ccggcgacgg acgatgccga atactggtcg 1260
ttgaccaaag atcagatgag cggctaccac gctgccgtac atatgaacag cgcatcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcctgcg 1380
gcgcacccgc agattactct ctccccacaa ggaccgtata aagcgcaggt gggggagtcg 1440
attgatctga cgatgaccgt agttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgaaaaac cgcaaagggg aacatcagga cgcatgggat 1560
aacctgcggg tcaccgttga ttccgaaggt atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgtcaacgg ccaggcgcac ctgacgttaa aacataacag cggcctgggc 1680
gtcgaaacgc ccatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagctgtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
catatgcgcg gcgtggtgga cgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca attcagcgaa aataacgaag agtgggcgac gtttaactcc 1920
gtggcgtcgg ccaccgcgca gtgcggtgtc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcggacag atggaaagcg agcacggctg gccgacctat 2040
cttaactact ggtcgtccac ctaccagagc gccaccacct ggaaactgat cgcgctgacg 2100
aacggcagtg aatttgccaa cagcaacgtc tcgatttacg ccagctgcct ggccagcgat 2160
aacccggtgg cggcgtccat caccattgaa ccggtcaatc cgtcgcagtg gtacgacggc 2220
agcgacgtcc acgcggtcaa agtgaaaaag ggcgagacga tgcagctcaa ggtgacggtg 2280
aaggacgcca gcggcaaccc gatcccggaa gcgccgtttg tgctcacccg cggcgacggt 2340
tacgatcgcc ggggcgaaaa gtataccgct caggacggtg acgatctgca aggcatcgtg 2400
acgcccgtgg tgatcgacgg cgaatcgctg gcatggacca ccaccaaaat ggggtcgcag 2460
accggcactg acggcacccg tatcatcagc gtcacccgcc cggacaccca cggcacccgc 2520
accgcgatta acgcgacgct gtatgaaaat gccgccgtga gtgccagcat cgacactatc 2580
tttaccgtcg tcaccagccc ggatgtcagc gtcgcccgca tgtgggggca tatggcgcca 2640
tcgctgacgg cggcggatgg cgcggtgtac cagcgcccgc tgctgtacgc tgagctgtcc 2700
agtacggaca atactgcgtc taagcaagaa accaacgaaa cctgggcggt ttttcatggg 2760
ccagccagtg aaggggccaa tccggcccgt tgcgcggcgg gctattaccc tgccgttgag 2820
gcgctggatt cgctctacag caaatacccg agccgaacga taaataccgc ccagggctgg 2880
ccggtctact attcttactg gagcggatcg aactcgacgt cattttccag cggggcaaaa 2940
cttgacttct attacgcagt cgatctggct gatggttcgc gtcggtcaga aaacagcgcg 3000
accagcactg cctggcagta tcaaatttgc gccacgacgc cgctgccgca ggccacgcag 3060
attaccctca cctccccgca ggcgatggat gacgctattc aggcggtgaa ggcgaaaaac 3120
agcgagtcga tcccgctact catcaccact accgatgcga tgggcaaccc ggtgccttat 3180
gcgacttttt cgcttaaacg cgacgccggg aaggcgcgca acaccgacta taataaattt 3240
gtagccacta acggcaccaa catgacggtg acgccgctca ccggtgcgca gcaacagttt 3300
tactatgcca catcggttct gaccggcgcg gatggtacgc tggccctgac gcttgccgaa 3360
cccggcggca tagggttgaa aaaccagctg accgcgaatc tgaacgatac gccgacggcg 3420
acctcatcgc tgccggtggt gttcaccgtc ctcaccagcc cggacagcga caaggccaac 3480
atgtacggcc atatgccgga gaccttcacc gccagcaacg gtgcggagtt taagcgcccg 3540
ctggtggcag gcgagccctc atcggaggcg cacacggata catatttcga aaccaatgag 3600
aactggctca tggtgaatag ttttaatacc ggcaattacg gcgggtgtcc gatgaaccag 3660
atggctgcga tagatgattt cactgcgctg tacaacgatc acccaagcgg caaggtggcg 3720
accgatattg gattgcccgt cgggaagcgg tggtgggcgg gggatagcct gctgaaaggc 3780
tcaacccttt actggcagta taaagatctc aagacgggga aaaactacag catgtcggaa 3840
aacccgggta actactactt acaactctgc ctgacaacat cgcgcagcgg gctgaatatc 3900
gcgctctctt ccgacgcatg gaacgccgat aaatcggcgg ccgtggcgaa aaaaggcgaa 3960
acgataccga tgacggtaac ggtgactaac gacgccgggc agccgcaggc cggggtggcc 4020
gtactgttga cgcgtgatta cgcttattcg cgcggtgcgg tggataagca atacattgaa 4080
ccaggcgtga ttggcgagcc ggttccgttt acaacttcgc ctgcgaatat gatgctgacg 4140
ccggttgcac ctgcgggtac ggcaatggcg tttaataacc agaatggcct cagcacaaaa 4200
tggtctggct tcaccggcga tgacggtaag ttgcggttta cgttaactca ggataaatcg 4260
ctggggttaa aaacgtctgt cacggcggcg cttgcgaatc aatttgatga ggcggcgagc 4320
gtagatgcaa tctttacggt acaaaccagc ccggacacgc cgtatgcgtc atactggggt 4380
catatgccgg ataccgtgca ggtgaacggc gttacgctgc gccgcccgta cctgaaagcc 4440
gagctctctg ccgcgccccg ggatacctgg ccgtttaata atgaaatctg ggggacgaac 4500
tattattatc agtccgaaca cgtggaaacg tcgttgacgc atctttgcgg atcgcaggaa 4560
aatatagcct cgctggacga tctgaaagcg ttgcagagcg ttatcggcac gttgcaatgg 4620
ccgacgacat catcctggga ctatgtgtcg caagatgaag gtcaaagcaa taagtactac 4680
tgttcattta acgaaacgac cggccagaca acctgtactc gtgaaaaagc gacgacctca 4740
ggcttaggct cgtgccgggt gccgtag 4767
<210> 2
<211> 5580
<212> DNA
<213> Salmonella (Salmonella)
<400> 2
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggca ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaacctcgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg cgtaccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt ggcgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcgaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaaacta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cagacagcga taaggccagt atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtataac ctacaccttc acccgcccga agctggcggc ggaagcgagc 1080
ggcgctgaca aaagcgtcgt cgataccaac gaaacctggg cgctgttcga ctggaacggc 1140
gccgataacc attgcaatat tctgccggat gccgaacaac tggtgcagat gcgacatgag 1200
cacagcacgc tggcaacgta caccggctgg ccggcgacgg acgatgccga atactggtcg 1260
tcgaccaaag atcagatgag cggctaccac gctgccgtac atatgaacag cgcatcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcctgcg 1380
gcgcacccgc agattactct ctccccacaa ggaccgtata aagcgcaggt gggggagtcg 1440
attgatctga cgatgaccgt agttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgaaaaac cgcaaagggg aacatcagga cgcatgggat 1560
aacctgcggg tcaccgttga ttccgaaggt atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgtcaacgg ccaggcgcac ctgacgttaa aacataacag cggcctgggc 1680
gtcgaaacgc ccatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagctgtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
catatgcgcg gcgtggtgga cgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca attcagcgaa aataacgaag agtgggcgac gtttaactcc 1920
gtggcgtcgg ccaccgcgca gtgcggtgtc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcggacag atggaaagcg agcacggctg gccgactgaa 2040
gattatttca tcgccgccga cagcgacgcc tccgggacgg tacacgtcaa cctcgaaaac 2100
ggcgatagcg gcaaatttac cgatacgccc aactacctga cctgctcggc caatgaaatg 2160
gtggcggtgc tggacgtcta cttcaacgac gacccggtga tcaaaaacgc cgacgccaaa 2220
gtgggtgaac aggttaagat gaacatccat tcgcgcaacg cccttaacgg catagcgatc 2280
ggcaataccg acttcaccat caccatggcg aacggcaggc ggcgtgacgg gctgacgacc 2340
ggctttaccg ataccagcaa cggcgagatg cagtttgacg acgtgggcta cgttgccggg 2400
caggtttatc acgggatcac cgacgctaac ggcgatgcga ccattatcct cacccagaaa 2460
aagggcgtgg ggctgctgac gccgttaagc atcgtgcccg tcaattcata catcaatacg 2520
ccggtttccc gcagcgtgaa gtttaccgtc gcgaccagcc cggatacggc aaaagccaaa 2580
atgtggggcc atatggccga cacgattacc gtgggcgact ggacttttga gcggcccaaa 2640
ctggcgggtg aagtgagcaa cccgctgcgt acccaggacg agagcaatga gacctgggcg 2700
cgcgtggccc atagcgacgc ggtgggcaac ccggatgcgg gcggctgcgc ggcgaaccgc 2760
ctgccgcgca tcgaccagct tgaggcgctg tataacgcca acagcggcgg caagattcac 2820
agcattcagg gctggccgac ctatcttaac tactggtcgt ccacctacca gagcgccacc 2880
acctggaaac tgatcgcgct gacgaacggc agtgaatttg ccaacagcaa cgtctcgatt 2940
tacgccagct gcctggccag cgataacccg gtggcggcgt ccatcaccat tgaaccggtc 3000
aatccgtcgc agtggtacga cggcagcgac gtccacgcgg tcaaagtgaa aaagggcgag 3060
acgatgcagc tcaaggtgac ggtgaaggac gccagcggca acccgatccc ggaagcgccg 3120
tttgtgctca cccgcggcga cggttacgat cgccggggcg aaaagtatac cgctcaggac 3180
ggtgacgatc tgcaaggcat cgtgacgccc gtggtgatcg acggcgaatc gctggcatgg 3240
accaccacca aaatggggtc gcagaccggc actgacggca cccgtatcat cagcgtcacc 3300
cgcccggaca cccacggcac ccgcaccgcg attaacgcga cgctgtatga aaatgccgcc 3360
gtgagtgcca gcatcgacac tatctttacc gtcgtcacca gcccggatgt cagcgtcgcc 3420
cgcatgtggg ggcatatggc gccatcgctg acggcggcgg atggcgcggt gtaccagcgc 3480
ccgctgctgt acgctgagct gtccagtacg gacaatactg cgtctaagca agaaaccaac 3540
gaaacctggg cggtttttca tgggccagcc agtgaagggg ccaatccggc ccgttgcgcg 3600
gcgggctatt accctgccgt tgaggcgctg gattcgctct acagcaaata cccgagccga 3660
acgataaata ccgcccaggg ctggccggtc tactattctt actggagcgg atcgaactcg 3720
acgtcatttt ccagcggggc aaaacttgac ttctattacg cagtcgatct ggctgatggt 3780
tcgcgtcggt cagaaaacag cgcgaccagc actgcctggc agtatcaaat ttgcgccacg 3840
acgccgctgc cgcaggccac gcagattacc ctcacctccc cgcaggcgat ggatgacgct 3900
attcaggcgg tgaaggcgaa aaacagcgag tcgatcccgc tactcatcac cactaccgat 3960
gcgatgggca acccggtgcc ttatgcgact ttttcgctta aacgcgacgc cgggaaggcg 4020
cgcaacaccg actataataa atttgtagcc actaacggca ccaacatgac ggtgacgccg 4080
ctcaccggtg cgcagcaaca gttttactat gccacatcgg ttctgaccgg cgccaccggc 4140
gcggatggta cgctggccct gacgcttgcc gaacccggcg gcatagggtt gaaaaaccag 4200
ctgaccgcga atctgaacga tacgccgacg gcgacctcat cgctgccggt ggtgttcacc 4260
gtcctcacca gcccggacag cgacaaggcc aacatgtacg gccatatgcc ggagaccttc 4320
accgccagca acggtgcgga gtttaagcgc ccgctggtgg caggcgagcc ctcatcggag 4380
gcgcacacgg atacatattt cgaaaccaat gaaaactgga tcatggtgaa tagttttaat 4440
accggcaatt acggcgggtg tccgatgaac cagatggctg cgatagatga tttcactgcg 4500
ctgtacaacg atcacccaag cggcaaggtg gcgaccgata ttggattgcc cgtcgggaag 4560
cggtggtggg cgggggatag cctgctgaaa ggctcaaccc tttactggca gtataaagat 4620
ctcaagacgg ggaaaaacta cagcatgtcg gaaaacccgg gtaactacta cttacaactc 4680
tgcctgacaa catcgcgcag cgggctgaat atcgcgctct cttccgacgc atggaacgcc 4740
gataaatcgg cggccgtggc gaaaaaaggc gaaacgatac cgatgacggt aacggtgact 4800
aacgacgccg ggcagccgca ggccggggtg gccgtactgt tgacgcgtga ttacgcttat 4860
tcgcgcggtg cggtggataa gcaatacatt gaaccaggcg tgattggcga gccggttccg 4920
tttacaactt cgcctgcgaa tatgatgctg acgccggttg cacctgcggg tacggcagtg 4980
gcgtttaata accagaatgg cctcagcaca aaatggtctg gcttcaccgg cgatgacggt 5040
aagttgcggt ttacgttaac tcaggataaa tcgctggggt taaaaacgtc tgtcacggcg 5100
gcgcttgcga atcaatttga tgaggcggcg agcgtagatg caatctttac ggtacaaacc 5160
agcccggaca cgccgtatgc gtcatactgg ggtcatatgc cggataccgt gcaggtgaac 5220
ggcgttacgc tgcgccgccc gtacctgaaa gccgagctct ctgccgcgcc ccgggatacc 5280
tggccgttta ataatgaaat ctgggggacg aactattatt atcagtccga acacgtggaa 5340
acgtcgttga cgcatctttg cggatcgcag gaaaatatag cctcgctgga cgatctgaaa 5400
gcgttgcaga gcgttatcgg cacgttgcaa tggccgacga catcatcctg ggactatgtg 5460
tcgcaagatg aaggtcaaag caataagtac tactgttcat ttaacgaaac gaccggccag 5520
acaacctgta ctcgtgaaaa agcgacgacc tcaggcttag gctcgtgccg ggtgccgtag 5580
<210> 3
<211> 5589
<212> DNA
<213> Salmonella (Salmonella)
<400> 3
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggca ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaacctcgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg aataccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt gacgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcaaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaagcta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cggacagcga taaggccaat atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtacgac ttacaccttc acccgcccga aactgctggc ggaagcgagc 1080
ggcgcggaca gccgcgtcga cgataccaac gaaacctggg cgcagtttac ctggagcggc 1140
gccgataacc actgcaacat tctgccggat gccgaacaac tggtggcgtt caggcatgag 1200
cacagcacac tggcgacgta caccggctgg ccggcgacgg acgatgccga atactggtca 1260
tcgaccaaaa accaactgag cggctaccat tccgcagtgc atatgaacag cgcgtcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcccgca 1380
gcgcacccgc agattaccct ttctccggtg gggccgtata aagcgcaggt gggagacgaa 1440
atcgatttga cgatgaccgt ggttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgacaaac cgcaaagggg agcaccagga cgcgtgggat 1560
aaccagcggg tcaccgtcga ttccgaaggc atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgttaacgg ccaggcgcat ctgacgttaa aacacgacag cggcatgggc 1680
gtcgaaacgc ctatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagcagtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
cacatgcgcg gcgtggtaga tgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca gttcgacgaa aacaacgaac agtgggcgac atttaactcc 1920
gtggcatcgg ccaccgcgca gtgcggtacc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcgggcag atggaaagcg aacacggctg gccgaccgaa 2040
gattattaca tcgccgccga cagcgacgcc tccgggacgg tacacgtcaa cctcgaaaac 2100
ggcgatagcg gcaaatttac cgatacgccg aactacctga cctgctcggc caatgaaatg 2160
gtggcggtgc tggacgtcta tttcaacgac gacccggcga ccaaaaatgc cgatatgacc 2220
gccaaagtgg gtgaacagat taagctcaac atccattcgc gcaacgctct taacggcatg 2280
gcgatcgcca ataccgactt caccgtcacc atggcaaacg gcaggcggcg cgacgggctg 2340
acgaccggtt ttaccgatac cagcaacggc gagatgcagt ttgacggcgt cggctacgtt 2400
gccgggcagg tttatcacgg gatcaccgac gccaacggcg atgcgaccat tatcctcacc 2460
caggataagg gcgtggggct gctgacgcag ttaagcatcg tgcccgtcga ttcatacatc 2520
aatacgccgg tttcccgcag cgtgaagttt accgtcgcca ccagcccgga tacggcaaaa 2580
gccaaaatgt ggggccatat ggccgacaca attaccgtgg gtgactggac ctttgagcgg 2640
cccaaactgg cgggtgaagt gagcaacccg ctgcgtaccc aggacgagag caatgagacc 2700
tggacgcgtg tggcccacac cgacgcggcg ggcaacccgg aggtgggcgg ctgcgcggcg 2760
aaccgcctgc cgcgcatcga ccagcttgag gcgctgtata acgccaacag cggcggcaaa 2820
attaacggca ttcagggctg gccaatctat cttaactact ggtcgtccac cttccagagc 2880
gccagcacgt ggaaactgat tgcgctggcg aacggcagtg aatttgccaa cagcaacgtc 2940
tcgatttaca ccagttgcct ggccagcgat aacccggtgc cagccgccat caccattgaa 3000
ccggtcgacc cgtcgcagtg gtacgacgac agcggcgtgc atgcagtcaa agtgaaaaag 3060
ggcgagacga tgcagctcaa ggtgacggtg aaggacgcca gcggcaaccc gatcccggaa 3120
gcgccgtttg tactcactcg cggcgacggc tacgaccgcc ggggcgagaa gtataccgct 3180
caggacggcg acgatctgca aggcatcgtg acgcccgtgg tgatcgacgg cgaatcgctg 3240
gcctggacca ccactaaaat ggggtcgctg accggccctg acggcacccg cattattaac 3300
gttacccgcc cggacaccca cggcacccgc accgcgatta acgcgacgct gtatgaaaat 3360
gccgccgtga gcgccagcat cgacaccatc tttaccgtcg tcaccagccc ggatgccagc 3420
gtcgcccgca tgtgggggca tatggcgccg tcgctgacgg cggcggatgg cgcggtgtac 3480
cagcgcccgc tgctgtacgc tgagctgtcc agtacggaca atactacgtc taagcaagaa 3540
accaacgaaa cctgggcggt ttttcatggg ccagccagtg aaggggcaaa tccggcccgt 3600
tgcgcggcgg gctattaccc tgccgttgag gcgctggatt cgctctacag caaatacccg 3660
agccgaacga taaataccgc ccagggctgg ccggtctact attcttactg gagcggatcg 3720
aactcgacgt cattttccag cggggcaaaa gttgacttct attacgttgt cgatctggct 3780
gatggttcgc gtcggtcaga aaacagctcg cccagcactg cctggcagta ccaaatttgc 3840
gctacgacgc cgttgccgca ggccacgcag attaccctca cctccccgca ggcgatggat 3900
gacgctattc aggcggtgaa ggcgaaaaac agcgagtcga tcccgctgct catcaccact 3960
accgatgcga tgggcaaccc ggtgccttat gcgacttttt cgcttaaacg cgacgccggg 4020
acgccgcgca acgccgacta taaaaaattt aacaccacca acgccaccaa catgacggta 4080
aagccgctca ccggtgcgca gcaacagttt tactatgcca catcggttct gaccggcgcc 4140
accggcgcgg acggtacgct gactctgacg cttgccgaac ccggcggcat agggttgaaa 4200
aacgtgctga ccgcgagtct gtacgatacg ccgacggcga cctcaacgct gccggtggtg 4260
ttcaccgtcc tcaccagccc ggacagcgac aaggccaaca tgtacggcca tatgccggag 4320
accttcaccg ccagcaacgg tgcggagttt aagcgcccgc tggtggtagg cgagccctca 4380
tcggaggcgc acacggatac ctatttcgaa accaatgaat actgggtcat ggtgaatagt 4440
tttaataccg gtaattacgg cggatgtccg atgaaccaga tggctgcgat ggatgatttc 4500
acggcgctgt acaaggatca cccaagcggc aaggtggcga ccgatattgg attgcccgtc 4560
gggaagcggt ggtgggcggg cgatagcctg ctgaaaggct caacccttta ctggcaatat 4620
aaagatctca agacggggaa agactacagc atgtcggaaa acccgggtaa ctactactta 4680
caactctgcc tgacaacatc gcgcagcggg ctgaatatcg cgctctcttc cgacgcatgg 4740
aacgccgata aatcagcggc tgtggcgaaa aaaggcgaaa cgataccgat gacggtaacg 4800
gtgactaacg acgccgggca gccgcaggcc ggggtggccg tactgttgac gcgtgaatac 4860
gcttattcgc gcggtgaggt ggataagcaa tacattgaac caggcgtgat tggcgagccg 4920
gttccgttta caacttcgcc ggcgaatatg atgctgacgc cggtttcacc tgtggcgggt 4980
acggcagtgg cgtttaataa ccagactggc ctcagcacaa aatggtctgg cttcaccggc 5040
gatgacggta agttgcggtt tacgttaact caggataaat cgctggggtt aaaaacgtct 5100
gtcacggcgg cgcttgcgaa tcaatttgat gaggcggcga gcgtggatgc aatctttacg 5160
atacaaacca gcccggacac gccgtatgcg tcatactggg gtcatatgcc ggataccgtg 5220
caggtgaacg gcgttacgct gcgccgcccg tatctgaaag ccgagctctc tgccatgccc 5280
cggaatacct ggccgtttaa taatgaaatc tgggggtcga actattatta tcagtcccag 5340
cacgtggaaa cgtcgttgac gcatctttgc ggatcgcagg aaaatatagc ctcgctggac 5400
gatctgaaag cgttgcagag cgttatcggc acgttgcaat ggccgacgac atcgtcctgg 5460
gattatgtgt cgcaagatga aggtcaaagc gataagtact actgttcatt taacgaaacg 5520
accggccaga caacctgtac tcgtgaaaaa tcggctaccg cgggctttgg ctcgtgccgg 5580
gtgccgtag 5589
<210> 4
<211> 590
<212> DNA
<213> Salmonella pullorum (Salmonella pullorum)
<400> 4
gacagatgga aagcgagcac ggctggccga cctatcttaa ctactggtcg tccacctacc 60
agagcgccac cacctggaaa ctgatcgcgc tgacgaacgg cagtgaattt gccaacagca 120
acgtctcgat ttacgccagc tgcctggcca gcgataaccc ggtggcggcg tccatcacca 180
ttgaaccggt caatccgtcg cagtggtacg acggcagcga cgtccacgcg gtcaaagtga 240
aaaagggcga gacgatgcag ctcaaggtga cggtgaagga cgccagcggc aacccgatcc 300
cggaagcgcc gtttgtgctc acccgcggcg acggttacga tcgccggggc gaaaagtata 360
ccgctcagga cggtgacgat ctgcaaggca tcgtgacgcc cgtggtgatc gacggcgaat 420
cgctggcatg gaccaccacc aaaatggggt cgcagaccgg cactgacggc acccgtatca 480
tcagcgtcac ccgcccggac acccacggca cccgcaccgc gattaacgcg acgctgtatg 540
aaaatgccgc cgtgagtgcc agcatcgaca ctatctttac cgtcgtcacc 590
<210> 5
<211> 1394
<212> DNA
<213> Salmonella (Salmonella)
<400> 5
gacagatgga aagcgagcac ggctggccga ctgaagatta tttcatcgcc gccgacagcg 60
acgcctccgg gacggtacac gtcaacctcg aaaacggcga tagcggcaaa tttaccgata 120
cgcccaacta cctgacctgc tcggccaatg aaatggtggc ggtgctggac gtctacttca 180
acgacgaccc ggtgatcaaa aacgccgacg ccaaagtggg tgaacaggtt aagatgaaca 240
tccattcgcg caacgccctt aacggcatgg cgatcggcaa taccgacttc accatcacca 300
tggcgaacgg caggcggcgt gacgggctga cgaccggctt taccgatacc agcaacggcg 360
agatgcagtt tgacgacgtg ggctacgttg ccgggcaggt ttatcacggg atcaccgacg 420
ctaacggcga tgcgaccatt atcctcaccc agaaaaaggg cgtggggctg ctgacgccgt 480
taaatattgc gcccgtcgat tcattaatca gcacgccggt ttcccgcagc gtgaagttta 540
ccgtcgccac cagcccggat acgccagcgg ccaaaatgtg gggccatatg gccgacacga 600
ttaccgtggg cgactggacc tttgagcggc ccaaactggc gggtgaagtg agcaacccgc 660
tgcgtaccca ggacgagagc aatgagacct gggcgcgcgt ggcccatagc gacgcggtgg 720
gcaacccgga tgcgggcggc tgcgcggcga accgcctgcc gcgcatcgac cagcttgagg 780
cgctgtataa cgccaacagc ggcggcaaga ttcacagcat tcagggctgg ccgacctatc 840
ttaactactg gtcgtccacc taccagagcg ccaccacctg gaaactgatc gcgctgacga 900
acggcagtga atttgccaac agcaacgtct cgatttacgc cagctgcctg gccagcgata 960
acccggtggc ggcgtccatc accattgaac cggtcaatcc gtcgcagtgg tacgacggca 1020
gcgacgtcca cgcggtcaaa gtgaaaaagg gcgagacgat gcagctcaag gtgacggtga 1080
aggacgtcag cggcaacccg atcccggaag cgccgtttgt gctcacccgc ggcgacggtt 1140
acgatcgccg gggcgaaaag tataccgctc aggacggtga cgatctgcaa ggcatcgtga 1200
cgcccgtggt gatcgacggc gaatcgctgg catggaccac caccaaaatg gggtcgcaga 1260
ccggcactga cggcacccgt atcatcagcg tcacccgccc ggacacccac ggcacccgca 1320
ccgcgattaa cgcgacgctg tatgaaaatg ccgccgtgag tgccagcatc gacactatct 1380
ttaccgtcgt cacc 1394
<210> 6
<211> 1400
<212> DNA
<213> Salmonella (Salmonella)
<400> 6
ggcagatgga aagcgaacac ggctggccga ccgaagatta ttacatcgcc gccgacagcg 60
acgcctccgg gacggtacac gtcaacctcg aaaacggcga tagcggcaaa tttaccgata 120
cgccgaacta cctgacctgc tcggccaatg aaatggtggc ggtgctggac gtctatttca 180
acgacgaccc ggcgaccaaa aatgccgata tgaccgccaa agtgggtgaa cagattaagc 240
tcaacatcca ttcgcgcaac gctcttaacg gcatggcgat cgccaatacc gacttcaccg 300
tcaccatggc aaacggcagg cggcgcgacg ggctgacgac cggttttacc gataccagca 360
acggcgagat gcagtttgac ggcgtcggct acgttgccgg gcaggtttat cacgggatca 420
ccgacgccaa cggcgatgcg accattatcc tcacccagga taagggcgtg gggctgctga 480
cgcagttaag catcgtgccc gtcgattcat acatcaatac gccggtttcc cgcagcgtga 540
agtttaccgt cgccaccagc ccggatacgg caaaagccaa aatgtggggc catatggccg 600
acacaattac cgtgggtgac tggacctttg agcggcccaa actggcgggt gaagtgagca 660
acccgctgcg tacccaggac gagagcaatg agacctggac gcgtgtggcc cacaccgacg 720
cggcgggcaa cccggaggtg ggcggctgcg cggcgaaccg cctgccgcgc atcgaccagc 780
ttgaggcgct gtataacgcc aacagcggcg gcaaaattaa cggcattcag ggctggccaa 840
tctatcttaa ctactggtcg tccaccttcc agagcgccag cacgtggaaa ctgattgcgc 900
tggcgaacgg cagtgaattt gccaacagca acgtctcgat ttacaccagt tgcctggcca 960
gcgataaccc ggtgccagcc gccatcacca ttgaaccggt cgacccgtcg cagtggtacg 1020
acgacagcgg cgtgcatgca gtcaaagtga aaaagggcga gacgatgcag ctcaaggtga 1080
cggtgaagga cgccagcggc aacccgatcc cggaagcgcc gtttgtactc actcgcggcg 1140
acggctacga ccgccggggc gagaagtata ccgctcagga cggcgacgat ctgcaaggca 1200
tcgtgacgcc cgtggtgatc gacggcgaat cgctggcctg gaccaccact aaaatggggt 1260
cgctgaccgg ccctgacggc acccgcatta ttaacgttac ccgcccggac acccacggca 1320
cccgcaccgc gattaacgcg acgctgtatg aaaatgccgc cgtgagcgcc agcatcgaca 1380
ccatctttac cgtcgtcacc 1400
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gacagatgga aagcgagcac 20
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggtgacgacg gtaaagatag tg 22
Claims (1)
1. A PCR primer capable of detecting salmonella and identifying salmonella pullorum is characterized by comprising a primer SEEP-F and a primer SEEP-R, wherein,
GACAGATGGAAAGCGAGCAC, the nucleotide sequence of which is shown in SEQ ID NO. 7;
GGTGACGACGGTAAAGATAGTG and the nucleotide sequence is shown in SEQ ID NO. 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711106401.5A CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711106401.5A CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107619872A CN107619872A (en) | 2018-01-23 |
| CN107619872B true CN107619872B (en) | 2021-07-16 |
Family
ID=61098748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711106401.5A Active CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107619872B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110714089B (en) * | 2019-10-29 | 2022-06-14 | 扬州大学 | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
| CN112568181A (en) * | 2020-11-27 | 2021-03-30 | 扬州大学 | Method for establishing pullorum salmonella chick embryo infection model |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055040A (en) * | 2011-11-15 | 2013-05-28 | 전북대학교산학협력단 | Pcr primer for detecting salmonella |
| CN104846066A (en) * | 2014-09-23 | 2015-08-19 | 中国农业大学 | PCR detection primers and detection method of Salmonella pullorum |
-
2017
- 2017-11-10 CN CN201711106401.5A patent/CN107619872B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055040A (en) * | 2011-11-15 | 2013-05-28 | 전북대학교산학협력단 | Pcr primer for detecting salmonella |
| CN104846066A (en) * | 2014-09-23 | 2015-08-19 | 中国农业大学 | PCR detection primers and detection method of Salmonella pullorum |
Non-Patent Citations (2)
| Title |
|---|
| On the Evolutionary History，Population Genetics and Diversity among Isolates of Salmonella Enteritidis PFGE Pattern JEGX01.0004;Marc W. Allard等;《PLOS ONE》;20130131;第8卷(第1期);第e55254页 * |
| 鸡白痢沙门氏菌与其它致病性沙门氏菌的血清型特异性PCR 鉴别检测方法的建立;张童利等;《中国预防兽医学报》;20170331;第39卷(第3期);第215-219页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107619872A (en) | 2018-01-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN107619872B (en) | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| Wei et al. | Epidemiological investigations and multilocus sequence typing of Mycoplasma synoviae isolates from chicken farms in China | |
| CN106801103B (en) | Detection primer group, detection kit and multiplex PCR detection method for streptococcus agalactiae | |
| CN111440887A (en) | Pseudomonas proteorum TaqMan real-time fluorescence quantitative PCR detection kit and preparation method thereof | |
| CN110699470A (en) | Dual PCR primer, kit, application and method for detecting salmonella and identifying pullorum disease/gallinarum serotype | |
| CN110724752A (en) | Method for detecting zoonosis pathogenic bacteria of human fish by multiple PCR | |
| CN111206110B (en) | Specific primers, kit and method for synchronously detecting klebsiella pneumoniae and golden yellow bacillus of large yellow croaker source | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| JP5727255B2 (en) | Rapid and simple discrimination method of Salmonella serotype by multiplex PCR and its primer set | |
| CN114606328B (en) | Primer group, probe and kit for detecting campylobacter, application and detection method | |
| CN111500773A (en) | Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus | |
| K Ibraheim et al. | Conventional and molecular detection of Pasteurella multocida in outbreak of respiratory tract infection of sheep and goats in Basrah Province | |
| CN108753999B (en) | Nucleic acid, kit and detection method for detecting salmonella paratyphi of pigeon | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| T AL-Musawi et al. | Escherichia coli O104: H4: a New Challenge in Iraq | |
| CN107604102A (en) | Dove TTV and the dual Real time PCR detection kits of dove New-type adenovirus | |
| CN109762914B (en) | HRM serotyping method, target gene, specific amplification primer and kit for salmonella food-borne pathogenic bacteria | |
| CN111172302B (en) | Providencia retx gene primer, fluorescent quantitative PCR detection method and application | |
| CN111197094B (en) | Compositions, kits and methods for genotyping vibrio parahaemolyticus | |
| CN110714089B (en) | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |