CN107619872A - A kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum - Google Patents
A kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum Download PDFInfo
- Publication number
- CN107619872A CN107619872A CN201711106401.5A CN201711106401A CN107619872A CN 107619872 A CN107619872 A CN 107619872A CN 201711106401 A CN201711106401 A CN 201711106401A CN 107619872 A CN107619872 A CN 107619872A
- Authority
- CN
- China
- Prior art keywords
- salmonella
- pullonum
- pcr
- primer
- seep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum.According to salmonella target sequence (SEQ ID NO.1, NO.2, NO.3), a pair of specific primers of screening design, comprising primer SEEP F and primer SEEP R, wherein, SEEP F nucleotide sequence is as shown in SEQ ID NO.7；SEEP R nucleotide sequence is as shown in SEQ ID NO.8.This method is with above-mentioned primer, and performing PCR amplification is entered to sample to be tested, obtains pcr amplification product；With agarose gel electrophoresis or PCR sequencing PCR detection amplified production；Amplified production size is 590bp, then contains in sample or candidate contains S. pullonum；Amplified production size is 1394bp or 1400bp, then contains in sample or candidate contains other salmonellas.It is of the invention can quick detection salmonella simultaneously differentiate S. pullonum, with traditional salmonella culture, biochemical identification and S. pullonum authentication method compared to more rapidly, simplicity, cost is lower.
Description
Technical field
The invention belongs to PCR detection technique fields, and in particular to one kind can detect salmonella and differentiate white diarrhea sramana
The PCR primer and method of Salmonella.
Background technology
Salmonella is the infecting both domestic animals and human pathogen for having important public hygienics meaning, and the serotype reported at present surpasses
Cross 2500.S. pullonum can cause white diarrhea, have the higher death rate to chick, brought sternly to scale chicken house
The economic loss of weight.S. pullonum Major Epidemic in the chick of 2-3 week old, but at present occur Sensitivity age increase and
The diversified trend of clinical disease type, the cycle that causes entirely to raise chickens all are endangered by this disease.The young often performance drowsiness of white diarrhea disease, weakness
And loss of appetite, bunch up, two wings are sagging, can send sharp cry during defecation, anus and around often have white powder
Or the excreta of green, the chick 20-30% death rate can be caused.The 10-20% death rate, diseased chicken can be caused in Growing Chicken
Caused by mostly disease young bird switchs to chronic after not curing thoroughly, or period of brooding infects.The feature of acute infection, normal table can not showed chicken
It is now symptomless infection.Bacterium enteritidis, salmonella typhimurium in salmonella etc. can be polluted by ovary, fallopian tubal
Egg, the salmonella being colonized in enteron aisle, chicken is polluted when processing trunk, salmonella enters human foods chain, into
Cause the lethal important pathogen died of people's food poisoning for various countries.
According to national standard, " food microbiological examination salmonella examines the sramana of proposition in (GB4789.4-2016)
Salmonella isolated culture method is relatively complicated, wastes time and energy, and report assay substantially needs 4-7 days.Kind chicken house mainly uses at present
Blood plate agglutination test monitors S. pullonum antibody, but this method needs substantial amounts of manpower and materials, and false positive compared with
Height, it is subjected to the influence such as manual operation.《Long-term animal epidemic control program (2012-2020) in country》It is proposed by 2015
S. pullonum the whole nation for generations more than kind chicken house reach purification standard, to the year two thousand twenty the whole nation all kinds of chicken houses reach purification
Standard.Foundation fast and accurately S. pullonum authentication method is needed badly, to promoting kind of a chicken house S. pullonum purification
It is significant.
With the development of molecular biology technology, PCR method has turned into the effective means of quick detection pathogen.At present with
The relevant PCR detection method of S. pullonum is related to 6 patents.Wherein《Salmonella and its five kinds of serotype it is multiple
PCR identification kits》(grant number CN201310110380),《Differentiate drawing for S. pullonum and avian infectious bronchitis nephritis virus
Thing group, kit and method》The S. pullonum detection primer being related in (application number 201510570362.9) can also expand
Increase and multiple Salmonella serogroups such as Wandsworth, Manchester, Chester, Java, Bareilly, specificity is not
It is good；《The PCR detection primers and detection method of S. pullonum》(application number 201410492056.3) and《One kind identification chicken
The PCR detection kit of dysentery characterized by white mucous stool detection of Salmonella》The base for the detection S. pullonum that (application number 201611111312.5) is chosen
Because ipaJ is existed in Salmonella choleraesuls, and the assignment of genes gene mapping is on miniplasmids, and not all S. pullonum
Carry, the situation of missing inspection easily occur；And《A kind of PCR detection kit of Rapid identification particular serotype detection of Salmonella》(application
Number 201610459944.4),《A kind of PCR detection kit of Rapid identification white diarrhea and Salmonella gallinarum》
(201610628075.3) the non-S. pullonum of tcpS, flhB gene chosen in is peculiar, and testing result can not be accurate
It is determined as white diarrhea serotype.Document《The foundation and application of S. pullonum PCR detection techniques》(animal and veterinary magazine,
2011,30(6):The fliC being related in 23-27) is not that white diarrhea serotype is peculiar yet, the interference of the serotypes such as enteritis easily occurs.
Therefore, need further to carry out full-length genome comparison to salmonella and S. pullonum, filter out Salmonella
Bacterium and the peculiar gene of S. pullonum, and then specific primer is designed, for kind of chicken house salmonella and white diarrhea Salmonella
The monitoring of bacterium provides a kind of fast and convenient PCR detection method.
The content of the invention
In view of this, the present invention is directed to the problem of above-mentioned, there is provided one kind can detect salmonella and differentiate white diarrhea sand
The PCR primer and method of door Salmonella.
In order to solve the above-mentioned technical problem, salmonella can be detected the invention discloses one kind and differentiate white diarrhea Salmonella
The PCR primer of bacterium, including primer SEEP-F and primer SEEP-R, wherein,
SEEP-F:GACAGATGGAAAGCGAGCAC, its nucleotide sequence is as shown in SEQ ID NO.7；
SEEP-R:GGTGACGACGGTAAAGATAGTG, its nucleotide sequence is as shown in SEQ ID NO.8.
The invention also discloses a kind of PCR method that can be detected salmonella and differentiate S. pullonum, including with
Lower step：
With above-mentioned primer, performing PCR amplification is entered to sample to be tested, obtains pcr amplification product；With agarose gel electrophoresis or
PCR sequencing PCR detects amplified production；
Amplified production size is 590bp, then contains in sample or candidate contains S. pullonum；
Amplified production size is 1394bp or 1400bp, then contains in sample or candidate contains other salmonellas；
Further, pcr amplification reaction system is 25 μ L：12.5 μ L 2 × Taq PCR MasterMix, 8.5 μ L
ddH2O, 2 each 1 μ L of μ L DNA, primer SEEP-F and primer SEEP-R.
Further, pcr amplification reaction condition is：95 DEG C of pre-degeneration 3min；95 DEG C of 30s, 57 DEG C of annealing 30s, 72 DEG C are prolonged
Stretch 40s, 30 circulations；72℃10min；4 DEG C of preservations.
Compared with prior art, the present invention can be obtained including following technique effect：
1) present invention passes through the S. pullonum full-length genome to being sequenced at present
(GenBank accession number be CP012347, CP003786, LK931482,
CP003047, CP006575) (GenBank accession number is Bacterium enteritidis with other serotype salmonellas：
CP016754；Salmonella typhimurium：CP022168；Salmonella gallinarum：CP019035；Salmonella paratyphi A：
CP000026；Moscow' saint paul：CP019206；Thompson salmonella：CP019196；Salmonella dublin：
CP019179；Salmonella：CP019176；Newport salmonella：CP013685；Salmonella anatis：CP014665)
It is compared, screens the specific gene SEEP9120_005890 of S. pullonum ATCC 9120, it encodes one
Individual hypothesis albumen, S. pullonum 4767bp, other serotype salmonellas are 5580bp or 5589bp.Using
The Software for Design Specific PCR primers of Primer Premier 6.0, S. pullonum purpose fragment 590bp, other sramana
Salmonella 1394 or 1400bp.Both salmonella can be identified, S. pullonum can be judged according to stripe size again.
2) primer being related in the present invention obtains after being based on full-length genome comparative analysis, further using primer-blast
Online comparison is carried out to primer, more accurate compared with the S. pullonum PCR method being related in background technology, specificity
More preferably, without other bacterium non-specific amplifications, salmonella and S. pullonum substance PCR identifications are realized.
3) present invention is by PCR method quick discriminating S. pullonum, with traditional salmonella culture, biochemical mirror
Fixed and S. pullonum authentication method compared to more rapidly, it is easy, cost is lower.
Certainly, any product for implementing the present invention it is not absolutely required to reach all the above technique effect simultaneously.
Brief description of the drawings
Accompanying drawing described herein is used for providing a further understanding of the present invention, forms the part of the present invention, this hair
Bright schematic description and description is used to explain the present invention, does not form inappropriate limitation of the present invention.In the accompanying drawings：
Fig. 1 is PCR specific detections of the present invention；Wherein, M DL2000plus, 1-3 are S. pullonum, 4：Intestines
Scorching salmonella, 5：Salmonella typhimurium, 6：Indiana salmonella, 7：Avian infectious bronchitis nephritis virus, 8：Escherichia coli, 9：
Enterococcus, 10：Healthy chicken intestinal contents extract DNA；
Fig. 2 is PCR sensitivity techniques of the present invention；Wherein, wherein, M DL2000plus, S. pullonum, 1：
108CFU/ml, 2：107CFU/ml, 3：106CFU/ml, 4：105CFU/ml, 5：104CFU/ml, 6：103CFU/ml, 7：102CFU/
Ml, 8：101CFU/ml, 9：Negative control；Bacterium enteritidis, 10：108CFU/ml, 11：107CFU/ml, 12：106CFU/ml,
13：105CFU/ml, 14：104CFU/ml, 15：103CFU/ml, 16：102CFU/ml, 17：101CFU/ml。
Embodiment
Describe embodiments of the present invention in detail below in conjunction with embodiment, thereby to the present invention how application technology hand
Section can fully understand and implement according to this to solve technical problem and reach the implementation process of technical effect.
A kind of structure for the PCR method that can be detected salmonella and differentiate S. pullonum of embodiment 1：
1st, the design of Specific PCR primers：
By S. pullonum full-length genome to being sequenced at present (GenBank accession number be CP012347,
CP003786, LK931482, CP003047, CP006575) (GenBank accession number is enteritis with other serotype salmonellas
Salmonella：CP016754；Salmonella typhimurium：CP022168；Salmonella gallinarum：CP019035；Paratyphoid A sramana
Salmonella：CP000026；Moscow' saint paul：CP019206；Thompson salmonella：CP019196；Salmonella dublin：
CP019179；Salmonella：CP019176；Newport salmonella：CP013685；Salmonella anatis：CP014665)
It is compared, screens S. pullonum ATCC 9120 (GenBank accession number is CP012347) specific gene
SEEP9120_005890, it encodes a hypothesis albumen, and S. pullonum is 4767bp (SEQ ID NO.1), other blood
Clear type salmonella is 5580bp (SEQ ID NO.2) or 5589bp (SEQ ID NO.3).Using Primer Premier 6.0
Software for Design Specific PCR primers, S. pullonum purpose fragment 590bp (SEQ ID NO.4), other salmonellas
1394bp (SEQ ID NO.5) or 1400bp (SEQ ID NO.6).Both salmonella can be identified, again can be big according to band
Small judgement white diarrhea serotype.Substance PCR identification salmonellas and white diarrhea serotype are the method achieve, it is accurate, quick, it is special
It is different in nature good.
PCR primer sequence is as follows：
SEEP-F:GACAGATGGAAAGCGAGCAC, its nucleotide sequence is as shown in SEQ ID NO.7；
SEEP-R:GGTGACGACGGTAAAGATAGTG, its nucleotide sequence is as shown in SEQ ID NO.8.
2nd, it is respectively template with the genome of different serotypes detection of Salmonella and other bacteriums, enters performing PCR amplification；Different serum
Type detection of Salmonella and other bacteriums include：S. pullonum, Bacterium enteritidis, salmonella typhimurium, Indiana are husky
Door Salmonella, avian infectious bronchitis nephritis virus, Escherichia coli, enterococcus genomic DNA and healthy chicken intestinal contents extraction DNA；
Pcr amplification reaction system is 25 μ L：12.5 μ L 2 × Taq PCR MasterMix, 8.5 μ L ddH2O, 2 μ L
DNA, each 1 μ L of upstream and downstream primer (SEEP-F and SEEP-R).
Pcr amplification reaction condition is：95 DEG C of pre-degeneration 3min；95 DEG C of 30s, 57 DEG C annealing 30s, 72 DEG C extension 40s, 30 times
Circulation；72℃10min；4 DEG C of preservations.
3rd, the identification of PCR primer
2 μ L PCR primers are taken to be carried out with 1% Ago-Gel (adding GoldView dyestuffs) in 0.5 × TAE buffer solutions
Electrophoresis detection, as a result as shown in Figure 1.S. pullonum amplicon size is 590bp, the serotype Salmonella of other detections
Bacterium is 1394bp, and Escherichia coli, enterococcus DNA and healthy chicken intestinal contents extraction DNA are feminine gender, shows that energy of the invention is special
Specific amplification salmonella, and S. pullonum can be distinguished according to stripe size.
The sensitivity experiment of embodiment 2
With 101-108CFU/ml S. pullonums, 101-108CFU/ml Bacterium enteritidis is extracted using boiling method
DNA enters performing PCR amplification as template.PCR reaction systems and amplification reaction condition are consistent with embodiment 1.Amplification such as Fig. 2
Shown, it is 10 to extrapolate salmonella and S. pullonum test limit3CFU/ml。
The clinical sample of embodiment 3 detects
15 chicken farms collections are saved from 10, China Sichuan, Guizhou, Hubei, Anhui etc. to die of illness 352 parts of chicken sample, it is sterile to connect
Plant onto blood plate, isolate all kinds of 247 plants of pathogens, bacterial genomes DNA is extracted using boiling method, built according to the present invention
Vertical PCR amplification system and amplification condition is detected, and sets up yin and yang attribute control, takes agaroses of the μ L of PCR primer 2 1%
Result of determination after progress electrophoresis in gel：66 plants of salmonella, wherein 25 plants of S. pullonum are identified altogether.Salmonella gives birth to
Changing identification and serological typing, " food microbiological examination salmonella examines (GB4789.4-2016) to enter according to national standard
OK, 66 plants of salmonella, serological typing 25 plants of S. pullonum of identification are identified from 247 pathogen strain bacterium altogether.As a result
Show that the PCR method qualification result of the salmonella of the invention established and S. pullonum accords with national standard method qualification result
Conjunction rate is 100%.
Some preferred embodiments of invention have shown and described in described above, but as previously described, it should be understood that invention is not
Form disclosed herein is confined to, is not to be taken as the exclusion to other embodiment, and available for various other combinations, modification
And environment, and can be carried out in the scope of the invention is set forth herein by the technology or knowledge of above-mentioned teaching or association area
Change., then all should be in power appended by invention and the change and change that those skilled in the art are carried out do not depart from the spirit and scope of invention
In the protection domain that profit requires.
Sequence table
<110>Sichuan University
<120>A kind of salmonella and the substance PCR rapid identification methods of white diarrhea serotype
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4767
<212> DNA
<213>S. pullonum (Salmonella pullorum)
<400> 1
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggaa ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaaccccgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg cgtaccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt ggcgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcgaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaaacta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cagacagcga taaggccagt atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtataac ctacaccttc acccgcccga agctggcggc ggaagcgagc 1080
ggcgctgaca aaagcgtcgt cgataccaac gaaacctggg cgctgttcga ctggaacggc 1140
gccgataacc attgcaatat tctgccggac gccgaacaac tggtgcagat gcgacatgag 1200
cacagcacgc tggcaacgta caccggctgg ccggcgacgg acgatgccga atactggtcg 1260
ttgaccaaag atcagatgag cggctaccac gctgccgtac atatgaacag cgcatcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcctgcg 1380
gcgcacccgc agattactct ctccccacaa ggaccgtata aagcgcaggt gggggagtcg 1440
attgatctga cgatgaccgt agttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgaaaaac cgcaaagggg aacatcagga cgcatgggat 1560
aacctgcggg tcaccgttga ttccgaaggt atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgtcaacgg ccaggcgcac ctgacgttaa aacataacag cggcctgggc 1680
gtcgaaacgc ccatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagctgtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
catatgcgcg gcgtggtgga cgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca attcagcgaa aataacgaag agtgggcgac gtttaactcc 1920
gtggcgtcgg ccaccgcgca gtgcggtgtc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcggacag atggaaagcg agcacggctg gccgacctat 2040
cttaactact ggtcgtccac ctaccagagc gccaccacct ggaaactgat cgcgctgacg 2100
aacggcagtg aatttgccaa cagcaacgtc tcgatttacg ccagctgcct ggccagcgat 2160
aacccggtgg cggcgtccat caccattgaa ccggtcaatc cgtcgcagtg gtacgacggc 2220
agcgacgtcc acgcggtcaa agtgaaaaag ggcgagacga tgcagctcaa ggtgacggtg 2280
aaggacgcca gcggcaaccc gatcccggaa gcgccgtttg tgctcacccg cggcgacggt 2340
tacgatcgcc ggggcgaaaa gtataccgct caggacggtg acgatctgca aggcatcgtg 2400
acgcccgtgg tgatcgacgg cgaatcgctg gcatggacca ccaccaaaat ggggtcgcag 2460
accggcactg acggcacccg tatcatcagc gtcacccgcc cggacaccca cggcacccgc 2520
accgcgatta acgcgacgct gtatgaaaat gccgccgtga gtgccagcat cgacactatc 2580
tttaccgtcg tcaccagccc ggatgtcagc gtcgcccgca tgtgggggca tatggcgcca 2640
tcgctgacgg cggcggatgg cgcggtgtac cagcgcccgc tgctgtacgc tgagctgtcc 2700
agtacggaca atactgcgtc taagcaagaa accaacgaaa cctgggcggt ttttcatggg 2760
ccagccagtg aaggggccaa tccggcccgt tgcgcggcgg gctattaccc tgccgttgag 2820
gcgctggatt cgctctacag caaatacccg agccgaacga taaataccgc ccagggctgg 2880
ccggtctact attcttactg gagcggatcg aactcgacgt cattttccag cggggcaaaa 2940
cttgacttct attacgcagt cgatctggct gatggttcgc gtcggtcaga aaacagcgcg 3000
accagcactg cctggcagta tcaaatttgc gccacgacgc cgctgccgca ggccacgcag 3060
attaccctca cctccccgca ggcgatggat gacgctattc aggcggtgaa ggcgaaaaac 3120
agcgagtcga tcccgctact catcaccact accgatgcga tgggcaaccc ggtgccttat 3180
gcgacttttt cgcttaaacg cgacgccggg aaggcgcgca acaccgacta taataaattt 3240
gtagccacta acggcaccaa catgacggtg acgccgctca ccggtgcgca gcaacagttt 3300
tactatgcca catcggttct gaccggcgcg gatggtacgc tggccctgac gcttgccgaa 3360
cccggcggca tagggttgaa aaaccagctg accgcgaatc tgaacgatac gccgacggcg 3420
acctcatcgc tgccggtggt gttcaccgtc ctcaccagcc cggacagcga caaggccaac 3480
atgtacggcc atatgccgga gaccttcacc gccagcaacg gtgcggagtt taagcgcccg 3540
ctggtggcag gcgagccctc atcggaggcg cacacggata catatttcga aaccaatgag 3600
aactggctca tggtgaatag ttttaatacc ggcaattacg gcgggtgtcc gatgaaccag 3660
atggctgcga tagatgattt cactgcgctg tacaacgatc acccaagcgg caaggtggcg 3720
accgatattg gattgcccgt cgggaagcgg tggtgggcgg gggatagcct gctgaaaggc 3780
tcaacccttt actggcagta taaagatctc aagacgggga aaaactacag catgtcggaa 3840
aacccgggta actactactt acaactctgc ctgacaacat cgcgcagcgg gctgaatatc 3900
gcgctctctt ccgacgcatg gaacgccgat aaatcggcgg ccgtggcgaa aaaaggcgaa 3960
acgataccga tgacggtaac ggtgactaac gacgccgggc agccgcaggc cggggtggcc 4020
gtactgttga cgcgtgatta cgcttattcg cgcggtgcgg tggataagca atacattgaa 4080
ccaggcgtga ttggcgagcc ggttccgttt acaacttcgc ctgcgaatat gatgctgacg 4140
ccggttgcac ctgcgggtac ggcaatggcg tttaataacc agaatggcct cagcacaaaa 4200
tggtctggct tcaccggcga tgacggtaag ttgcggttta cgttaactca ggataaatcg 4260
ctggggttaa aaacgtctgt cacggcggcg cttgcgaatc aatttgatga ggcggcgagc 4320
gtagatgcaa tctttacggt acaaaccagc ccggacacgc cgtatgcgtc atactggggt 4380
catatgccgg ataccgtgca ggtgaacggc gttacgctgc gccgcccgta cctgaaagcc 4440
gagctctctg ccgcgccccg ggatacctgg ccgtttaata atgaaatctg ggggacgaac 4500
tattattatc agtccgaaca cgtggaaacg tcgttgacgc atctttgcgg atcgcaggaa 4560
aatatagcct cgctggacga tctgaaagcg ttgcagagcg ttatcggcac gttgcaatgg 4620
ccgacgacat catcctggga ctatgtgtcg caagatgaag gtcaaagcaa taagtactac 4680
tgttcattta acgaaacgac cggccagaca acctgtactc gtgaaaaagc gacgacctca 4740
ggcttaggct cgtgccgggt gccgtag 4767
<210> 2
<211> 5580
<212> DNA
<213>Salmonella (Salmonella)
<400> 2
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggca ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaacctcgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg cgtaccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt ggcgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcgaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaaacta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cagacagcga taaggccagt atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtataac ctacaccttc acccgcccga agctggcggc ggaagcgagc 1080
ggcgctgaca aaagcgtcgt cgataccaac gaaacctggg cgctgttcga ctggaacggc 1140
gccgataacc attgcaatat tctgccggat gccgaacaac tggtgcagat gcgacatgag 1200
cacagcacgc tggcaacgta caccggctgg ccggcgacgg acgatgccga atactggtcg 1260
tcgaccaaag atcagatgag cggctaccac gctgccgtac atatgaacag cgcatcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcctgcg 1380
gcgcacccgc agattactct ctccccacaa ggaccgtata aagcgcaggt gggggagtcg 1440
attgatctga cgatgaccgt agttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgaaaaac cgcaaagggg aacatcagga cgcatgggat 1560
aacctgcggg tcaccgttga ttccgaaggt atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgtcaacgg ccaggcgcac ctgacgttaa aacataacag cggcctgggc 1680
gtcgaaacgc ccatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagctgtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
catatgcgcg gcgtggtgga cgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca attcagcgaa aataacgaag agtgggcgac gtttaactcc 1920
gtggcgtcgg ccaccgcgca gtgcggtgtc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcggacag atggaaagcg agcacggctg gccgactgaa 2040
gattatttca tcgccgccga cagcgacgcc tccgggacgg tacacgtcaa cctcgaaaac 2100
ggcgatagcg gcaaatttac cgatacgccc aactacctga cctgctcggc caatgaaatg 2160
gtggcggtgc tggacgtcta cttcaacgac gacccggtga tcaaaaacgc cgacgccaaa 2220
gtgggtgaac aggttaagat gaacatccat tcgcgcaacg cccttaacgg catagcgatc 2280
ggcaataccg acttcaccat caccatggcg aacggcaggc ggcgtgacgg gctgacgacc 2340
ggctttaccg ataccagcaa cggcgagatg cagtttgacg acgtgggcta cgttgccggg 2400
caggtttatc acgggatcac cgacgctaac ggcgatgcga ccattatcct cacccagaaa 2460
aagggcgtgg ggctgctgac gccgttaagc atcgtgcccg tcaattcata catcaatacg 2520
ccggtttccc gcagcgtgaa gtttaccgtc gcgaccagcc cggatacggc aaaagccaaa 2580
atgtggggcc atatggccga cacgattacc gtgggcgact ggacttttga gcggcccaaa 2640
ctggcgggtg aagtgagcaa cccgctgcgt acccaggacg agagcaatga gacctgggcg 2700
cgcgtggccc atagcgacgc ggtgggcaac ccggatgcgg gcggctgcgc ggcgaaccgc 2760
ctgccgcgca tcgaccagct tgaggcgctg tataacgcca acagcggcgg caagattcac 2820
agcattcagg gctggccgac ctatcttaac tactggtcgt ccacctacca gagcgccacc 2880
acctggaaac tgatcgcgct gacgaacggc agtgaatttg ccaacagcaa cgtctcgatt 2940
tacgccagct gcctggccag cgataacccg gtggcggcgt ccatcaccat tgaaccggtc 3000
aatccgtcgc agtggtacga cggcagcgac gtccacgcgg tcaaagtgaa aaagggcgag 3060
acgatgcagc tcaaggtgac ggtgaaggac gccagcggca acccgatccc ggaagcgccg 3120
tttgtgctca cccgcggcga cggttacgat cgccggggcg aaaagtatac cgctcaggac 3180
ggtgacgatc tgcaaggcat cgtgacgccc gtggtgatcg acggcgaatc gctggcatgg 3240
accaccacca aaatggggtc gcagaccggc actgacggca cccgtatcat cagcgtcacc 3300
cgcccggaca cccacggcac ccgcaccgcg attaacgcga cgctgtatga aaatgccgcc 3360
gtgagtgcca gcatcgacac tatctttacc gtcgtcacca gcccggatgt cagcgtcgcc 3420
cgcatgtggg ggcatatggc gccatcgctg acggcggcgg atggcgcggt gtaccagcgc 3480
ccgctgctgt acgctgagct gtccagtacg gacaatactg cgtctaagca agaaaccaac 3540
gaaacctggg cggtttttca tgggccagcc agtgaagggg ccaatccggc ccgttgcgcg 3600
gcgggctatt accctgccgt tgaggcgctg gattcgctct acagcaaata cccgagccga 3660
acgataaata ccgcccaggg ctggccggtc tactattctt actggagcgg atcgaactcg 3720
acgtcatttt ccagcggggc aaaacttgac ttctattacg cagtcgatct ggctgatggt 3780
tcgcgtcggt cagaaaacag cgcgaccagc actgcctggc agtatcaaat ttgcgccacg 3840
acgccgctgc cgcaggccac gcagattacc ctcacctccc cgcaggcgat ggatgacgct 3900
attcaggcgg tgaaggcgaa aaacagcgag tcgatcccgc tactcatcac cactaccgat 3960
gcgatgggca acccggtgcc ttatgcgact ttttcgctta aacgcgacgc cgggaaggcg 4020
cgcaacaccg actataataa atttgtagcc actaacggca ccaacatgac ggtgacgccg 4080
ctcaccggtg cgcagcaaca gttttactat gccacatcgg ttctgaccgg cgccaccggc 4140
gcggatggta cgctggccct gacgcttgcc gaacccggcg gcatagggtt gaaaaaccag 4200
ctgaccgcga atctgaacga tacgccgacg gcgacctcat cgctgccggt ggtgttcacc 4260
gtcctcacca gcccggacag cgacaaggcc aacatgtacg gccatatgcc ggagaccttc 4320
accgccagca acggtgcgga gtttaagcgc ccgctggtgg caggcgagcc ctcatcggag 4380
gcgcacacgg atacatattt cgaaaccaat gaaaactgga tcatggtgaa tagttttaat 4440
accggcaatt acggcgggtg tccgatgaac cagatggctg cgatagatga tttcactgcg 4500
ctgtacaacg atcacccaag cggcaaggtg gcgaccgata ttggattgcc cgtcgggaag 4560
cggtggtggg cgggggatag cctgctgaaa ggctcaaccc tttactggca gtataaagat 4620
ctcaagacgg ggaaaaacta cagcatgtcg gaaaacccgg gtaactacta cttacaactc 4680
tgcctgacaa catcgcgcag cgggctgaat atcgcgctct cttccgacgc atggaacgcc 4740
gataaatcgg cggccgtggc gaaaaaaggc gaaacgatac cgatgacggt aacggtgact 4800
aacgacgccg ggcagccgca ggccggggtg gccgtactgt tgacgcgtga ttacgcttat 4860
tcgcgcggtg cggtggataa gcaatacatt gaaccaggcg tgattggcga gccggttccg 4920
tttacaactt cgcctgcgaa tatgatgctg acgccggttg cacctgcggg tacggcagtg 4980
gcgtttaata accagaatgg cctcagcaca aaatggtctg gcttcaccgg cgatgacggt 5040
aagttgcggt ttacgttaac tcaggataaa tcgctggggt taaaaacgtc tgtcacggcg 5100
gcgcttgcga atcaatttga tgaggcggcg agcgtagatg caatctttac ggtacaaacc 5160
agcccggaca cgccgtatgc gtcatactgg ggtcatatgc cggataccgt gcaggtgaac 5220
ggcgttacgc tgcgccgccc gtacctgaaa gccgagctct ctgccgcgcc ccgggatacc 5280
tggccgttta ataatgaaat ctgggggacg aactattatt atcagtccga acacgtggaa 5340
acgtcgttga cgcatctttg cggatcgcag gaaaatatag cctcgctgga cgatctgaaa 5400
gcgttgcaga gcgttatcgg cacgttgcaa tggccgacga catcatcctg ggactatgtg 5460
tcgcaagatg aaggtcaaag caataagtac tactgttcat ttaacgaaac gaccggccag 5520
acaacctgta ctcgtgaaaa agcgacgacc tcaggcttag gctcgtgccg ggtgccgtag 5580
<210> 3
<211> 5589
<212> DNA
<213>Salmonella (Salmonella)
<400> 3
gtgaataaag ttgtacattt cttactgaca ttactgatca tgtttgcagt gtcgatcgca 60
cctgcgcagg cgctattgaa gggcggaacc tggcaagagc tgaactcagt caccggtgcg 120
gttaacggca ccgcgccgct ggccgacggc gctattatcc ccctttacca gggaagtacg 180
ctgcttgacc cgagcaaaac ccacgatatt gaattcagcg ccatgccgcg cgattttagc 240
gcggatgcta cctcaacctc gatgcgggcg gtcaattcca ccgataccga aggcgatctc 300
tttagcgatc cgcccaccat cgcctgggaa aaccgccagc cgcccgccat gggcctggta 360
tgggccgatg ccgccacgcc cgacacgccg ctctcgccgc agccggttcc gaacctgacc 420
ttttgcgccc aaaacctcgc cgggcgacag ctggtggcct gggcgcaggt ggaagatgaa 480
accaacgttc ccgcgctgtg gctctttacg aataccgggg tgccgaatta tgcgaccatt 540
ccgctgttaa gcccgaaagt gacgctgaat atcaaaccag cggtgagcga ccctgtttct 600
gtgagcggcg atcatgtcga tgccagtttt gaagcatcga aagttaaggt cggagaaagt 660
attactctta ctgtcaccac caaagcgtgt gatggcaaac ctgcgatcaa tgcgccgttt 720
gtgatccgtc gcgaggatgc aataaatcgc cagggtgtgg tcaataacgc taacccggtg 780
cgcgttggca ataccgagtt aacgactgcg caaacagaat atcatggtgt aacggacggg 840
cagggcaacg ccacggtggt ggtaacgcaa gagaacggtc cgggggtaaa aacgcgactt 900
atcgtctctt cgcaaagcta tcccacgctg accgacaatg tcgacgtcat tttcaccacc 960
atcaccagtc cggacagcga taaggccaat atgtacggcc acatgataga gagcgctacc 1020
gcgacgctga acggtacgac ttacaccttc acccgcccga aactgctggc ggaagcgagc 1080
ggcgcggaca gccgcgtcga cgataccaac gaaacctggg cgcagtttac ctggagcggc 1140
gccgataacc actgcaacat tctgccggat gccgaacaac tggtggcgtt caggcatgag 1200
cacagcacac tggcgacgta caccggctgg ccggcgacgg acgatgccga atactggtca 1260
tcgaccaaaa accaactgag cggctaccat tccgcagtgc atatgaacag cgcgtcggtc 1320
gtcagggccg ccgacagcga cacgctgctg gtcagttgtg tggataaagc ccagcccgca 1380
gcgcacccgc agattaccct ttctccggtg gggccgtata aagcgcaggt gggagacgaa 1440
atcgatttga cgatgaccgt ggttgaccgg gacacgcaaa aaccgctgcc ttaccgctac 1500
atggagctgt ttatcgaccc ggcgacaaac cgcaaagggg agcaccagga cgcgtgggat 1560
aaccagcggg tcaccgtcga ttccgaaggc atgagcgcct cgtcgccgga gcactatacc 1620
ggcgtgactg acgttaacgg ccaggcgcat ctgacgttaa aacacgacag cggcatgggc 1680
gtcgaaacgc ctatccgcat cgtgatgccg gacgacgaag gcggcaacgt cgagcagtcc 1740
tttagcgtaa ttttcaccgt ggtcaccagc ccggacgtgg acggcgccaa catgtggggc 1800
cacatgcgcg gcgtggtaga tgcgggcaac ctgtacaaac gtccgctgct ggcggtggag 1860
gccagccata aagacggcca gttcgacgaa aacaacgaac agtgggcgac atttaactcc 1920
gtggcatcgg ccaccgcgca gtgcggtacc ggccaggtgc cggatcagtc gtcgctggcg 1980
catttgtaca gcgaacatgc gggcgggcag atggaaagcg aacacggctg gccgaccgaa 2040
gattattaca tcgccgccga cagcgacgcc tccgggacgg tacacgtcaa cctcgaaaac 2100
ggcgatagcg gcaaatttac cgatacgccg aactacctga cctgctcggc caatgaaatg 2160
gtggcggtgc tggacgtcta tttcaacgac gacccggcga ccaaaaatgc cgatatgacc 2220
gccaaagtgg gtgaacagat taagctcaac atccattcgc gcaacgctct taacggcatg 2280
gcgatcgcca ataccgactt caccgtcacc atggcaaacg gcaggcggcg cgacgggctg 2340
acgaccggtt ttaccgatac cagcaacggc gagatgcagt ttgacggcgt cggctacgtt 2400
gccgggcagg tttatcacgg gatcaccgac gccaacggcg atgcgaccat tatcctcacc 2460
caggataagg gcgtggggct gctgacgcag ttaagcatcg tgcccgtcga ttcatacatc 2520
aatacgccgg tttcccgcag cgtgaagttt accgtcgcca ccagcccgga tacggcaaaa 2580
gccaaaatgt ggggccatat ggccgacaca attaccgtgg gtgactggac ctttgagcgg 2640
cccaaactgg cgggtgaagt gagcaacccg ctgcgtaccc aggacgagag caatgagacc 2700
tggacgcgtg tggcccacac cgacgcggcg ggcaacccgg aggtgggcgg ctgcgcggcg 2760
aaccgcctgc cgcgcatcga ccagcttgag gcgctgtata acgccaacag cggcggcaaa 2820
attaacggca ttcagggctg gccaatctat cttaactact ggtcgtccac cttccagagc 2880
gccagcacgt ggaaactgat tgcgctggcg aacggcagtg aatttgccaa cagcaacgtc 2940
tcgatttaca ccagttgcct ggccagcgat aacccggtgc cagccgccat caccattgaa 3000
ccggtcgacc cgtcgcagtg gtacgacgac agcggcgtgc atgcagtcaa agtgaaaaag 3060
ggcgagacga tgcagctcaa ggtgacggtg aaggacgcca gcggcaaccc gatcccggaa 3120
gcgccgtttg tactcactcg cggcgacggc tacgaccgcc ggggcgagaa gtataccgct 3180
caggacggcg acgatctgca aggcatcgtg acgcccgtgg tgatcgacgg cgaatcgctg 3240
gcctggacca ccactaaaat ggggtcgctg accggccctg acggcacccg cattattaac 3300
gttacccgcc cggacaccca cggcacccgc accgcgatta acgcgacgct gtatgaaaat 3360
gccgccgtga gcgccagcat cgacaccatc tttaccgtcg tcaccagccc ggatgccagc 3420
gtcgcccgca tgtgggggca tatggcgccg tcgctgacgg cggcggatgg cgcggtgtac 3480
cagcgcccgc tgctgtacgc tgagctgtcc agtacggaca atactacgtc taagcaagaa 3540
accaacgaaa cctgggcggt ttttcatggg ccagccagtg aaggggcaaa tccggcccgt 3600
tgcgcggcgg gctattaccc tgccgttgag gcgctggatt cgctctacag caaatacccg 3660
agccgaacga taaataccgc ccagggctgg ccggtctact attcttactg gagcggatcg 3720
aactcgacgt cattttccag cggggcaaaa gttgacttct attacgttgt cgatctggct 3780
gatggttcgc gtcggtcaga aaacagctcg cccagcactg cctggcagta ccaaatttgc 3840
gctacgacgc cgttgccgca ggccacgcag attaccctca cctccccgca ggcgatggat 3900
gacgctattc aggcggtgaa ggcgaaaaac agcgagtcga tcccgctgct catcaccact 3960
accgatgcga tgggcaaccc ggtgccttat gcgacttttt cgcttaaacg cgacgccggg 4020
acgccgcgca acgccgacta taaaaaattt aacaccacca acgccaccaa catgacggta 4080
aagccgctca ccggtgcgca gcaacagttt tactatgcca catcggttct gaccggcgcc 4140
accggcgcgg acggtacgct gactctgacg cttgccgaac ccggcggcat agggttgaaa 4200
aacgtgctga ccgcgagtct gtacgatacg ccgacggcga cctcaacgct gccggtggtg 4260
ttcaccgtcc tcaccagccc ggacagcgac aaggccaaca tgtacggcca tatgccggag 4320
accttcaccg ccagcaacgg tgcggagttt aagcgcccgc tggtggtagg cgagccctca 4380
tcggaggcgc acacggatac ctatttcgaa accaatgaat actgggtcat ggtgaatagt 4440
tttaataccg gtaattacgg cggatgtccg atgaaccaga tggctgcgat ggatgatttc 4500
acggcgctgt acaaggatca cccaagcggc aaggtggcga ccgatattgg attgcccgtc 4560
gggaagcggt ggtgggcggg cgatagcctg ctgaaaggct caacccttta ctggcaatat 4620
aaagatctca agacggggaa agactacagc atgtcggaaa acccgggtaa ctactactta 4680
caactctgcc tgacaacatc gcgcagcggg ctgaatatcg cgctctcttc cgacgcatgg 4740
aacgccgata aatcagcggc tgtggcgaaa aaaggcgaaa cgataccgat gacggtaacg 4800
gtgactaacg acgccgggca gccgcaggcc ggggtggccg tactgttgac gcgtgaatac 4860
gcttattcgc gcggtgaggt ggataagcaa tacattgaac caggcgtgat tggcgagccg 4920
gttccgttta caacttcgcc ggcgaatatg atgctgacgc cggtttcacc tgtggcgggt 4980
acggcagtgg cgtttaataa ccagactggc ctcagcacaa aatggtctgg cttcaccggc 5040
gatgacggta agttgcggtt tacgttaact caggataaat cgctggggtt aaaaacgtct 5100
gtcacggcgg cgcttgcgaa tcaatttgat gaggcggcga gcgtggatgc aatctttacg 5160
atacaaacca gcccggacac gccgtatgcg tcatactggg gtcatatgcc ggataccgtg 5220
caggtgaacg gcgttacgct gcgccgcccg tatctgaaag ccgagctctc tgccatgccc 5280
cggaatacct ggccgtttaa taatgaaatc tgggggtcga actattatta tcagtcccag 5340
cacgtggaaa cgtcgttgac gcatctttgc ggatcgcagg aaaatatagc ctcgctggac 5400
gatctgaaag cgttgcagag cgttatcggc acgttgcaat ggccgacgac atcgtcctgg 5460
gattatgtgt cgcaagatga aggtcaaagc gataagtact actgttcatt taacgaaacg 5520
accggccaga caacctgtac tcgtgaaaaa tcggctaccg cgggctttgg ctcgtgccgg 5580
gtgccgtag 5589
<210> 4
<211> 590
<212> DNA
<213>S. pullonum (Salmonella pullorum)
<400> 4
gacagatgga aagcgagcac ggctggccga cctatcttaa ctactggtcg tccacctacc 60
agagcgccac cacctggaaa ctgatcgcgc tgacgaacgg cagtgaattt gccaacagca 120
acgtctcgat ttacgccagc tgcctggcca gcgataaccc ggtggcggcg tccatcacca 180
ttgaaccggt caatccgtcg cagtggtacg acggcagcga cgtccacgcg gtcaaagtga 240
aaaagggcga gacgatgcag ctcaaggtga cggtgaagga cgccagcggc aacccgatcc 300
cggaagcgcc gtttgtgctc acccgcggcg acggttacga tcgccggggc gaaaagtata 360
ccgctcagga cggtgacgat ctgcaaggca tcgtgacgcc cgtggtgatc gacggcgaat 420
cgctggcatg gaccaccacc aaaatggggt cgcagaccgg cactgacggc acccgtatca 480
tcagcgtcac ccgcccggac acccacggca cccgcaccgc gattaacgcg acgctgtatg 540
aaaatgccgc cgtgagtgcc agcatcgaca ctatctttac cgtcgtcacc 590
<210> 5
<211> 1394
<212> DNA
<213>Salmonella (Salmonella)
<400> 5
gacagatgga aagcgagcac ggctggccga ctgaagatta tttcatcgcc gccgacagcg 60
acgcctccgg gacggtacac gtcaacctcg aaaacggcga tagcggcaaa tttaccgata 120
cgcccaacta cctgacctgc tcggccaatg aaatggtggc ggtgctggac gtctacttca 180
acgacgaccc ggtgatcaaa aacgccgacg ccaaagtggg tgaacaggtt aagatgaaca 240
tccattcgcg caacgccctt aacggcatgg cgatcggcaa taccgacttc accatcacca 300
tggcgaacgg caggcggcgt gacgggctga cgaccggctt taccgatacc agcaacggcg 360
agatgcagtt tgacgacgtg ggctacgttg ccgggcaggt ttatcacggg atcaccgacg 420
ctaacggcga tgcgaccatt atcctcaccc agaaaaaggg cgtggggctg ctgacgccgt 480
taaatattgc gcccgtcgat tcattaatca gcacgccggt ttcccgcagc gtgaagttta 540
ccgtcgccac cagcccggat acgccagcgg ccaaaatgtg gggccatatg gccgacacga 600
ttaccgtggg cgactggacc tttgagcggc ccaaactggc gggtgaagtg agcaacccgc 660
tgcgtaccca ggacgagagc aatgagacct gggcgcgcgt ggcccatagc gacgcggtgg 720
gcaacccgga tgcgggcggc tgcgcggcga accgcctgcc gcgcatcgac cagcttgagg 780
cgctgtataa cgccaacagc ggcggcaaga ttcacagcat tcagggctgg ccgacctatc 840
ttaactactg gtcgtccacc taccagagcg ccaccacctg gaaactgatc gcgctgacga 900
acggcagtga atttgccaac agcaacgtct cgatttacgc cagctgcctg gccagcgata 960
acccggtggc ggcgtccatc accattgaac cggtcaatcc gtcgcagtgg tacgacggca 1020
gcgacgtcca cgcggtcaaa gtgaaaaagg gcgagacgat gcagctcaag gtgacggtga 1080
aggacgtcag cggcaacccg atcccggaag cgccgtttgt gctcacccgc ggcgacggtt 1140
acgatcgccg gggcgaaaag tataccgctc aggacggtga cgatctgcaa ggcatcgtga 1200
cgcccgtggt gatcgacggc gaatcgctgg catggaccac caccaaaatg gggtcgcaga 1260
ccggcactga cggcacccgt atcatcagcg tcacccgccc ggacacccac ggcacccgca 1320
ccgcgattaa cgcgacgctg tatgaaaatg ccgccgtgag tgccagcatc gacactatct 1380
ttaccgtcgt cacc 1394
<210> 6
<211> 1400
<212> DNA
<213>Salmonella (Salmonella)
<400> 6
ggcagatgga aagcgaacac ggctggccga ccgaagatta ttacatcgcc gccgacagcg 60
acgcctccgg gacggtacac gtcaacctcg aaaacggcga tagcggcaaa tttaccgata 120
cgccgaacta cctgacctgc tcggccaatg aaatggtggc ggtgctggac gtctatttca 180
acgacgaccc ggcgaccaaa aatgccgata tgaccgccaa agtgggtgaa cagattaagc 240
tcaacatcca ttcgcgcaac gctcttaacg gcatggcgat cgccaatacc gacttcaccg 300
tcaccatggc aaacggcagg cggcgcgacg ggctgacgac cggttttacc gataccagca 360
acggcgagat gcagtttgac ggcgtcggct acgttgccgg gcaggtttat cacgggatca 420
ccgacgccaa cggcgatgcg accattatcc tcacccagga taagggcgtg gggctgctga 480
cgcagttaag catcgtgccc gtcgattcat acatcaatac gccggtttcc cgcagcgtga 540
agtttaccgt cgccaccagc ccggatacgg caaaagccaa aatgtggggc catatggccg 600
acacaattac cgtgggtgac tggacctttg agcggcccaa actggcgggt gaagtgagca 660
acccgctgcg tacccaggac gagagcaatg agacctggac gcgtgtggcc cacaccgacg 720
cggcgggcaa cccggaggtg ggcggctgcg cggcgaaccg cctgccgcgc atcgaccagc 780
ttgaggcgct gtataacgcc aacagcggcg gcaaaattaa cggcattcag ggctggccaa 840
tctatcttaa ctactggtcg tccaccttcc agagcgccag cacgtggaaa ctgattgcgc 900
tggcgaacgg cagtgaattt gccaacagca acgtctcgat ttacaccagt tgcctggcca 960
gcgataaccc ggtgccagcc gccatcacca ttgaaccggt cgacccgtcg cagtggtacg 1020
acgacagcgg cgtgcatgca gtcaaagtga aaaagggcga gacgatgcag ctcaaggtga 1080
cggtgaagga cgccagcggc aacccgatcc cggaagcgcc gtttgtactc actcgcggcg 1140
acggctacga ccgccggggc gagaagtata ccgctcagga cggcgacgat ctgcaaggca 1200
tcgtgacgcc cgtggtgatc gacggcgaat cgctggcctg gaccaccact aaaatggggt 1260
cgctgaccgg ccctgacggc acccgcatta ttaacgttac ccgcccggac acccacggca 1320
cccgcaccgc gattaacgcg acgctgtatg aaaatgccgc cgtgagcgcc agcatcgaca 1380
ccatctttac cgtcgtcacc 1400
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
gacagatgga aagcgagcac 20
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
ggtgacgacg gtaaagatag tg 22
Claims (4)
1. a kind of PCR primer that can be detected salmonella and differentiate S. pullonum, it is characterised in that including primer
SEEP-F and primer SEEP-R, wherein,
SEEP-F:GACAGATGGAAAGCGAGCAC, its nucleotide sequence is as shown in SEQ ID NO.7；
SEEP-R:GGTGACGACGGTAAAGATAGTG, its nucleotide sequence is as shown in SEQ ID NO.8.
2. a kind of PCR method that can be detected salmonella and differentiate S. pullonum, it is characterised in that including following step
Suddenly：
With the primer described in claim 1, performing PCR amplification is entered to sample to be tested, obtains pcr amplification product；Coagulated with agarose
Gel electrophoresis or PCR sequencing PCR detection amplified production；
Amplified production size is 590bp, then contains in sample or candidate contains S. pullonum；
Amplified production size is 1394bp or 1400bp, then contains in sample or candidate contains other salmonellas.
3. the PCR method according to claim 2 that can be detected salmonella and differentiate S. pullonum, its feature exist
In pcr amplification reaction system is 25 μ L：12.5 μ L 2 × Taq PCR MasterMix, 8.5 μ L ddH2O, 2 μ L DNA, primer
Each 1 μ L of SEEP-F and primer SEEP-R.
4. the PCR method according to claim 2 that can be detected salmonella and differentiate S. pullonum, its feature exist
In pcr amplification reaction condition is：95 DEG C of pre-degeneration 3min；95 DEG C of 30s, 57 DEG C of annealing 30s, 72 DEG C extend 40s, 30 circulations；
72℃10min；4 DEG C of preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711106401.5A CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711106401.5A CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107619872A true CN107619872A (en) | 2018-01-23 |
| CN107619872B CN107619872B (en) | 2021-07-16 |
Family
ID=61098748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711106401.5A Active CN107619872B (en) | 2017-11-10 | 2017-11-10 | PCR primer and method capable of detecting salmonella and identifying salmonella pullorum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107619872B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110714089A (en) * | 2019-10-29 | 2020-01-21 | 扬州大学 | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
| CN112568181A (en) * | 2020-11-27 | 2021-03-30 | 扬州大学 | Method for establishing pullorum salmonella chick embryo infection model |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055040A (en) * | 2011-11-15 | 2013-05-28 | 전북대학교산학협력단 | Pcr primer for detecting salmonella |
| CN104846066A (en) * | 2014-09-23 | 2015-08-19 | 中国农业大学 | PCR detection primers and detection method of Salmonella pullorum |
-
2017
- 2017-11-10 CN CN201711106401.5A patent/CN107619872B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055040A (en) * | 2011-11-15 | 2013-05-28 | 전북대학교산학협력단 | Pcr primer for detecting salmonella |
| CN104846066A (en) * | 2014-09-23 | 2015-08-19 | 中国农业大学 | PCR detection primers and detection method of Salmonella pullorum |
Non-Patent Citations (2)
| Title |
|---|
| MARC W. ALLARD等: "On the Evolutionary History，Population Genetics and Diversity among Isolates of Salmonella Enteritidis PFGE Pattern JEGX01.0004", 《PLOS ONE》 * |
| 张童利等: "鸡白痢沙门氏菌与其它致病性沙门氏菌的血清型特异性PCR 鉴别检测方法的建立", 《中国预防兽医学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110714089A (en) * | 2019-10-29 | 2020-01-21 | 扬州大学 | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
| CN110714089B (en) * | 2019-10-29 | 2022-06-14 | 扬州大学 | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
| CN112568181A (en) * | 2020-11-27 | 2021-03-30 | 扬州大学 | Method for establishing pullorum salmonella chick embryo infection model |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107619872B (en) | 2021-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Salehi et al. | Detection of invA gene in isolated Salmonella from broilers by PCR method | |
| Van et al. | Campylobacter hepaticus, the cause of spotty liver disease in chickens, is present throughout the small intestine and caeca of infected birds | |
| Zandi et al. | Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. | |
| Shahdadnejad et al. | Typing of clostridium perfringens isolated from broiler chickens using multiplex PCR | |
| CN107190104B (en) | Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application | |
| CN105648055B (en) | A kind of fowl source salmonella multiple PCR detection kit and its nondiagnostic detection method | |
| US11725252B2 (en) | PCR detection kit for rapidly identifying Salmonella of specific serotypes | |
| Stenzel et al. | Occurrence and genetic diversity of pigeon circovirus strains in Poland | |
| CN107619872A (en) | A kind of PCR primer and method that can be detected salmonella and differentiate S. pullonum | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN110699485A (en) | RPA primer pair, probe, kit and detection method for rapidly detecting Marek's disease virus | |
| CN108060265A (en) | For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application | |
| Wei et al. | Epidemiological investigations and multilocus sequence typing of Mycoplasma synoviae isolates from chicken farms in China | |
| JP5727255B2 (en) | Rapid and simple discrimination method of Salmonella serotype by multiplex PCR and its primer set | |
| CN113151516B (en) | Human high-risk zoonotic streptococcus suis specific sequence, detection primer and application | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN108315402B (en) | Amplification primer pair for sequencing bifidobacterium in intestinal tract and sequencing method | |
| CN114606328B (en) | Primer group, probe and kit for detecting campylobacter, application and detection method | |
| CN106636428B (en) | PCR method for rapidly detecting and identifying Serratia | |
| Hassan et al. | Detection and identification of Helicobacter pullorum in poultry species in upper Egypt | |
| CN113151309B (en) | Streptococcus suis specific sequence with high risk of human beings and livestock and application thereof | |
| CN105986029B (en) | Liquid chip method for identifying pig source food source bacteria | |
| CN111197095B (en) | Screening method of vaccine strain | |
| Ajayi et al. | Molecular Identification of Selected Multiple Antibiotic Resistance Bacteria Isolated from Poultry Droppings in Akure, Nigeria | |
| CN110714089B (en) | PCR primer of specific targeting flagellum hook gene flgE and application thereof in rapid detection of flagella and flagellum-free salmonella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |