KR20090011428A - A composition that is comprising extracts, fractions or isolated single compounds of robinia pseudo-acacia var. umbraculifera - Google Patents

Abstract

A pharmaceutical composition for prevention of disease is provided to suppress tumor necrosis factor alpha(TNF alpha) and biosynthesis of matrix metalloproteinases and to show very excellent effect as skin aging and wrinkle improving. A pharmaceutical composition for prevention of disease selected from a group consisting of obesity, metabolic disease, cardiovascular disease and skin disease is controlled by peroxisome proliferator activation receptor action comprising Robinia pseudo-acacia var. umbraculifera extract extracted using water, alcohol or their mixture as solvent as active ingredient. The alcohol is C1 to C4 lower alcohol. PPAR is PPAR gamma or PPAR alpha.

Description

A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo-acacia var. umbraculifera}

The present invention is Robinia ( Robinia) pseudo - acacia var . umbraculifera ) Extract, fractions thereof, or a composition containing the compounds isolated from the fractions as an active ingredient, more specifically, the extract of Mindungsi , extracts thereof, or extracted with water, alcohol or a mixture thereof as a solvent, or Amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone, or a pharmaceutically acceptable salt thereof, the compound isolated from the fraction. It relates to a composition containing as an active ingredient.

Today, due to the improvement of living standards and changing lifestyles, diseases due to metabolic abnormalities such as hyperlipidemia, diabetes, obesity, etc. are increasing. These diseases have complex causes including genetic and nutritional factors. .

Peroxysome is one of the organelles that causes these metabolic disorders and has long been considered to play a minor role in cellular function, but many recent studies have shown that metabolism of oxygen, glucose, lipids, hormones It plays an important role in the back, and also has been reported to have a wide range of effects on the regulation of cell proliferation / differentiation, the regulation of inflammatory mediators. Through lipid metabolism and glucose metabolism, peroxysomes are known to play an important role in not only insulin sensitivity but also in cell membrane and adipocyte formation and in aging and tumorigenesis through effects on oxidative stress. ( Smith.KJ et.al., J Cutan Med Surg 5 (3): 231-43, 2001; smith. KJ et.al., J Cutan Med Surg 5 (4): 315-22, 2001).

Intensive research in this area over the last decade has produced evidence that nuclear hormone receptors, called peroxisome proliferator-activated receptors (PPARs), will be good targets for the pharmacological approach of these diseases. Let go. Peroxysome proliferator activated receptors (PPARs) are one of 48 nuclear receptors and regulate gene expression by ligand binding. One of the nuclear receptors, the farnesoid X receptor, binds bile acids and the liver X receptor binds to oxysterols, while the peroxysome proliferator activated receptors (PPARs) Various fatty acids act as endogenous ligands. Reference may be made to the publication (Michel Rivier, et.al., J. Invest . Dermatol 111, p . 1116-1121, 1998), which lists a number of bibliographic references relating to PPAR type receptors . Timothy M et. Al., Med . Chem ., Vol. 43, p. 527-550, 2000).

The peroxysome proliferator activating receptors (PPARs) identified to date are peroxysome proliferator activating receptor alpha (PPARα), peroxysome proliferator activating receptor beta (PPARβ / δ) and peroxysome proliferator activating receptor gamma ( PPARγ), and in each case, PPARα is mainly found in the blood vessel wall, liver, heart, muscle, kidney and brown adipose tissue. Fibrates such as fenofibrate, bezafibrate, ciprofibrate, and gemfibrozil are agonists of PPARα and prevent atherosclerosis in mice and humans. Or delay the onset of action, and has an anti-obesity effect through fatty acid promotion. They also play an important role in promoting keratinocyte differentiation / proliferation in the epidermis of the skin, promoting skin barrier formation through lipid metabolism, suppressing inflammation, and healing wounds. Suppression of erythema production has also been reported (Kippenberger S, et.al., JID 117 (6): 1430-6, 2001).

PPARδ, also known as PPARβ, is distributed in many tissues, especially in skin, brain and adipose tissue. It is involved in cholesterol transport, myelination, and wound healing, and acts as an important regulator of fatty acid metabolism and energy homeostasis (Kyomin et al., 19 (3): 250, 2004). .

PPARγ is most common in adipose tissue and is found in vascular endothelium, macrophages, and pancreatic β-cells. It is less common in tissues where PPARα is found, such as liver, heart, and skeletal muscle. PPARγ is the most widely studied of the three subtypes. PPARγ plays a critical role in regulating the differentiation of fat cells, where it is expressed a lot, and in deciding on systemic lipid homeostasis. In particular, patent application WO 96/33724 describes selective compounds of PPARγ, such as prostaglandin J2 or D2, as potential activators for the treatment of obesity and diabetes. In patent application FR 98/02894, the use of PPARγ activator compounds in the preparation of pharmaceutical compositions intended to treat skin disorders associated with epidermal cell differentiation abnormalities is described. Compounds that activate PPARγ activity in whole or in part inhibit adipocyte differentiation and constitute an effective treatment for obesity. Moreover, partially activated compounds are effective in treating hyperglycemia as well as treating obesity. Thus, PPARγ total / partially activating compounds are effective in the treatment of obesity and other symptoms commonly occurring in non-insulin dependent diabetes mellitus such as elevated plasma levels of glucose, triglycerides and insulin (WO 01/30343, WO 02 / 08188, WO 2004/020408) (Berger et al., Trends Pharmacol. Sci . , Vol. 26, p. 244-51, 2005). In January 1997, thiazolidinediones was approved for the hypoglycemic treatment of type 2 diabetes in the United States, of which troglitazone was recovered from the market due to hepatotoxicity. Currently used PPARγ agonists are rosiglitazone and pioglitazone, which were approved in the United States in 1999.

Looking at the patents for PPARs mainly consists of patents for activating agents for PPARγ, patents for new substances and patents for the search method, diabetes obesity. Patents for new substances include substituted 4-hydroxy-phenylalkanoic acid derivatives having agonist activity against PPARγ (Korean Patent No. 474202), and novel compounds useful for the treatment of PPAR mediated diseases (Korean Patent No. 2005-0055790). ), Chiral oxazole-arylpropionic acid derivatives and their use as PPAR agonists (Korean Patent No. 2005-0055750), novel PPAR ligands that do not cause fluid retention, edema or congestive heart failure (Korean Patent No. 2005-0055701) N-substituted-1H-indole-5-propionic acid compounds (PLA) as novel PPAR agonists useful for treating diabetes, novel compounds that enhance the activity of PPARγ and PPARα, methods for preparing the same, and Pharmaceutical composition containing it (Korean Patent Publication No. 2005-0040746), benzoic acid derivative (Korean Patent Publication No. 2005-0014014) as a modulator of PPARγ and PPARα, oral antidiabetic (Republic of Korea Patent Publication No. 2004-0044515) and the like, the patent for the search method for obesity and diabetic regulators search method (Korea Patent No. 468046), peroxysome proliferation response element of βGK gene (Korea Patent Registration No. 4434948), a method for searching for disease-related regulators such as inflammation, cancer, and metabolic diseases using monoclonal antibodies against PPARα, specific antibody secreting fusion cell lines, and antibodies (Korean Patent Publication No. 2005-0027808). Roh contains a composition for the prevention or treatment of diseases mediated by PPARα containing mayylignan or a pharmaceutically acceptable salt thereof extracted from nutmeg (Korean Patent Publication No. 2007-0033938), catechin and camphorol components Sebum inhibitory cosmetic composition (Korean Patent Publication No. 2007-0028902), autoimmune disease caused by activation of PPARγ receptor and Alzheimer's disease Useful for the treatment of diseases, composition comprising rabdan diterpene extracted from cheonsimyeon (Korea Patent Publication No. 2007-0026398), a composition for preventing and treating diabetes comprising a camphor leaf extract or a fraction thereof as an active ingredient (Korea Patent Publication 2007-0019344), a composition comprising ginseng PPT as a PPARγ agonist (Korean Patent Publication No. 2006-0131012), a gourd and plant extract having anti-localization and anti-obesity activity or a purified product isolated therefrom. Patent Nos. 2005-0054009, 2005-0054006), Compositions and foods for improving lipid metabolism (Korean Patent Publication No. 2004-0084908), Treatment and prevention of symptoms related to heart insulin resistance (Korean Patent Publication No. 2003-0019434), of bone formation Control (Korean Patent Publication No. 0093808), benzoic acid derivatives for treating diabetes mellitus (Korean Patent Publication No. 2002-0087382), skin care composition (Korean Patent No. 2002-0047101), PPA delta inhibitor for cardiovascular disease (Korean Patent Publication No. 2002-0012323), Alzheimer's disease, composition and treatment method for the treatment of central nervous system damage and inflammatory diseases (Korean Patent Publication No. 2001-0101085), The use of PPAR-alpha and PPAR-gamma antagonists for the treatment of syndrome X (Korean Patent Laid-Open Publication No. 1999-0077099).

The bark is named Robinia pseudo - acacia var . umbraculifera is a legume plant and is a naturalized plant native to North America. It is distributed throughout Korea and grows in mountains and fields. The bark is about 25 m high and the bark is yellowish brown and split vertically. Small branches lack hair and thorns. The leaves are alternate and the pinnate leaves. 9 to 19 small leaves, elliptical or egg-shaped, 2.5-4.5 cm long. Both ends are round and flat, and petioles are 2-4 mm long. Flowers do not bloom, have no thorns, and water crowns are round. Breeding is done by folding, giving up, etc. (Doosan World Great White and Ensaber).

There are no patents using the bark, and the patent using the bark is natural tea (Korea Patent Publication No. 2004-0005848), which is effective in relieving hangovers and restoring liver function, food use of lectins derived from Acacia (European Patent 1009418), The ash tree (Korean Patent Laid-Open No. 2001-0063743) and the like used in other feed manufacturing are disclosed. Amorphastilbol described in this patent is known only for its antimicrobial effect (Mitscher, LA., Et.al., Phytochemistry, 27 (4): 1481-83, 1985), and also 5,7-dihydrate. The effects of 5,7-dihydroxy-6-geranyl flavanone on obesity / diabetes and skin aging have not been reported at all.

Therefore, the present inventors have reviewed the biological overview of these PPARs and the effects and mechanisms of PPARs, in particular obesity, diabetes, skin aging and moisturizing, and looking for ligands in the highland while searching for ligands The extract, its fractions, or some of the single components isolated from the fractions exhibited the activating effects of PPARα and PPARγ, which can be used as a preventive and therapeutic agent for obesity, diabetes, skin aging, skin wrinkles or skin moisturizing. The invention was completed.

A composition containing as an active ingredient extract of Min Dong-Agashi, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone, or a pharmaceutically acceptable salt thereof Is to provide a composition for preventing and treating diseases regulated by PPARγ or PPARα action by activating a Peroxysome Proliferator-Activated Receptor (PPAR).

In order to achieve the above object, the present invention is obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing as a active ingredient extracts Mindong baeksae extracted with water, alcohol or a mixture thereof as a solvent It provides a pharmaceutical composition for preventing and treating any one disease selected from the group consisting of.

In addition, the present invention is any one selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing the fraction extracted by additionally adding an organic solvent to the extract of Min Dong It provides a pharmaceutical composition for preventing and treating diseases.

In addition, the present invention contains the active fraction obtained as an active ingredient when the concentration of acetonitrile to water in silica gel column chromatography increases the concentration of acetonitrile from 60% to 100% by 80% in the step gradient. It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR.

In addition, the present invention is obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing an Amorphastilbol compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient It provides a pharmaceutical composition for preventing and treating any one disease selected from the group consisting of.

In addition, the present invention is a 5,7-dihydroxy-6-geranyl flavanone compound represented by the following formula (2) or a pharmaceutically acceptable salt thereof as an active ingredient It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the PPAR action.

In the above formula,

R _{1 ,} R ₂ And R ₃ is independently of each other H, OH or OCH ₃ .

In another aspect, the present invention provides a PPARγ agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranylflavanone as an active ingredient. do.

In another aspect, the present invention provides a PPARα agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone as an active ingredient. do.

In addition, the present invention is obesity is controlled by the action of PPAR containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone It provides a health food for preventing and improving any one disease selected from the group consisting of metabolic diseases, cardiovascular diseases and skin diseases.

In addition, the present invention is a skin that is controlled by the action of PPAR containing at least one selected from the group consisting of the extract of Min Dong, the fraction thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone It provides a skin external preparation for preventing and improving any one symptom selected from the group consisting of aging, low elasticity, wrinkles, dry skin and keratinization.

Amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, or a pharmaceutically acceptable salt thereof, which is a extract of the present invention, a fraction thereof, or a compound isolated from the fraction, activates PPAR Prevent and treat obesity and diabetes, inhibit tumor necrosis factor alpha (TNF α), inhibit the biosynthesis of matrix metalloproteinase-1 (MMP-1) and improve skin aging and wrinkles It can be usefully used as a composition for preventing and treating the disease because it can exhibit a very excellent effect as a skin external preparation.

Hereinafter, the present invention will be described in detail.

Mindonggashi extract, a fraction thereof, or a compound separated from the fraction, which is an active ingredient of the present invention, is prepared by a separation and purification method comprising the following steps.

1) extracting the mindong aka as an extraction solvent;

2) filtering and concentrating the extract of step 1);

3) further extracting the concentrate of step 2) with an organic solvent;

4) obtaining the active fractions from the fractions of step 3) by column chromatography; And

5) obtaining the active compound from the active fraction of step 4) by HPLC method,

In the above production method, the steppe may be used without limitation, such as cultivated or commercially available, can be used all above the ground, roots, seeds of the tree.

In the above production method, the extraction solvent of step 1) is characterized in that the water, alcohol or a mixture thereof. As the alcohol, C ₁ to C ₄ lower alcohols are preferably used, and as lower alcohols, ethanol or methanol is preferably used. During the extraction, the solvent is preferably extracted by adding 5 to 15 times the amount of the extract, and it is more preferable to extract by adding 10 times, but not always limited thereto. After the solvent is added, reflux cooling is preferably performed, but the present invention is not limited thereto. The temperature of the solvent at the time of extraction is preferably 60 ~ 100 ℃, more preferably 80 ℃ but not limited thereto. In addition, the extraction time is preferably 2 to 4 hours, more preferably 3 hours is not limited thereto. In addition, the number of extraction is preferably 1 to 5 times, more preferably three times repeated extraction is not limited thereto. After extracting and filtering mindong aqua by the above method, the filtrate was concentrated and lyophilized to obtain an extract.

In the production method, hexane, dichloromethane, acetone, or acetonitrile may be used as the organic solvent of step 3), but after dichloromethane is added, the soluble layer is discarded and extracted with methanol, but not always limited thereto.

In the above method, the column chromatography of step 4) is separated by performing column chromatography using a filler selected from the group consisting of silica gel, Sephadex, RP-18, polyamide, Toyopearl and XAD resin. It can be purified. Column chromatography can be carried out several times by selecting the appropriate filler as required. In the embodiment of the present invention, the silica gel was used as the filler in the flash column chromatography, and the active fraction was obtained when the concentration of acetonitrile in water was increased from 60% to 100% by 80% in the step gradient. there was.

In the above preparation method, the acetonitrile concentration in water was increased by 10% from 10% to 100% in HPLC (Phenomenex Luna 10 μm ₁₈ column) in step 5) for 60 minutes. The active compound was obtained through the material separated in 26 components and the material separated in 29 components. As a result of confirming the structure of the material separated into the 26 and 29 components by nuclear magnetic resonance (NMR), the material separated into the 26 components is Amorphastilbol represented by Chemical Formula 1. The substance separated in 29 components was found to be 5,7-dihydroxy-6-geranyl flavanone represented by the formula (2).

The present invention is a mindonggashi extract prepared by the above production method, fractions thereof, or the compound separated from the fractions of ammol pastol or 5,7-dihydroxy-6-geranyl flavanone, or pharmaceutically thereof It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by PPAR action containing an acceptable salt as an active ingredient.

In another aspect, the present invention provides a PPARγ agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranylflavanone as an active ingredient. do.

In another aspect, the present invention provides a PPARα agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone as an active ingredient. do.

The metabolic disease controlled by the PPAR action is any one selected from the group consisting of diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, hypercholesterolemia, hypertriglyceridemia, metabolic syndrome (Syndrome X) and endothelial dysfunction It is characterized by.

The hypercholesterolemia is characterized in that any one selected from the group consisting of low HDL-cholesterolemia, high LDL-cholesterolemia, hypertriglyceridemia.

The cardiovascular disease regulated by the PPAR action is characterized in that any one selected from the group consisting of hypertension, precoagulant state, dyslipidemia and atherosclerosis disease.

The skin disease controlled by the PPAR action is characterized in that any one selected from the group consisting of skin barrier strengthening, atopic dermatitis, contact dermatitis and inflammatory diseases.

In the present invention, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, are involved in the activation of PPAR γ involved in fat and sugar metabolism. The effect was measured using a luciferase assay system. As a result, the degree of activation of PPAR γ was equal or better than when treated with a troglitazone positive control known as a PPAR γ agonist, and the higher the throughput, the higher the value (see Table 1 and FIG. 1). .

In addition, in the present invention, the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the adipocyte differentiation was examined. Glitazone drugs used to improve sugar or fat metabolism activate PPAR γ, a mechanism of nuclear receptor and transcription factor, which activates fat metabolism-related genes to promote the influx of sugar into fat cells and accumulate in fat. This will promote the differentiation of fat cells. The degree of differentiation was measured by culturing fat cells in a medium containing each test substance, and the fat accumulation effect was equal or better than that when treated with a troglitazone positive control known as a PPAR γ agonist. Therefore, it was found that amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone of the present invention is a very effective ingredient for improving fat metabolism by confirming that it promotes the differentiation of adipocytes (see FIG. 2). .

In addition, in the present invention, PPARγ and fat through RT-PCR to determine the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the expression of genes involved in PPARγ and adipocyte differentiation Cell-related genes C / ATCA (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), Adiponectin, Fatty acid synthase (Fass), Glucose transporter 4 , GLUT4) and resistin (Resistin), the expression level was confirmed that the expression increased as much as treated with a troglitazone positive control known as PPAR γ agonist (see Figure 3). Therefore, it can be seen that amorphastyl ball or 5,7-dihydroxy-6-geranylflavanone of the present invention functions as a PPAR γ agonist and is an effective ingredient for improving fat metabolism.

In addition, in the present invention, the effect of alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone on the activation of PPAR α is lucifera. Measurements were made using a luciferase assay system. As a result, the degree of activation of PPAR α was equal or better than that of the Wy-14,643 positive control group, which is a well-known PPARα agonist, and it was confirmed that the higher the throughput, the higher the value (Table 2 and FIG. 4). Accordingly, it can be seen that the extract of Mindung-Ashok of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can function as a PPAR agonist. have.

In addition, in the present invention, in order to determine the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the expression of genes involved in PPARα and fatty acid oxidation, PPARα and fatty acid oxidation through RT-PCR As a result of examining the expression levels of the related genes CPT1α (Carnitine Palmitoyl Transferase I alpha) and ACO2 (Acyl-CoA Oxidase 2), it was confirmed that the expression increased as much as Wy-14,643, which is known to be an agonist of PPAR α (FIG. 3). Therefore, it can be seen that amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone of the present invention functions as a PPARα agonist and is an effective ingredient for fatty acid oxidation.

In addition, in the present invention, agglutinin extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, a tumor necrosis factor alpha (TNF α) In order to examine the effect of inhibiting the biosynthesis of the human keratinocytes were irradiated with ultraviolet rays and cultured in a medium containing each test substance was measured by ELISA method. As a result, the amount of biosynthesis of TNF α was synthesized less than that of the negative control without any substance, and the same amount or higher than that of the positive control Wy-14,643 was synthesized. It was confirmed that the higher the amount of biosynthesis of TNF α was smaller (see Table 3). Thus, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can inhibit the biosynthesis of TNF α. Able to know.

In addition, in the present invention, to investigate the relationship between the tumor necrosis factor alpha (TNF α) and the amount of biosynthesis of metalloproteases-1 (MMP-1), a type I collagenase by ultraviolet light After irradiating with UV light, the medium was cultured in a medium containing each test substance, and then treated with TNF α antibody and TNF α, respectively, and measured by ELISA. As a result, the amount of biosynthesis of MMP-1 decreased when the TNF α antibody was treated and increased when the TNF α was treated, indicating a correlation with each other (see Table 4 and Table 5). Therefore, the extract of Mindonggashi (Pacaceae), the fractions thereof, or the compound isolated from the fractions of the present invention, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, reduce the biosynthesis of TNF α and thus eventually form I-cola. It was found that the biosynthesis of the genease can be reduced.

The biggest mechanism of wrinkle formation and loss of elasticity is the reduction of collagen, which is a substrate material due to the increased biosynthesis of MMP-1. Reducing the biosynthesis of TNF α by ultraviolet rays reduces the biosynthesis of MMP-1, which can effectively prevent and improve skin inflammation, reduction of skin matrix material, decreased elasticity and wrinkle formation (Obayashi K, et.al., J Cosmet Sci . 56 (1): 17-27. 2005). Therefore, the extract of Mindonggashashi, the fractions thereof, or the compound isolated from the fractions of the present invention, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, reduce skin inflammation, decrease skin matrix material, and decrease elasticity. Or it may be usefully used as a composition for preventing and improving wrinkle formation.

In addition, in the present invention, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are used for expression of genes related to skin moisturization and hydration. The impact was examined. Filaggrin and Involucrin related to skin moisturizing and hydration are described in Application No. 10-2000-7010163 (International Application No. PCT / US1999 / 05413). Each test substance was incubated in human keratinocytes and cultured, and then the degree of biosynthesis of filaggrin and Involucrin was examined using Western Blot. As a result, it was confirmed that the expression level of the gene could be increased when the test material was treated as compared to the negative control without any material (see Table 6). Therefore, it can be seen that the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can enhance skin moisturization and hydration. Can be.

 In the present invention, the pharmaceutically acceptable salt is an addition salt formed by free acid. Suitable free acids may be organic and inorganic acids, inorganic acids may be hydrochloric acid, bromic acid, sulfuric acid and phosphoric acid, and organic acids may be citric acid, acetic acid, lactic acid, tartariac acid, maleic acid, Fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, galluxuronic acid, embonic acid, glutamic acid or aspartic acid Etc. can be used. Furthermore, the extract of Mindong Acacia according to the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, is not only a pharmaceutically acceptable salt, All salts, hydrates, and solvates that can be prepared by conventional methods can be included.

The pharmaceutical composition for preventing and treating diseases regulated by the action of PPARγ and / or PPARα of the present invention may be Amolpastilball or 5,7-dihydroxy- It may optionally contain one or more in 6-geranyl flavanone, and may further contain one or more active ingredients exhibiting the same or similar functions in addition to the above components.

Amorphastilball or 5,7-dihydroxy-6-geranylflavanone, which is a compound of the present invention, the extract of the wild locust, fractions thereof, or a compound isolated from the fractions can be administered orally or parenterally during clinical administration. It can be used in the form of a general pharmaceutical formulation. That is, the pharmaceutical composition for preventing and treating diseases regulated by the PPARγ and / or PPARα action of the present invention may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, commonly used fillers. And diluents or excipients such as extenders, binders, wetting agents, disintegrating agents and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules and capsules, and the like, which may be used in the pharmaceutical composition of the present invention at least one excipient such as starch, calcium carbonate, sucrose, lactose And gelatin etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups, and may include various excipients such as wetting agents, sweeteners, fragrances and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol and gelatin may be used. The pharmaceutical composition for preventing and treating diseases regulated by the PPARγ and / or PPARα action of the present invention may be via subcutaneous injection, intravenous injection or intramuscular injection during parenteral administration.

As a result of toxicity experiments conducted by oral administration of the pharmaceutical composition of the present invention to rats, the 50% lethal dose (LD ₅₀ ) by oral administration toxicity test is judged to be a safe substance of at least 5 g / kg or more, and the individual dosage is applicable to the disease. It can vary from the doctor's prescription for. The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, hormone therapy, chemotherapy and biological response modifiers for the prevention and treatment of diseases regulated by PPARγ and / or PPARα action.

      In addition, the present invention is an active ingredient to the mindonggashi extract, fractions thereof, or a compound separated from the fractions prepared by the above production method, amorphastilball or 5,7-dihydroxy-6-geranylflavanone Provided is a health food for preventing and ameliorating any one disease selected from the group consisting of diabetes, obesity, metabolic disease, cardiovascular disease and skin disease, which are controlled by the PPAR action.

      The extract of Mindonggashokja of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone, may be added as it is or may be used with other food or food ingredients. It can be used suitably according to a conventional method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment). Generally, in the preparation of food or beverages, the pharmaceutical compositions of the present invention are added in an amount of up to 15 parts by weight, preferably up to 10 parts by weight based on the raw materials. However, in the case of long-term intake for health and hygiene or health control purposes, the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety.

There is no particular limitation on the kind of food. Examples of the food to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, Alcoholic beverages and vitamin complexes, and the like and include all of the health foods in the conventional sense.

The health beverage composition of the present invention may contain various flavors, natural carbohydrates, and the like as additional components, as in general beverages. The above-mentioned natural carbohydrates are glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used.

In addition to the extract of the present invention, Min Dong-Agashi extract, fractions thereof, or a compound separated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone, various nutrients, vitamins, electrolytes, flavors, Colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. In addition, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone may be used as a natural fruit juice, fruit juice beverage or vegetable beverage. It may contain pulp for manufacture. These components can be used independently or in combination. The proportion of such additives is not critical but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention is an active ingredient to the mindonggashi extract prepared by the above method, fractions thereof, or the compound separated from the fractions, amorphastilball or 5,7-dihydroxy-6-geranylflavanone Provided is a skin external preparation for preventing and ameliorating any one disease selected from the group consisting of skin aging, low elasticity, wrinkles, skin drying and keratinogenesis controlled by the PPAR action.

In addition to the essential ingredients, the skin external preparations are commonly used in skin external preparations such as cosmetics and pharmaceuticals, such as aqueous components, oily ingredients, powder components, alcohols, humectants, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, and surfactants. , Fragrances, colorants, and various skin nutrients can be appropriately blended as needed.

In addition, hydrothermal decay of metals such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, gluconic acid, caffeine, tannin, bellafamil, licorice extract, glablidine, and caline Extracts, various herbal medicines, tocopherol acetate, glytilinic acid, tranexamic acid and derivatives thereof or salts thereof, vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, trehalose, etc. Sugars etc. can also be mix | blended suitably.

The external skin preparation may be a cream, gel, ointment, skin emulsion, skin suspension, transdermal patch, drug-containing bandage.

The external skin preparation may be prepared by using conventional carriers, excipients, binders, disintegrants, solubilizers, suspending agents, preservatives or extenders, etc., which are pharmaceutically acceptable at the time of clinical administration. In the external application for skin, the effective dose of the composition of the present invention is 0.01 to 300 mg / cm ² , preferably 10 to 50 mg / cm ² , may be administered 1 to 4 times a day. However, the dosage level for a particular patient may vary depending on the weight, age, sex, health status, diet, time of administration, administration method, excretion rate, severity of the disease, and the like of the patient.

Hereinafter, the present invention will be described in detail by Examples, Experimental Examples and Formulation Examples.

However, the following Examples, Experimental Examples, and Formulation Examples specifically illustrate the present invention, and the content of the present invention is not limited to Examples, Experimental Examples, and Formulation Examples.

< Example  1> Min Dong  Preparation of Ground Extract

Mindong bark tree used in the present invention was used that is native to Daegwallyeong highland, and was used by dividing the ground portion, root, seed portion.

<1-1> Min Dong  Preparation of Methanol Extracts from Above Ground

100 g of the leaves of the leaves of twigs, including the stems and stems, were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.5 g of concentrate.

<1-2> Min Dong  Above ground  water  Preparation of Extract

100 g of the leaves of twigs of M. locust, including leaves, twigs and stems, were immersed in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.5 g of concentrate.

<1-3> Min Dong  Preparation of Ethanol Extracts from Above Ground

100 g of the ground ash tree was dipped in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.5 g of concentrate.

< Example  2> Min Dong  Preparation of Root Extract

<2-1> Min Dong  Preparation of Methanol Extracts of Roots

100 g of bark roots were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 11.2 g of concentrate.

<2-2> Min Dong  Root  water  Preparation of Extract

100 g of the barberry roots were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.3 g of concentrate.

<2-3> Min Dong  Preparation of Ethanol Extract of Roots

100 g of bark roots were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.0 g of concentrate.

< Example  3> Min Dong  Preparation of Seed Extract

<3-1> Min Dong  Preparation of Methanol Extracts of Seeds

100 g of ripe bark seeds were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 14.7 g of concentrate.

<3-2> Min Dong  Seed  water  Preparation of Extract

100 g of ripe bark seeds were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.7 g of concentrate.

<3-3> Min Dong  Preparation of Ethanol Extracts of Seeds

100 g of ripe bark seeds were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.7 g of concentrate.

< Example  4> Min Dong  From extract Fraction  Produce

<4-1> Fraction  Produce

After extracting the extract of Example 3-1 under reflux with dichloromethane twice, the dichloromethane soluble layer was discarded, and the extract obtained by refluxing twice with methanol was dried under reduced pressure and concentrated to give 11 g of a fraction.

<4-2> active Fraction  Produce

7 g of the fraction was adsorbed with 7 g of silicon dioxide to perform flash column chromatography (manufacture). The flash column chromatography used Lichroprep RP-18 (40-63 μm, MERCK, USA) as a filler, the sample is loaded by adsorption on celite (Diatomaceous earth, approx. 95%, Sigma, USA) It was. Each fraction was obtained by gravitational flow rate in a gradient of 10% up to 100% with acetonitrile concentration of 60% in water as an initial solvent. The activity of the fraction was excellent when the concentration gradient of 80% in the fraction of each condition.

< Example  5> Amorphous steel ball  detach

Fractions obtained at the acetonitrile concentration gradient 80% were analyzed by HPLC (analytic HPLC, Waters 2996 Photodiode Array Detector, UV 210 nm). Phenomenex Luna 10 μm C ₁₈ column with acetonitrile concentration of 10% to 100% concentration in water, prepared at 60 ml for 60 minutes at an average flow rate of 1 ml per minute. The resulting compound was obtained (see FIG. 6).

Results confirmed the structure the compound NMR ⁽¹ H and 13C-NMR, Varian 500MHz spectrometer, Varian USA) compound is separated out on the component 26 has been confirmed that amorphastilbol Oh steel ball (Amorphastilbol).

< Example  6> 5,7- Dihydroxy -6- Geranil Flavanese  detach

Fractions obtained at the acetonitrile concentration gradient 80% were analyzed by HPLC (analytic HPLC, Waters 2996 Photodiode Array Detector, UV 210 nm). Phenomenex Luna 10 μm C ₁₈ column with acetonitrile concentration of 10% to 100% concentration in water at 1 ml / min for 60 minutes The resulting compound was obtained (see FIG. 6).

The compound was identified by NMR ( ¹ H and 13 C-NMR, Varian 500 MHz spectrometer, Varian USA). As a result, the compound separated into 29 components was 5,7-dihydroxy-6-geranylflavanone (5, 7-Dihydroxy-6-geranyl flavanone) was confirmed.

< Experimental Example  1> Engaged in local and party metabolism PPAR γ ( Peroxisome Proliferator Activated  Receptor gamma Activation experiment

Plasmids have a PPARγ gene after a universal promoter, which is expressed even in normal culture conditions, and PPRE (PPARs Response Element), which is activated by binding of ligand-binding PPARγ, as a promoter. A plasmid (pRL-SV40, Promega, USA) with a firefly luciferase gene and a Renilla luciferase gene bound to a universal promoter to be used as a reference were used. KLIEWER SA., Proc . Nadl . Acad . Sci . USA, 91: 7355-7359, 1994).

CV-1 cells (CCL-70, ATCC) were placed on a 24-well plate at a concentration of 5 × 10 ⁴ and cultured for 24 hours, followed by transient transfection of the three plasmid genes. After incubation for 24 hours and washed with 1 x Phosphate Buffered Saline (PBS). The following candidates were treated by concentration for 24 hours, washed with 1 x PBS, and then cells were crushed with 1 x Passive Lysis Buffer (PLB), followed by a dual-luciferase receptor assay system kit (dual-Luciferase). ^R The luciferase activity of the samples and the reference was measured using the Reporter Assay System kit (Promega, USA). In this experiment, the control group used troglitazone, which is known as one of the ligands of PPARγ, and the control group was treated as the untreated group. A comparison was shown with the activation degree of the negative control group being 100.

Min Dong  Extract, its Fraction , Or above In fractions  Of isolated compounds PPAR degree of activation for γ sample density Activation degree No treatment group 100 Troglitazone 10 uM 420 Example <1-1> 100 ug / ml 375 30 ug / ml 320 10 ug / ml 221 3 ug / ml 155 1 ug / ml 107 Example <2-1> 100 ug / ml 370 30 ug / ml 316 10 ug / ml 218 3 ug / ml 153 1 ug / ml 106 Example <3-1> 100 ug / ml 445 30 ug / ml 380 10 ug / ml 262 3 ug / ml 184 1 ug / ml 127 Example <3-2> 100 ug / ml 400 30 ug / ml 330 10 ug / ml 202 3 ug / ml 154 1 ug / ml 127 Example <4-1> 100 ug / ml 450 30 ug / ml 385 10 ug / ml 302 3 ug / ml 224 1 ug / ml 176 Example <4-2> 30 uM 405 10 uM 279 3 uM 196  Example 5 30 uM 425 10 uM 249 3 uM 172  Example 6 30 uM 250 10 uM 198 3 uM 163

As a result, as shown in Table 1 and FIG. 1, the extract of Mindung-Ashok, fractions thereof, or a compound separated from the fractions, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, were treated with the substances. When compared to the control group did not control the PPAR γ showed a higher activation level, the higher the throughput was confirmed that the higher the value. Therefore, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound isolated from the fraction is Since it showed a tendency to activate PPAR γ, it can be seen that it is an excellent component that serves to improve fat and sugar metabolism.

< Experimental Example  2> Adipocyte Differentiation Experiment

3T3L1 cells (CL-173, ATCC), which are mouse preadipocytes, were spread on a 6-well plate at a concentration of 3 X 10 ⁵ per well, and after 48 hours, the final concentration was 1 uM of dexamethasone. It was exchanged with differentiation media containing 10 ug / ml insulin and 500 uM of isobutylmethylxantine (IBMX). At this time, the differentiation group was only differentiated, and the positive control group was treated simultaneously with the concentration of troglitazone (troglitazone) and the compound at 10 uM. After 48 hours, the cells were replaced with a medium containing 10 ug / ml of insulin and a positive control group and the samples used in the experiment. After that, the medium was changed every 48 hours, and the progress of differentiation was checked. After the differentiation progressed, the progress was confirmed by oil red O (Oil red O) staining. The oil red O staining was performed to wash the differentiated cells twice with phosphate buffered saline (PBS) at 37 ℃ and fixed for 30 minutes at room temperature with 3.7% formalin (in PBS). Thereafter, formalin was removed and the fixed cells were washed twice with PBS and once with 70% ethanol, and then used with oil red O (0.5% in isopropanol and diluted with stock: DDW = 6: 4 whenever used). ) And dyeing at room temperature for 30 minutes and then observed the degree of staining using a microscope.

As a result, as shown in Figure 2, each group treated with amorphastilball and 5,7-dihydroxy-6-geranyl flavanone showed the fat accumulation effect as treated with troglitazone (fat metabolism) It was found to be a very effective ingredient for improvement (see FIG. 2).

< Experimental Example  3> PPAR γ and expression of genes involved in adipocyte differentiation

3T3L1 cells, which are mouse preadipocytes, were plated at 5 x 10 ⁵ in 60 pie dishes, and after 48 hours the final concentration was 1 uM of dexamethasone, 10 ug / ml of insulin, and IBMX. Exchange was carried out with differentiation media containing 500 uM. At this time, the differentiation group was a group that differentiated only, the positive control group was treated with 10 uM of troglitazone (troglitazone) and the remainder was simultaneously treated with 10 uM of amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone. . After 48 hours, the cells were replaced with a medium containing 10 ug / ml of insulin and a positive control group and the samples used in the experiment. Thereafter, the medium was changed every 48 hours, and the progress of differentiation was checked. After differentiation progressed, total RNA was extracted using trizol, and the expression level of adipocyte differentiation-related genes was confirmed by RT-PCR. Reverse transcription in the RT-PCR was performed using a commercially available kit (reverse transcription system, Promega), PCR denatured (denaturation) 94 ℃, 1 minute, annealing (54 ℃), One minute, extension was performed at 72 ° C., one minute for a total of 30 cycles. Primers used for PCR are as follows.

PPAR γ

Forward 5 'ttcgctgatgcactgcctat 3' (SEQ ID NO: 1)

Reverse 5 'gccaacagcttctccttctc 3' (SEQ ID NO: 2)

C / EBP α

Forward 5 'aggtgctggagttgaccagt 3' (SEQ ID NO: 3)

Reverse 5 'cagcctagagatccagcgac 3' (SEQ ID NO: 4)

Ap2

Forward 5 'atgtgtgatgcctttgtggga 3' (SEQ ID NO: 5)

Reverse 5 'tgccctttcataaactcttgt 3' (SEQ ID NO: 6)

Adiponectin

Forward 5 'agcctggagaagccgcttat 3' (SEQ ID NO: 7)

Reverse 5 'ttgcagtagaacttgccagtgc 3' (SEQ ID NO: 8)

Fas

Forward 5 'ctgcgtggctatgattatggc 3' (SEQ ID NO: 9)

Reverse 5 'cgtgaggttgctgtcgtctgt 3' (SEQ ID NO: 10)

GLUT4

Forward 5 'tcgtcattggcattctggtt 3' (SEQ ID NO: 11)

Reverse 5 'ggtcatcaagatggcacagc 3' (SEQ ID NO: 12)

Resistin

Forward 5 'tcaactccctgtttccaaatgc 3' (SEQ ID NO: 13)

Reverse 5 'tcttcacgaatgtcccacga 3' (SEQ ID NO: 14)

GAPDH

Forward 5 'accacagtccatgccatcac 3' (SEQ ID NO: 15)

Reverse 5 'tccaccaccctgttgctgta 3' (SEQ ID NO: 16)

As a result, as shown in Figure 3 PPARγ and its related genes C / EBPα (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), Adiponectin, Fatty acid synthase (Fass) , Glucose transporter 4 (GLUT4), Resistin (Resistin) is a troglitazone (Troglitazone) used as a positive control in each group treated with amorphastilball and 5,7-dihydroxy-6-geranylflavanone By confirming the increase by), it can be seen that it is involved in sugar and fat metabolism.

< Experimental Example  4> Skin cells  Promotes differentiation / proliferation, promotes lipid biosynthesis and plays a role in anti-inflammatory PPAR α ( Peroxisome Proliferator Activated Receptor alpha Activation test

Plasmid used PPARα instead of PPARγ and the same one used in Experimental Example 1 above was used.

CV-1 cells were placed on 24-well plates at a concentration of 5 × 10 ⁴ , and then cultured for 24 hours, followed by transient transfection of the three kinds of plasmid genes. After 24 hours of incubation, 1 x phosphate buffered saline (Phosphate Buffered Saline, PBS), washed with the material of the present invention for 24 hours after incubation with 1xPBS after washing for 24 hours after breaking the cells with 1xPLB dual-luciferase receptor The luciferase activity of the samples and references was measured according to user instructions using an assay system kit (Dual-Luciferase ^® Reporter Assay System kit, Promega, USA). In this experiment, the positive control group used Wy-14,643 (Sigma, USA), which is known to be the strongest of PPARα ligands, and the negative control group was untreated.

Mindung Asshole Extract  And ingredients PPAR degree of activation for α sample density Activation degree No treatment group 100 Wy-14,643 10 uM 771 Example <1-1> 100 ug / ml 392 30 ug / ml 196 10 ug / ml 114 3 ug / ml 108 1 ug / ml 104 Example <2-1> 100 ug / ml 355 30 ug / ml 178 10 ug / ml 103 3 ug / ml 102 1 ug / ml 101 Example <3-1> 100 ug / ml 733 30 ug / ml 366 10 ug / ml 212 3 ug / ml 184 1 ug / ml 143 Example <3-2> 100 ug / ml 533 30 ug / ml 306 10 ug / ml 182 3 ug / ml 134 1 ug / ml 113 Example <4-1> 100 ug / ml 743 30 ug / ml 406 10 ug / ml 282 3 ug / ml 204 1 ug / ml 173 Example <4-2> 30 uM 555 10 uM 404 3 uM 202  Example 5 30 uM 650 10 uM 482 3 uM 253 Example 6 30 uM 583 10 uM 354 3 uM 189

As a result, as shown in Table 2 and FIG. 4, the extract of Mindung-Ashok, fractions thereof, or a compound separated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, were treated with the substances. Compared with the control group, the PPAR α activation level was higher than that of the control group, and the higher the throughput, the higher the level.

< Experimental Example  5> PPAR Expression of genes involved in α and fatty acid oxidation

HepG2 cells (HB-8065, ATCC, USA), a human hepatocellular carcinoma cell line, were placed in 60 pie dishes at a concentration of 1 X 10 ⁶ , and after 24 hours, the positive control group Wy-14,643, Amorphastylball and 5,7-dihydroxy-6-geranylflavanone were treated respectively. After 24 hours, total RNA was extracted using trizol, and the expression level of fatty acid oxidation related genes was confirmed by RT-PCR. Reverse transcription in the RT-PCR was performed using a commercially available kit (reverse transcription system, Promega), PCR denatured (denaturation) 94 ℃, 1 minute, annealing (54 ℃), One minute, extension was performed at 72 ° C., one minute for a total of 30 cycles. Primers used for PCR are as follows.

PPAR α

Forward 5 'acggaaagcccactctgccccctctc 3' (SEQ ID NO: 17)

Reverse 5 'cttgtccccgcagattctacattcg 3' (SEQ ID NO: 18)

CPT1 α

Forward 5 'agacggtggaacagaggctgaag 3' (SEQ ID NO: 19)

Reverse 5 'tgagaccaaacaaagtgatgatgtcag 3' (SEQ ID NO: 20)

ACO2

Forward 5 'gcggacatggctactcaaagc 3' (SEQ ID NO: 21)

Reverse 5 'gcagtgcaccttagcagcctg 3' (SEQ ID NO: 22)

GAPDH

Forward 5 'accacagtccatgccatcac 3' (SEQ ID NO: 23)

Reverse 5 'tccaccaccctgttgctgta 3' (SEQ ID NO: 24)

As a result, as shown in FIG. 5, PPARα and its related genes, CPT1α (Carnitine Palmitoyl Transferase I alpha) and ACO2 (Acyl-CoA Oxidase 2), are amorphastyl ball and 5,7-dihydroxy-6-geranyl flap. Each group treated with banone increased as much as the group treated with Wy-14643 used as a positive control group, indicating that it was involved in fatty acid oxidation.

< Experimental Example  6> Tumor necrosis factor alpha (UV) TNF  Determination of Biosynthesis Inhibitory Effect of α)

Human keratinocytes directly isolated from neonatal foreskin were incubated in a 12-hole plate incubator at 10 ⁵ concentrations, irradiated with UV B at 30 mJ / cm ² , and each test substance contained 10 uM and 10 ppm for extract. Replaced with medium. After 6 to 24 hours of culture, the cells were harvested and the amount of tumor necrosis factor alpha (TNF α) generated was quantified using ELISA (Pharmingen 555212) method. The value is shown in Table 3 comparing the UV control to 100.

Min Dong  UV rays of extracts and ingredients TNF  inhibitory effect of α biosynthesis sample density TNF  α biosynthesis (%) No treatment group 100 Wy-14,643 10 uM 30 Example <1-1> 100 ug / ml 35 30 ug / ml 48 10 ug / ml 63 3 ug / ml 75 1 ug / ml 88 Example <2-1> 100 ug / ml 50 30 ug / ml 68 10 ug / ml 82 3 ug / ml 92 1 ug / ml 98 Example <3-1> 100 ug / ml 5 30 ug / ml 20 10 ug / ml 35 3 ug / ml 48 1 ug / ml 58 Example <3-2> 100 ug / ml 30 30 ug / ml 42 10 ug / ml 58 3 ug / ml 70 1 ug / ml 81 Example <4-1> 100 ug / ml 5 30 ug / ml 24 10 ug / ml 35 3 ug / ml 45 1 ug / ml 50 Example <4-2> 30 uM 5 10 uM 24 3 uM 40 Example 5 30 uM 5 10 uM 28 3 uM 43 Example 6 30 uM 15 10 uM 34 3 uM 61

As a result, as shown in Table 3, alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are tumor necrosis factor alpha. It can be seen that the biosynthesis of.

< Experimental Example  7> Type I by UV Collagenase Metalloproteinases -1 (Metalloelastase-1, MMP -1) biosynthesis inhibition efficacy measurement

<7-1> TNF  α and MMP -1 relationship measurement

Human fibroblasts, primary cells directly isolated from neonatal foreskin, were cultured in a 48-hole plate incubator at 10 ⁴ concentrations, and after 24 hours of irradiation with UV A at 15 J / cm ² , the tumor necrosis factor alpha Antibody against was added at a concentration of 1 ug / ml. The supernatant was harvested on day 2 of culture and the amount of type I collagenase produced was quantified using ELISA (AP biotech RPN2610) method. The value was shown by the comparison value which made the control group which did not carry out 100.

TNF  Antibodies to α and Type I Collagenase Biosynthesis  relation Test group Type I collagenase biosynthesis (%) Antibody Untreated Group TNF α antibody treatment group Ultraviolet A irradiation group 210 134 TNF α-treated group 250 - Control 100 100

As a result, as shown in Table 4, it was confirmed that the biosynthesis of type I collagenase increased by treatment with UVA and inflammatory mediator TNF α, and the increase of type I collagenase by UV light is due to the antibody against TNF α. It can be seen that the decrease in processing. In other words, it was found that TNF α, which is an inflammation mediator, increased due to ultraviolet rays A, thereby increasing type I collagenase and decreasing type I collagenase biosynthesis upon blocking of intermediate mediators. The treatment of neonatal fibroblasts with PPARα activator, the test substance below, reduced the biosynthesis of type I collagenase, which was restored to normal after treatment with inflammatory mediator TNFα.

<7-2> each test substance TNF  relationship of α

Human fibroblasts, primary cells directly isolated from neonatal foreskin, were incubated in a 48-hole plate incubator at 10 ⁴ concentrations, irradiated with UV A at 15 J / cm ² after 24 hours, and then tested. After changing to a medium containing 10 uM or 10 ppm each TNF α 10 ng / ml was added. The supernatant was harvested on day 2 of culture and the amount of type I collagenase produced was quantified using ELISA (AP biotech RPN2610) method. The value showed the comparison value which made the ultraviolet irradiation group 100.

TNF  α and type I Collagenase Biosynthesis  relation Example Type I collagenase biosynthesis (%) Ultraviolet A irradiation group TNF α-treated group <1-1> (10 mg / ml) 42 88 <2-1> (10 mg / ml) 48 86 <3-1> (10 mg / ml) 35 87 <3-2> (10 mg / ml) 45 86 <4-1> (10 uM) 38 89 5 (10 uM) 45 86

As a result, as shown in Tables 4 and 5, alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, was typed by ultraviolet rays. It was found that reducing the biosynthesis of I collagenase, which may activate PPARα may affect the reduction of biosynthesis of inflammatory mediators.

< Experimental Example  8> Expression of genes related to skin moisturizing and hydration

Human keratinocytes directly isolated from neonatal foreskin were incubated in 100 pie dishes at 10 ⁶ concentrations, and each test substance was replaced with a medium containing 10 uM and extracts of 10 ug / ml. After 24 hours of culture, cells were harvested to obtain protein, and the amount of protein was quantified using a BCA kit (Pierce Biotechnology, USA). Western Blot method was used to quantify the amount of filaggrin and Involucrin produced. The western blot was electrophoresed by loading 30 ug of protein per lane on an SDS-PAGE gel, followed by PVDF membrane (Amersham) using a protein transfer kit (Invitrogen, USA). , USA). After transfer, the antibody against pilarcrine and involukrin (Santacruz Biotechnology, USA) were attached at 37 ° C. for about 1 hour, washed three times with PBS, and the HRP-attached secondary antibody at 37 ° C. was used as the primary antibody. After attaching for about 3 hours, washing with PBS three times, the degree of luminescence was exposed to the film using the ECL kit, and the intensity of the band was quantified using a densitometer. The value was compared with the ultraviolet control group 100.

Mindung Asshole Extract , Objection Fraction , Or above In fractions  Moisturizing Factor Biosynthesis Effect of Isolated Compounds sample density Filaggrin Synthesis (%) Involuclin Biosynthesis (%) No treatment group 100 100 Wy-14,643 10 uM 230 225 Example <1-1> 10 ug / ml 235 221 Example <2-1> 10 ug / ml 180 186 Example <3-1> 10 ug / ml 280 276 Example <3-2> 10 ug / ml 240 230 Example <4-1> 10 uM 275 268 Example 5 10 uM 282 253 Example 6 10 uM 246 228

As a result, as shown in Table 6, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are naturally moisturized in keratinocytes. It was found that the skin moisturization can be enhanced by increasing the amount of biosynthesis of the filaggrin and involukrin factors.

< Experimental Example  9> Min Dong  Extract, its Fraction  And said In fractions  Acute Toxicity Test of Oral Administration of Isolated Compounds

The present inventors performed the following experiment to determine the acute toxicity of the extract of Min Dong, the fractions thereof and the compounds isolated from the fractions. Acute toxicity experiments were performed using 6 week-old SPF SD rats. The extract of Mindung-Ash, its fractions, and the compounds isolated from the fractions were each suspended orally administered in a 0.5% methylcellulose solution at a dose of 5 g / kg / 15 ml. Hematology and blood biochemical tests were performed by observing the mortality, clinical symptoms, and weight changes of the animals after the administration of the test substance.

As a result, no significant clinical symptoms or dead animals were noted in all animals treated with the test substance, and no toxic changes were observed in weight changes, blood tests, blood biochemistry tests, and autopsy findings.

As a result, the rats showed no toxicity change up to 5 g / kg, and the minimum lethal dose (LD ₅₀ ) for oral administration was found to be a safe substance of 5 g / kg or more.

Examples of preparations for the compositions of the present invention are illustrated below.

< Formulation example  1>: Preparation of pharmaceutical preparation

1. Preparation of powder

2 g extract of Example <1-3>

1 g lactose

The above ingredients were mixed and filled in airtight cloth to prepare a powder.

2. Preparation of Tablets

100 mg of extract of Example <1-3>

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

3. Preparation of Capsule

100 mg of extract of Example <2-3>

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.

4. Manufacture of rings

1 g extract of Example <2-3>

Lactose 1.5 g

1 g of glycerin

Xylitol 0.5 g

After mixing the above components, it was prepared to be 4 g per ring in a conventional manner.

5. Preparation of Granules

150 mg of extract of Example <2-3>

Soybean Extract 50mg

Glucose 200 mg

Starch 600 mg

After mixing the above components, 100 mg of 30% ethanol was added and dried at 60 ° C. to form granules, which were then filled into fabrics.

< Formulation example  2>: Manufacture of food

Food products containing the extract of Mindonggashashi of the present invention were prepared as follows.

1. Preparation of Cooking Seasonings

20 ~ 95 parts by weight of the extract of Example <1-2> of the present invention to prepare a cooking seasoning for health promotion.

2. Preparation of Tomato Ketchup and Sauce

0.2 ~ 1.0 parts by weight of the extract of Example <1-2> of the present invention was added to tomato ketchup or sauce to prepare tomato ketchup or sauce for health promotion.

3. Manufacturing of Flour Foods

0.5 to 5.0 parts by weight of the extract of Example <1-2> of the present invention was added to the flour, and bread, cake, cookies, crackers and noodles were prepared using the mixture to prepare foods for health promotion.

4. Preparation of soups and gravy

0.1 ~ 5.0 parts by weight of the extract of Example <2-2> of the present invention was added to soups and broth to prepare meat products for health promotion, soups and noodles of noodles.

5. Preparation of Ground Beef

10 parts by weight of the extract of Example <2-2> of the present invention was added to the ground beef to prepare a ground beef for health promotion.

6. Manufacture of Dairy Products

5 to 10 parts by weight of the extract of Example <2-2> of the present invention was added to milk, and various dairy products such as butter and ice cream were prepared using the milk.

7. Manufacture of wire

Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh.

Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh.

The extract of Example <1-2> of the present invention was concentrated under reduced pressure in a vacuum concentrator, and the dried product obtained by drying with a spray and a hot air dryer was pulverized with a particle size of 60 mesh to obtain a dry powder.

The dry powders of the grains, seeds and extracts of Example 3-3 prepared above were formulated in the following ratios.

Cereals (30 parts by weight brown rice, 15 parts by weight brittle, 20 parts by weight of barley),

Seeds (7 parts by weight perilla, 8 parts by weight black beans, 7 parts by weight black sesame seeds),

Dry powder (3 parts by weight) of the compound isolated from the extract of Example <3-2>,

Ganoderma lucidum (0.5 parts by weight),

Foxglove (0.5 part by weight)

< Formulation example  3>: Manufacture of beverage

1. Manufacture of health drinks

       1000 mg of extract of Example <3-2>

       Citric acid 1000 mg

       100 g oligosaccharides

       Plum concentrate 2 g

       1 g of taurine

       Add 900 ml of purified water

After mixing the above components according to the conventional healthy beverage manufacturing method, and stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and then refrigerated and stored Used to prepare the healthy beverage composition of the invention.

Although the composition ratio is a composition suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and intended use.

2. Preparation of Vegetable Juice

5 g of the extract of Example <3-2> of the present invention was added to 1,000 ml of tomato or carrot juice to prepare a vegetable juice for health promotion.

3. Preparation of Fruit Juice

1 g of the extract of Example <3-2> of the present invention was added to 1,000 ml of apple or grape juice to prepare a fruit juice for health promotion.

< Formulation example  4>: Manufacture of ointment

A topical preparation for skin containing the extract of Mindonggashi of the present invention, a fraction thereof and a compound active ingredient separated from the fraction can be prepared. The inventors have prepared a general ointment containing the extract of Mind.

Ointment Ingredients ingredient Content (% by weight) Caprine / Capryl Triglycerides 10.0 Liquid paraffin 10.0 Solbitan Sesquioleate 6.0 Octyldodeceth-25 9.0 3,7 hexanoate 10.0 Squalane 1.0 Salicylic acid 1.0 glycerin 15.0 Sorbitol 1.0 Extract of Example <3-3> 50

< Formulation example  5>: Manufacture of cosmetics

Functional cosmetics containing as an extract active ingredient of Mindonggashashi of the present invention, fractions thereof and compounds isolated from the fractions can be prepared. The inventors of the present invention are functional cosmetics containing amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone and cosmetics of emulsified formulations such as nutrient cosmetics, creams, essences, and solubilized formulations such as soft cosmetics. Prepared.

<5-1> Cosmetic Preparation of Emulsion Formulation

Cosmetics of emulsifier type were prepared with the composition shown in Table 8. The manufacturing method is as follows.

1) The mixture which mixed the raw materials of 1-9 was heated at 65-70 degreeC.

2) 10 was added to the mixture of step 1).

3) The mixture of the raw materials of 11-13 was heated at 65-70 degreeC, and was completely dissolved.

4) While passing through step 3), the mixture of 2) was slowly added and emulsified for 2 to 3 minutes at 8,000 rpm.

5) The raw material of 14 was dissolved in a small amount of water, and then added to the mixture of step 4) and emulsified for 2 minutes.

6) 15 to 17 of the raw materials were weighed, respectively, and added to the mixture of step 5) and emulsified for 30 seconds.

7) After emulsifying the mixture of step 6) through a degassing process to cool to 25 ~ 35 ℃ to prepare an emulsion-type cosmetics.

Composition of Emulsifying Formulations 1, 2, 3 Furtherance Emulsifier 1 Emulsifier 2 Emulsifier 3 One Stearic acid 0.3 0.3 0.3 2 Stealy alcohol 0.2 0.2 0.2 3 Glyceryl Monostearate 1.2 1.2 1.2 4 Beeswax 0.4 0.4 0.4 5 Polyoxyethylene sorbitan monolauric acid ester 2.2 2.2 2.2 6 Methyl paraoxybenzoate 0.1 0.1 0.1 7 Paraoxybenzoic Acid Profiles 0.05 0.05 0.05 8 Cetylethylhexanoate 5 5 5 9 Triglycerides 2 2 2 10 Cyclomethicone 3 3 3 11 Distilled water to 100 to 100 to 100 12 Concentrated glycerin 5 5 5 13 Triethanolamine 0.15 0.15 0.15 14 Polyacrylic acid polymer 0.12 0.12 0.12 15 Pigment 0.0001 0.0001 0.0001 16 incense 0.10 0.10 0.10 17 Compound of Example 5 0.0001 One 10

<5-2> Solubilization  Cosmetic preparation of the formulation

A cosmetic of solubilized formulation was prepared with the composition shown in Table 9. The manufacturing method is as follows.

1) Raw materials 2 to 6 were placed in raw material 1 (purified water) and dissolved using a still mixer.

2) The raw materials of 8-11 were put into the raw material of 7 (alcohol), and it melt | dissolved completely.

3) The mixture of step 2) was solubilized with slow addition to the mixture of step 1).

Solubilization  Composition of Formulations 1, 2, 3 Furtherance  Solubilized Formulation 1 Solubilized Formulation 2  Solubilized Formulation 3 One Purified water  to 100  to 100  to 100 2 Concentrated glycerin  3  3  3 3 1,3-butylene glycol  2  2  2 4 EDTA-2Na  0.01  0.01  0.01 5 Pigment  0.0001  0.0002  0.0002 6 Compound of Example 6  0.1 5 5 7 Alcohol (95%)  8 8 8 8 Methyl paraoxybenzoate  0.1  0.1  0.1 9 Polyoxyethylene Hydrogenate Ester  0.3  0.3  0.3 10 incense  0.15  0.15  0.15 11 Cyclomethicone   -   -  0.2

1 is a graph showing the degree of activation of PPARγ on the ground, root, seed, methanol extract of Mindungashok, compound Amorphastilball or 5,7-dihydroxy-6-geranylflavanone isolated from the fractions. ,

Figure 2 is a diagram showing the degree of differentiation of adipocytes of the compound, amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone,

3 is a diagram showing the results of confirming the expression level of the PPARγ-related genes of the compound Amorphastilball or 5,7-dihydroxy-6-geranyl flavanone by RT-PCR,

Figure 4 is a graph showing the degree of activation of PPARα of the ground portion, roots, methanol extract of the seed, amorphastilball or 5,7-dihydroxy-6-geranylflavanone which is a compound isolated from the fractions. ,

5 is a diagram showing the results of confirming the expression level of the PPARα-related genes of the compound Amorphastilball or 5,7-dihydroxy-6-geranyl flavanone by RT-PCR,

FIG. 6 is an HPLC chromatogram showing the compound Amorphastilbol and 5,7-dihydroxy-6-geranylflavanone.

<110> Korea Institute of Science and Technology <120> A composition that is comprising extracts, fractions and / or          isolated single compounds of Robinia pseudo-acacia var.          umbraculifera <130> 7p-06-37 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> PPAR gamma forward primer <400> 1 ttcgctgatg cactgcctat 20 <210> 2 <211> 20 <212> DNA <213> PPAR gamma reverse primer <400> 2 gccaacagct tctccttctc 20 <210> 3 <211> 20 <212> DNA <213> C / EBP alpha forward primer <400> 3 aggtgctgga gttgaccagt 20 <210> 4 <211> 20 <212> DNA <213> C / EBP alpha reverse primer <400> 4 cagcctagag atccagcgac 20 <210> 5 <211> 21 <212> DNA <213> Ap2 forward primer <400> 5 atgtgtgatg cctttgtggg a 21 <210> 6 <211> 21 <212> DNA <213> Ap2 reverse primer <400> 6 tgccctttca taaactcttg t 21 <210> 7 <211> 20 <212> DNA <213> Adiponectin forward primer <400> 7 agcctggaga agccgcttat 20 <210> 8 <211> 22 <212> DNA <213> Adiponectin reverse primer <400> 8 ttgcagtaga acttgccagt gc 22 <210> 9 <211> 21 <212> DNA <213> Fas forward primer <400> 9 ctgcgtggct atgattatgg c 21 <210> 10 <211> 21 <212> DNA <213> Fas reverse primer <400> 10 cgtgaggttg ctgtcgtctg t 21 <210> 11 <211> 20 <212> DNA <213> GLUT4 forward primer <400> 11 tcgtcattgg cattctggtt 20 <210> 12 <211> 20 <212> DNA <213> GLUT4 reverse primer <400> 12 ggtcatcaag atggcacagc 20 <210> 13 <211> 22 <212> DNA <213> Resistin forward primer <400> 13 tcaactccct gtttccaaat gc 22 <210> 14 <211> 20 <212> DNA <213> Resistin reverse primer <400> 14 tcttcacgaa tgtcccacga 20 <210> 15 <211> 20 <212> DNA <213> GAPDH forward primer <400> 15 accacagtcc atgccatcac 20 <210> 16 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 16 tccaccaccc tgttgctgta 20 <210> 17 <211> 26 <212> DNA <213> PPAR alpha forward primer <400> 17 acggaaagcc cactctgccc cctctc 26 <210> 18 <211> 25 <212> DNA <213> PPAR alpha reverse primer <400> 18 cttgtccccg cagattctac attcg 25 <210> 19 <211> 23 <212> DNA <213> CPT1 alpha forward primer <400> 19 agacggtgga acagaggctg aag 23 <210> 20 <211> 27 <212> DNA <213> CPT1 alpha reverse primer <400> 20 tgagaccaaa caaagtgatg atgtcag 27 <210> 21 <211> 21 <212> DNA <213> ACO2 forward primer <400> 21 gcggacatgg ctactcaaag c 21 <210> 22 <211> 21 <212> DNA <213> ACO2 reverse primer <400> 22 gcagtgcacc ttagcagcct g 21 <210> 23 <211> 20 <212> DNA <213> GAPDH forward primer <400> 23 accacagtcc atgccatcac 20 <210> 24 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 24 tccaccaccc tgttgctgta 20  

Claims (17)

Obesity, metabolic disease, cardiovascular system regulated by the action of Peroxysome Proliferator-Activated Receptor (PPAR) containing water, alcohol or mixtures thereof as an active ingredient A pharmaceutical composition for preventing and treating any one disease selected from the group consisting of diseases and skin diseases. The pharmaceutical composition of claim 1, wherein the alcohol is a C ₁ to C ₄ lower alcohol. The pharmaceutical composition of claim 2, wherein the lower alcohol is ethanol or methanol. The pharmaceutical composition of claim 1, wherein the PPAR is PPARγ or PPARα. It consists of obesity, metabolic diseases, cardiovascular diseases and skin diseases, which are controlled by PPAR action, which contains fractions extracted by adding organic solvent to the extract of Mindonggashi extract extracted with water, alcohol or a mixture thereof as a solvent. Pharmaceutical composition for preventing and treating any one disease selected from the group. 6. The pharmaceutical composition according to claim 5, wherein the fraction is a methanol soluble layer obtained by discarding the dichloromethane soluble layer obtained by adding dichloromethane as an organic solvent to the extract of Mindung-Ash and adding methanol again. The active fraction obtained by adsorbing the fractions of Mindonggashi of claim 6 to silica gel in column chromatography and increasing the concentration of acetonitrile to water in 10% increments from 60% to 100% by 80% in the concentration gradient. A pharmaceutical composition for preventing and treating any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the PPAR action. From the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing an Amorphastilbol compound represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient Pharmaceutical composition for preventing and treating any one selected. <Formula 1>

To 5,7-dihydroxy-6-geranyl flavanone (5,7-Dihydroxy-6-geranyl flavanone) compound represented by the formula (2) or a pharmaceutically acceptable salt thereof to PPAR action A pharmaceutical composition for preventing and treating any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by. <Formula 2>

In the above formula, R _{1 ,} R ₂ And R ₃ is independently of each other H, OH or OCH ₃ . The method according to claim 1, 5, 7, 8, or 9, wherein the metabolic disease regulated by PPAR action is diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, hypercholesterolemia, hypertriglyceridemia, metabolism Syndrome X and a pharmaceutical composition, characterized in that any one selected from the group consisting of endothelial dysfunction. The pharmaceutical composition of claim 10, wherein the hypercholesterolemia is any one selected from the group consisting of low HDL-cholesterolemia, high LDL-cholesterolemia, and hypertriglyceridemia. The method according to claim 1, 5, 7, 8, or 9, wherein the cardiovascular disease regulated by PPAR action is from the group consisting of hypertension, precoagulant state, dyslipidemia and atherosclerosis disease. Pharmaceutical composition, characterized in that any one selected. The method according to claim 1, 5, 7, 8, or 9, wherein the skin disease controlled by PPAR action is any one selected from the group consisting of skin barrier enhancement, atopy, contact dermatitis and inflammatory diseases. Pharmaceutical compositions. At least one selected from the group consisting of Mindung ash extract extracted from water, an alcohol or a mixture thereof as a solvent, a fraction thereof, amorphastilball and 5,7-dihydroxy-6-geranylflavanone is an active ingredient. PPARγ agonist to contain. At least one selected from the group consisting of Mindung ash extract extracted from water, an alcohol or a mixture thereof as a solvent, a fraction thereof, amorphastilball and 5,7-dihydroxy-6-geranylflavanone is an active ingredient. PPARα agonist containing. At least one member selected from the group consisting of Mindung ash extract extracted from water, ethanol or a mixture thereof as a solvent, a fraction thereof, amorphastyl ball and 5,7-dihydroxy-6-geranylflavanone Obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by PPAR action any one disease prevention and improvement health food selected from the group consisting of. At least one member selected from the group consisting of min Dong-gashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone extracted using water, alcohol or a mixture thereof as a solvent A skin external preparation for preventing and improving any one symptom selected from the group consisting of skin aging, low elasticity, wrinkles, skin drying and keratinogenesis controlled by PPAR action.

Images