KR20090011428A - A composition that is comprising extracts, fractions or isolated single compounds of robinia pseudo-acacia var. umbraculifera - Google Patents
A composition that is comprising extracts, fractions or isolated single compounds of robinia pseudo-acacia var. umbraculifera Download PDFInfo
- Publication number
- KR20090011428A KR20090011428A KR1020070074991A KR20070074991A KR20090011428A KR 20090011428 A KR20090011428 A KR 20090011428A KR 1020070074991 A KR1020070074991 A KR 1020070074991A KR 20070074991 A KR20070074991 A KR 20070074991A KR 20090011428 A KR20090011428 A KR 20090011428A
- Authority
- KR
- South Korea
- Prior art keywords
- group
- ppar
- extract
- diseases
- skin
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C39/00—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring
- C07C39/205—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring polycyclic, containing only six-membered aromatic rings as cyclic parts with unsaturation outside the rings
- C07C39/21—Compounds having at least one hydroxy or O-metal group bound to a carbon atom of a six-membered aromatic ring polycyclic, containing only six-membered aromatic rings as cyclic parts with unsaturation outside the rings with at least one hydroxy group on a non-condensed ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
- C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
- C07D311/22—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4
- C07D311/26—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3
- C07D311/28—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3 with aromatic rings attached in position 2 only
- C07D311/32—2,3-Dihydro derivatives, e.g. flavanones
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Medical Informatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Alternative & Traditional Medicine (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Microbiology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Child & Adolescent Psychology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Medicines Containing Plant Substances (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
Description
본 발명은 민둥아까시(Robinia pseudo - acacia var . umbraculifera) 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물을 유효성분으로 함유하는 조성물에 관한 것으로서, 더욱 상세하게는 물, 알코올 또는 이들의 혼합물을 용매로 하여 추출되는 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼(Amorphastilbol) 또는 5,7-디하이드록시-6-게라닐플라바논(5,7-Dihydroxy-6-geranyl flavanone), 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 조성물에 관한 것이다.The present invention is Robinia ( Robinia) pseudo - acacia var . umbraculifera ) Extract, fractions thereof, or a composition containing the compounds isolated from the fractions as an active ingredient, more specifically, the extract of Mindungsi , extracts thereof, or extracted with water, alcohol or a mixture thereof as a solvent, or Amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone, or a pharmaceutically acceptable salt thereof, the compound isolated from the fraction. It relates to a composition containing as an active ingredient.
오늘날 생활수준의 향상과 생활습관의 변화로 인해 고지혈증, 당뇨병, 비만 등의 대사기능 이상에 기인한 병들이 점점 증가하고 있는 추세이며 이러한 병들은 유전적인 요소와 영양학적인 요소를 포함한 복잡한 원인들을 가지고 있다.Today, due to the improvement of living standards and changing lifestyles, diseases due to metabolic abnormalities such as hyperlipidemia, diabetes, obesity, etc. are increasing. These diseases have complex causes including genetic and nutritional factors. .
퍼옥시좀(Peroxisome)은 이러한 대사기능 이상의 원인이 되는 세포 내 소기관 중 하나로 오랫동안 세포 기능상에 있어 마이너(minor)한 역할을 하는 것으로 여겨져 왔으나 최근의 많은 연구를 통해 산소, 포도당, 지질, 호르몬의 대사 등에 있어 중요한 역할을 담당하며, 또한, 세포증식/분화의 조절, 염증 매개체들의 조절에도 폭 넓은 영향을 가지는 것으로 보고 되어지고 있다. 지질대사와 포도당대사를 통하여 퍼옥시좀은 인슐린 감수성뿐만 아니라 세포막과 비만세포(adipocyte) 형성에 영향을 주고 산화적 스트레스에 대한 영향을 통해서 노화 및 종양발생(tumorigenesis)에서도 중요한 역할을 하는 것으로 알려지고 있다(smith. KJ et.al., J Cutan Med Surg 5(3):231-43, 2001; smith. KJ et.al., J Cutan Med Surg 5(4):315-22, 2001).Peroxysome is one of the organelles that causes these metabolic disorders and has long been considered to play a minor role in cellular function, but many recent studies have shown that metabolism of oxygen, glucose, lipids, hormones It plays an important role in the back, and also has been reported to have a wide range of effects on the regulation of cell proliferation / differentiation, the regulation of inflammatory mediators. Through lipid metabolism and glucose metabolism, peroxysomes are known to play an important role in not only insulin sensitivity but also in cell membrane and adipocyte formation and in aging and tumorigenesis through effects on oxidative stress. ( Smith.KJ et.al., J Cutan Med Surg 5 (3): 231-43, 2001; smith. KJ et.al., J Cutan Med Surg 5 (4): 315-22, 2001).
이러한 부분에 대한 지난 10 여년 간의 집중적 연구는 퍼옥시좀 증식체 활성화 수용체(peroxisome proliferator-activated receptors, PPARs)라는 핵 호르몬 수용체가 이들 병들의 약리학적 접근의 좋은 표적(target)이 될 것이라는 증거들을 내어 놓았다. 퍼옥시좀 증식체 활성화 수용체들(PPARs)은 48가지의 핵수용체(nuclear receptors)중 하나이며 리간드(ligand) 결합에 의해 유전자 발현을 조절한다. 핵수용체중 하나인 파르네소이드 X 수용체(farnesoid X receptor)는 담즙산과 결합하고, 리버 X 수용체(liver X receptor)는 옥시스테롤(oxysterols)과 결합하는 반면 퍼옥시좀 증식체 활성화 수용체들(PPARs)는 다양한 지방산이 내생의 리간드(endogenous ligand)로 작용한다. PPAR 형의 수용체에 관련된 다수의 서지학적 참조문들이 열거되어 있는 간행물(Michel Rivier, et.al., J. Invest . Dermatol 111, p.1116∼1121, 1998)을 언급할 수 있고, 또한 보고서(Timothy M et.al., Med . Chem., Vol. 43, p. 527∼550, 2000)을 언급할 수 있다.Intensive research in this area over the last decade has produced evidence that nuclear hormone receptors, called peroxisome proliferator-activated receptors (PPARs), will be good targets for the pharmacological approach of these diseases. Let go. Peroxysome proliferator activated receptors (PPARs) are one of 48 nuclear receptors and regulate gene expression by ligand binding. One of the nuclear receptors, the farnesoid X receptor, binds bile acids and the liver X receptor binds to oxysterols, while the peroxysome proliferator activated receptors (PPARs) Various fatty acids act as endogenous ligands. Reference may be made to the publication (Michel Rivier, et.al., J. Invest . Dermatol 111, p . 1116-1121, 1998), which lists a number of bibliographic references relating to PPAR type receptors . Timothy M et. Al., Med . Chem ., Vol. 43, p. 527-550, 2000).
현재까지 밝혀진 퍼옥시좀 증식체 활성화 수용체들(PPARs)은 퍼옥시좀 증식체 활성화 수용체 알파(PPARα), 퍼옥시좀 증식체 활성화 수용체 베타(PPARβ/δ) 및 퍼옥시좀 증식체 활성화 수용체 감마(PPARγ)의 3가지이며, 각각에 대해 살펴보면, PPARα는 주로 혈관벽, 간, 심장, 근육, 신장, 갈색지방조직에서 발견된다. 페노피브레이트(Fenofibrate), 벤자피브레이트(bezafibrate), 시프로피브레이트(ciprofibrate), 젬피브로질(gemfibrozil)등의 피브레이트(fibrate)류는 PPARα의 작용제(agonist)으로서 쥐와 사람의 동맥경화증을 예방하거나 발병을 지연시키는 작용, 지방산화촉진을 통한 항비만작용을 가진다. 또한 이들은 피부의 표피에서 각질형성세포 분화촉진/증식 억제, 지질대사를 통한 피부장벽 형성 촉진, 염증의 억제, 상처회복에 있어 중요한 기능을 하고 있으며, PPARα의 자외선에 의한 염증매개체의 생성억제와, 홍반생성억제작용도 보고되었다(Kippenberger S, et.al., JID 117(6): 1430-6, 2001). The peroxysome proliferator activating receptors (PPARs) identified to date are peroxysome proliferator activating receptor alpha (PPARα), peroxysome proliferator activating receptor beta (PPARβ / δ) and peroxysome proliferator activating receptor gamma ( PPARγ), and in each case, PPARα is mainly found in the blood vessel wall, liver, heart, muscle, kidney and brown adipose tissue. Fibrates such as fenofibrate, bezafibrate, ciprofibrate, and gemfibrozil are agonists of PPARα and prevent atherosclerosis in mice and humans. Or delay the onset of action, and has an anti-obesity effect through fatty acid promotion. They also play an important role in promoting keratinocyte differentiation / proliferation in the epidermis of the skin, promoting skin barrier formation through lipid metabolism, suppressing inflammation, and healing wounds. Suppression of erythema production has also been reported (Kippenberger S, et.al., JID 117 (6): 1430-6, 2001).
PPARδ는 PPARβ라고도 하며 많은 조직에 분포하며 특히 피부, 뇌, 지방조직에서 많이 발견된다. 콜레스테롤 역수송, 유수화(myelination), 상처회복에 관여하며, 지방산 대사와 에너지 생체항상성(homeostasis)에 매우 중요한 조절자로서 작용한다(황후상 등, 대한내분비학회지, 19(3): 250, 2004).PPARδ, also known as PPARβ, is distributed in many tissues, especially in skin, brain and adipose tissue. It is involved in cholesterol transport, myelination, and wound healing, and acts as an important regulator of fatty acid metabolism and energy homeostasis (Kyomin et al., 19 (3): 250, 2004). .
PPARγ는 지방조직에 가장 많이 나타나며, 혈관내피, 대식세포, 췌장 β-세포에서 발견된다. 간, 심장, 골격근과 같이 주로 PPARα가 발견되는 조직에서는 덜 발견된다. PPARγ는 3가지 서브타입 중에서 가장 광범위하게 연구되고 있다. PPARγ의 중대한 역할은 그것이 많이 발현되는 곳인 지방 세포의 분화를 조절하고 전신 지질 항상성에 결정적인 역할을 한다. 특히, 특허 출원 WO 96/33724에서는, PPARγ의 선택성 화합물, 예컨대 프로스타글란딘 J2 또는 D2 가 비만증 및 당뇨병의 치료를 위한 잠재적 활성제라고 기술되어있다. 특허 출원 FR 98/02894에서, 제약학적 조성물로서, 표피 세포 분화 이상과 관련된 피부장애를 치료하고자 하는 제약학적 조성물의 제조에서 PPARγ 활성화제 화합물의 용도를 기술하였다. PPARγ 활성을 전체적 또는 부분적 활성화 화합물은 지방세포 분화를 억제하여 비만에 대한 효과적인 치료법을 구성한다. 더욱이, 부분적 활성화 화합물은 비만 치료뿐만 아니라 고혈당증을 조절하는데 효과적이다. 따라서, PPARγ 전체적/부분적 활성화 화합물들은 비만 치료 및 글루코오스, 트리글리세라이드 및 인슐린의 상승된 혈장 수준과 같은 비인슐린 의존성 당뇨병에서 일반적으로 발생하는 기타 증상의 치료에 효과적이다(WO 01/30343, WO 02/08188, WO 2004/020408)(Berger et al., Trends Pharmacol. Sci ., vol. 26, p.244-51, 2005). 1997년 1월 치아졸리딘다이온(thiazolidinediones)은 미국에서 제2형 당뇨환자의 혈당저하치료제로 승인되었으나 그 중 트로글리타존(troglitazone)은 간독성 때문에 시장에서 회수되었다. 현재 사용중인 PPARγ 작용약(agonist)은 로지글리타존(rosiglitazone)과 피오글리 타존(pioglitazone)이며 1999년 미국에서 승인받았다. PPARγ is most common in adipose tissue and is found in vascular endothelium, macrophages, and pancreatic β-cells. It is less common in tissues where PPARα is found, such as liver, heart, and skeletal muscle. PPARγ is the most widely studied of the three subtypes. PPARγ plays a critical role in regulating the differentiation of fat cells, where it is expressed a lot, and in deciding on systemic lipid homeostasis. In particular, patent application WO 96/33724 describes selective compounds of PPARγ, such as prostaglandin J2 or D2, as potential activators for the treatment of obesity and diabetes. In patent application FR 98/02894, the use of PPARγ activator compounds in the preparation of pharmaceutical compositions intended to treat skin disorders associated with epidermal cell differentiation abnormalities is described. Compounds that activate PPARγ activity in whole or in part inhibit adipocyte differentiation and constitute an effective treatment for obesity. Moreover, partially activated compounds are effective in treating hyperglycemia as well as treating obesity. Thus, PPARγ total / partially activating compounds are effective in the treatment of obesity and other symptoms commonly occurring in non-insulin dependent diabetes mellitus such as elevated plasma levels of glucose, triglycerides and insulin (WO 01/30343, WO 02 / 08188, WO 2004/020408) (Berger et al., Trends Pharmacol. Sci . , Vol. 26, p. 244-51, 2005). In January 1997, thiazolidinediones was approved for the hypoglycemic treatment of type 2 diabetes in the United States, of which troglitazone was recovered from the market due to hepatotoxicity. Currently used PPARγ agonists are rosiglitazone and pioglitazone, which were approved in the United States in 1999.
PPARs에 대한 특허들을 살펴보면 주로 PPARγ에 대한 활성화제 즉 신물질에 대한 특허와 검색방법에 대한 특허, 당뇨 비만 등에 대한 용도 특허들로 구성이 되어 있다. 신물질에 대한 특허는 PPARγ에 대한 효능제 활성을 갖는 치환된 4-히드록시-페닐알카논산 유도체(대한민국 등록특허 제474202호), PPAR 매개 질환의 치료에 유용한 신규 화합물(대한민국 공개특허 제 2005-0055790), 키랄 옥사졸-아릴프로파이온산 유도체 및 PPAR 작용제로서 그의 용도(대한민국 공개특허 제 2005-0055750), 체액 잔류, 부종 또는 울혈심부전증을 유발하지 않는 신규 PPAR 리간드(대한민국 공개특허 제 2005-0055701), 당뇨병 치료에 유용한 PPAR 작용제로서 N- 치환된-1H-인돌-5-프로파이온산 화합물(대한민국 공개특허 제 2005-0042809), PPARγ와 PPARα의 활성을 항진시키는 신규화합물, 그것의 제조 방법, 및 그것을 함유한 약제 조성물(대한민국 공개특허 제 2005-0040746), PPARγ와 PPARα의 조절물질로서 벤조산 유도체(대한민국 공개특허 제 2005-0014014), 경구용 항당뇨병제(대한민국 공개특허 제 2004-0044515) 등이 있고, 검색방법에 대한 특허는 비만 및 당뇨 조절물질의 검색 방법(대한민국 등록특허 제 468046), βGK유전자의 퍼옥시좀 증식 반응 요소(대한민국 등록특허 제 4434948), PPARα에 대한 단일클론 항체, 특이항체분비 융합세포주 및 항체를 이용한 염증, 암, 대사성 질환과 같은 질병 관련 조절인자를 검색하는 방법(대한민국 공개특허 제 2005-0027808) 등이 있고, 용도특허로는 육두구에서 추출한 메이스리그난 또는 이의 약제학적으로 허용 가능한 염을 유효성분으로 함유하는 PPARα에 의해 매개되는 질환의 예방 또는 치료용 조성물 (대한민국공개특허 제 2007-0033938), 카테킨 및 캄페롤 성분을 함유하는 피지억제용 화장료 조성물(대한민국 공개특허 제 2007-0028902), PPARγ수용체의 활성화에 기인한 자가면역질환 및 알츠하이머병의 치료에 유용한, 천심련으로부터 추출된 랍단 디테르펜을 포함하는 조성물(대한민국 공개특허 제 2007-0026398), 녹나무 잎 추출물 또는 그의 분획물을 유효성분으로 포함하는 당뇨병 예방 및 치료용 조성물(대한민국 공개특허 제 2007-0019344), PPARγ 작용제(agonist)로서의 인삼 PPT(대한민국 공개특허 제 2006-0131012), 항지방화 및 항비만 활성을 갖는 박과 식물 추출물 또는 이로부터 분리한 정제물을 포함하는 조성물(대한민국 공개특허 제 2005-0054009, 2005-0054006), 지질대사 개선용 조성물 및 식품(대한민국 공개특허 제 2004-0084908), 심장 인슐린 내성 관련 증상의 치료 및 예방(대한민국 공개특허 제 2003-0019434), 뼈 형성의 조절(대한민국 공개특허 제 0093808), 진성 당뇨병 치료를 위한 벤조산 유도체(대한민국 공개특허 제 2002-0087382), 피부 관리 조성물(대한민국 공개특허 제 2002-0047101), 심혈관 질환 치료용 PPAR 델타 억제제(대한민국 공개특허 제 2002-0012323), 알쯔하이머병, 중추신경계 손상 및 염증성 질환의치료용 조성물 및 치료 방법(대한민국 공개특허 제 2001-0101085), 증후군 X의 치료를 위한 PPAR - 알파 및 PPAR - 감마 길항제의 용도(대한민국 공개특허 제 1999-0077099) 등이 있다.Looking at the patents for PPARs mainly consists of patents for activating agents for PPARγ, patents for new substances and patents for the search method, diabetes obesity. Patents for new substances include substituted 4-hydroxy-phenylalkanoic acid derivatives having agonist activity against PPARγ (Korean Patent No. 474202), and novel compounds useful for the treatment of PPAR mediated diseases (Korean Patent No. 2005-0055790). ), Chiral oxazole-arylpropionic acid derivatives and their use as PPAR agonists (Korean Patent No. 2005-0055750), novel PPAR ligands that do not cause fluid retention, edema or congestive heart failure (Korean Patent No. 2005-0055701) N-substituted-1H-indole-5-propionic acid compounds (PLA) as novel PPAR agonists useful for treating diabetes, novel compounds that enhance the activity of PPARγ and PPARα, methods for preparing the same, and Pharmaceutical composition containing it (Korean Patent Publication No. 2005-0040746), benzoic acid derivative (Korean Patent Publication No. 2005-0014014) as a modulator of PPARγ and PPARα, oral antidiabetic (Republic of Korea Patent Publication No. 2004-0044515) and the like, the patent for the search method for obesity and diabetic regulators search method (Korea Patent No. 468046), peroxysome proliferation response element of βGK gene (Korea Patent Registration No. 4434948), a method for searching for disease-related regulators such as inflammation, cancer, and metabolic diseases using monoclonal antibodies against PPARα, specific antibody secreting fusion cell lines, and antibodies (Korean Patent Publication No. 2005-0027808). Roh contains a composition for the prevention or treatment of diseases mediated by PPARα containing mayylignan or a pharmaceutically acceptable salt thereof extracted from nutmeg (Korean Patent Publication No. 2007-0033938), catechin and camphorol components Sebum inhibitory cosmetic composition (Korean Patent Publication No. 2007-0028902), autoimmune disease caused by activation of PPARγ receptor and Alzheimer's disease Useful for the treatment of diseases, composition comprising rabdan diterpene extracted from cheonsimyeon (Korea Patent Publication No. 2007-0026398), a composition for preventing and treating diabetes comprising a camphor leaf extract or a fraction thereof as an active ingredient (Korea Patent Publication 2007-0019344), a composition comprising ginseng PPT as a PPARγ agonist (Korean Patent Publication No. 2006-0131012), a gourd and plant extract having anti-localization and anti-obesity activity or a purified product isolated therefrom. Patent Nos. 2005-0054009, 2005-0054006), Compositions and foods for improving lipid metabolism (Korean Patent Publication No. 2004-0084908), Treatment and prevention of symptoms related to heart insulin resistance (Korean Patent Publication No. 2003-0019434), of bone formation Control (Korean Patent Publication No. 0093808), benzoic acid derivatives for treating diabetes mellitus (Korean Patent Publication No. 2002-0087382), skin care composition (Korean Patent No. 2002-0047101), PPA delta inhibitor for cardiovascular disease (Korean Patent Publication No. 2002-0012323), Alzheimer's disease, composition and treatment method for the treatment of central nervous system damage and inflammatory diseases (Korean Patent Publication No. 2001-0101085), The use of PPAR-alpha and PPAR-gamma antagonists for the treatment of syndrome X (Korean Patent Laid-Open Publication No. 1999-0077099).
민둥아까시나무는 학명이 Robinia pseudo - acacia var . umbraculifera로서 콩과에 속하는 식물로 북아메리카 원산의 귀화식물이고, 한국 전역에 분포하여 산과 들에서 자란다. 높이 약 25 m로 나무껍질은 노란빛을 띤 갈색이며 세로로 갈라진다. 작은 가지는 털과 가시가 없다. 잎은 어긋나고 깃꼴겹잎이다. 작은 잎은 9 ∼ 19개로서 타원 모양이거나 달걀 모양이고 길이 2.5 ∼ 4.5 cm이다. 양끝이 둥글고 밋밋하며 작은 잎자루는 길이 2 ∼ 4 mm이다. 꽃이 피지 않으며 가시도 없으며 수관(樹冠)이 둥글다. 번식은 꺾꽂이·포기나누기 등으로 한다(두산세계대백과 엔싸이버).The bark is named Robinia pseudo - acacia var . umbraculifera is a legume plant and is a naturalized plant native to North America. It is distributed throughout Korea and grows in mountains and fields. The bark is about 25 m high and the bark is yellowish brown and split vertically. Small branches lack hair and thorns. The leaves are alternate and the pinnate leaves. 9 to 19 small leaves, elliptical or egg-shaped, 2.5-4.5 cm long. Both ends are round and flat, and petioles are 2-4 mm long. Flowers do not bloom, have no thorns, and water crowns are round. Breeding is done by folding, giving up, etc. (Doosan World Great White and Ensaber).
민둥아까시나무를 이용한 특허는 전무하며, 아까시나무를 이용한 특허는 숙취해소 및 간기능 회복에 효과가 있는 천연차(대한민국공개특허 제 2004-0005848), 아까시 유래 렉틴의 식품 용도(유럽특허 1009418), 기타 사료제조에 사용된 아까시 나무(대한민국공개특허 제 2001-0063743) 등이 공개되어 있다. 본 특허에 명시된 아모파스틸볼(amorphastilbol)은 항균효과(Mitscher, LA., et.al., Phytochemistry, 27(4): 1481-83, 1985)가 알려졌을 뿐이고, 또한 5,7-디하이드록시-6-게라닐 플라바논(5,7-dihydroxy-6-geranyl flavanone)도 비만/당뇨, 피부노화에 대한 효과는 전혀 보고되어 있지 않았다. There are no patents using the bark, and the patent using the bark is natural tea (Korea Patent Publication No. 2004-0005848), which is effective in relieving hangovers and restoring liver function, food use of lectins derived from Acacia (European Patent 1009418), The ash tree (Korean Patent Laid-Open No. 2001-0063743) and the like used in other feed manufacturing are disclosed. Amorphastilbol described in this patent is known only for its antimicrobial effect (Mitscher, LA., Et.al., Phytochemistry, 27 (4): 1481-83, 1985), and also 5,7-dihydrate. The effects of 5,7-dihydroxy-6-geranyl flavanone on obesity / diabetes and skin aging have not been reported at all.
이에, 본 발명자들은 이들 PPARs의 생물학적인 개략적 정보와 PPARs의 효능과 작용 기작, 특히 비만, 당뇨, 피부노화 및 보습과의 관련성 등에 대해 살펴보고, 리간드(ligand)들을 찾던 중 고랭지에서 자생하고 있던 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물로부터 분리한 단일 성분들 중 일부가 PPARα및 PPARγ의 활성화 효과를 나타내어 비만, 당뇨, 피부노화, 피부주름 또는 피부보습의 예 방 및 치료제로 사용될 수 있음을 밝힘으로써 본 발명을 완성하였다. Therefore, the present inventors have reviewed the biological overview of these PPARs and the effects and mechanisms of PPARs, in particular obesity, diabetes, skin aging and moisturizing, and looking for ligands in the highland while searching for ligands The extract, its fractions, or some of the single components isolated from the fractions exhibited the activating effects of PPARα and PPARγ, which can be used as a preventive and therapeutic agent for obesity, diabetes, skin aging, skin wrinkles or skin moisturizing. The invention was completed.
민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논, 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 조성물은 퍼옥시좀 증식체 활성화 수용체(Peroxisome Proliferator-Activated Receptor, PPAR)를 활성화시켜서 PPARγ 또는 PPARα 작용에 의해 조절되는 질환 예방 및 치료용 조성물을 제공하는 것이다.A composition containing as an active ingredient extract of Min Dong-Agashi, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone, or a pharmaceutically acceptable salt thereof Is to provide a composition for preventing and treating diseases regulated by PPARγ or PPARα action by activating a Peroxysome Proliferator-Activated Receptor (PPAR).
상기의 목적을 달성하기 위하여, 본 발명은 물, 알코올 또는 이들의 혼합물을 용매로 하여 추출된 민둥아까시 추출물을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.In order to achieve the above object, the present invention is obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing as a active ingredient extracts Mindong baeksae extracted with water, alcohol or a mixture thereof as a solvent It provides a pharmaceutical composition for preventing and treating any one disease selected from the group consisting of.
또한, 본 발명은 상기 민둥아까시 추출물에 유기용매를 추가로 가하여 추출한 분획물을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.In addition, the present invention is any one selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing the fraction extracted by additionally adding an organic solvent to the extract of Min Dong It provides a pharmaceutical composition for preventing and treating diseases.
또한, 본 발명은 상기 분획물을 실리카겔 컬럼 크로마토그래피에서 물에 대한 아세토니트릴의 농도가 60 %에서 100 %로 10 %씩 증가하는 단계 농도구배에서 80 %일 때 얻을 수 있는 활성 분획물을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.In addition, the present invention contains the active fraction obtained as an active ingredient when the concentration of acetonitrile to water in silica gel column chromatography increases the concentration of acetonitrile from 60% to 100% by 80% in the step gradient. It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR.
또한, 본 발명은 하기 화학식 1로 표시되는 아몰파스틸볼(Amorphastilbol) 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.In addition, the present invention is obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the action of PPAR containing an Amorphastilbol compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient It provides a pharmaceutical composition for preventing and treating any one disease selected from the group consisting of.
또한, 본 발명은 하기 화학식 2로 표시되는 5,7-디하이드록시-6-게라닐플라바논(5,7-Dihydroxy-6-geranyl flavanone) 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.In addition, the present invention is a 5,7-dihydroxy-6-geranyl flavanone compound represented by the following formula (2) or a pharmaceutically acceptable salt thereof as an active ingredient It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by the PPAR action.
상기식에서,In the above formula,
R1 , R2 및 R3은 서로 독립적으로 H, OH 또는 OCH3이다.R 1 , R 2 And R 3 is independently of each other H, OH or OCH 3 .
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 유효성분으로 함유하는 PPARγ 작용제를 제공한다.In another aspect, the present invention provides a PPARγ agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranylflavanone as an active ingredient. do.
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 유효성분으로 함유하는 PPARα 작용제를 제공한다.In another aspect, the present invention provides a PPARα agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone as an active ingredient. do.
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 함유하는 PPAR 작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 개선용 건강식품을 제공한다.In addition, the present invention is obesity is controlled by the action of PPAR containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone It provides a health food for preventing and improving any one disease selected from the group consisting of metabolic diseases, cardiovascular diseases and skin diseases.
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 함유하는 PPAR 작용에 의해 조절되는 피부노화, 저탄력, 주름, 피부건조 및 각질형성으로 이루어진 군으로부터 선택된 어느 하나의 증상 예방 및 개선용 피부 외용제를 제공한다.In addition, the present invention is a skin that is controlled by the action of PPAR containing at least one selected from the group consisting of the extract of Min Dong, the fraction thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone It provides a skin external preparation for preventing and improving any one symptom selected from the group consisting of aging, low elasticity, wrinkles, dry skin and keratinization.
본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논, 또는 이의 약학적으로 허용가능한 염은 PPAR를 활성화하여 비만과 당뇨를 예방 및 치료할 수 있고, 종양괴사인자 알파(TNF α)를 억제하여, 매트릭스 메탈로프로테이나제(Matrix metalloproteinase-1, MMP-1)의 생합성을 억제하여 피부노화와 주름 개선용 피부외용제로서 매우 우수한 효과를 나타낼 수 있으므로 상기 질환 예방 및 치료용 조성물로 유용하게 이용될 수 있다.Amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, or a pharmaceutically acceptable salt thereof, which is a extract of the present invention, a fraction thereof, or a compound isolated from the fraction, activates PPAR Prevent and treat obesity and diabetes, inhibit tumor necrosis factor alpha (TNF α), inhibit the biosynthesis of matrix metalloproteinase-1 (MMP-1) and improve skin aging and wrinkles It can be usefully used as a composition for preventing and treating the disease because it can exhibit a very excellent effect as a skin external preparation.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명의 유효성분인 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물은 하기의 단계들을 포함하는 분리정제 방법에 의해 제조된다.Mindonggashi extract, a fraction thereof, or a compound separated from the fraction, which is an active ingredient of the present invention, is prepared by a separation and purification method comprising the following steps.
1) 민둥아까시를 추출용매로 추출하는 단계;1) extracting the mindong aka as an extraction solvent;
2) 단계 1)의 민둥아까시 추출물을 여과 및 농축하는 단계;2) filtering and concentrating the extract of step 1);
3) 단계 2)의 농축물을 추가적으로 유기용매로 추출하는 단계;3) further extracting the concentrate of step 2) with an organic solvent;
4) 단계 3)의 분획물을 컬럼 크로마토그래피 방법을 통해 활성 분획물을 수득하는 단계; 및4) obtaining the active fractions from the fractions of step 3) by column chromatography; And
5) 단계 4)의 활성 분획물을 HPLC 방법을 통해 활성 화합물을 수득하는 단계,5) obtaining the active compound from the active fraction of step 4) by HPLC method,
상기 제조방법에 있어서, 단계 1)의 민둥아까시는 재배한 것 또는 시판되는 것 등 제한 없이 사용할 수 있으며, 나무의 지상부, 뿌리, 종자를 모두 사용할 수 있다.In the above production method, the steppe may be used without limitation, such as cultivated or commercially available, can be used all above the ground, roots, seeds of the tree.
상기 제조방법에 있어서, 단계 1)의 추출용매는 물, 알코올 또는 이들의 혼합물인 것을 특징으로 한다. 상기 알코올로는 C1 내지 C4 저급 알코올을 이용하는 것이 바람직하며, 저급 알코올로는 에탄올 또는 메탄올을 이용하는 것이 바람직하다. 추출시 용매를 민둥아까시 분량의 5 내지 15배 첨가하여 추출하는 것이 바람직하며, 10배 첨가하여 추출하는 것이 더욱 바람직하나 이에 한정하지 않는다. 상기 용매를 가한 후 환류 냉각하여 추출하는 것이 바람직하나 이에 한정하지 않는다. 추출시 용매의 온도는 60 ~ 100℃인 것이 바람직하며, 80℃인 것이 더욱 바람직하나 이에 한정하지 않는다. 또한, 추출시간은 2 ~ 4 시간이 바람직하며, 3 시간이 더욱 바람직하나 이에 한정하지 않는다. 아울러, 추출 회수는 1 내지 5회인 것이 바람직하며, 3회 반복 추출하는 것이 더욱 바람직하나 이에 한정되는 것은 아 니다. 상기 방법에 의하여 민둥아까시를 추출, 여과한 뒤 여과액을 농축 및 동결건조하여 추출물을 수득하였다.In the above production method, the extraction solvent of step 1) is characterized in that the water, alcohol or a mixture thereof. As the alcohol, C 1 to C 4 lower alcohols are preferably used, and as lower alcohols, ethanol or methanol is preferably used. During the extraction, the solvent is preferably extracted by adding 5 to 15 times the amount of the extract, and it is more preferable to extract by adding 10 times, but not always limited thereto. After the solvent is added, reflux cooling is preferably performed, but the present invention is not limited thereto. The temperature of the solvent at the time of extraction is preferably 60 ~ 100 ℃, more preferably 80 ℃ but not limited thereto. In addition, the extraction time is preferably 2 to 4 hours, more preferably 3 hours is not limited thereto. In addition, the number of extraction is preferably 1 to 5 times, more preferably three times repeated extraction is not limited thereto. After extracting and filtering mindong aqua by the above method, the filtrate was concentrated and lyophilized to obtain an extract.
상기 제조방법에 있어서, 단계 3)의 유기용매는 헥산, 디클로로메탄, 아세톤 또는 아세토니트릴등이 사용될 수 있으며, 디클로로메탄을 가한 후 가용층을 버리고 다시 메탄올로 추출하는 것이 바람직하나 이에 한정하지 않는다.In the production method, hexane, dichloromethane, acetone, or acetonitrile may be used as the organic solvent of step 3), but after dichloromethane is added, the soluble layer is discarded and extracted with methanol, but not always limited thereto.
상기 제조방법에 있어서, 단계 4)의 컬럼 크로마토그래피는 실리카겔, 세파덱스, RP-18, 폴리아미드, 도요펄(Toyopearl) 및 XAD 수지로 이루어진 군으로부터 선택된 충진제를 이용한 컬럼 크로마토그래피를 수행하여 분리 및 정제할 수 있다. 컬럼 크로마토그래피는 필요에 따라 적절한 충진제를 선택하여 수차례 실시할 수 있다. 본 발명의 실시예에서는 플래쉬 컬럼 크로마토그래피에서 충진제로서 실리카겔을 이용하였으며 물에 대한 아세토니트릴의 농도가 60 %에서 100 %로 10 %씩 증가하는 단계 농도구배에서 80 %일 때 활성 분획물을 수득할 수 있었다.In the above method, the column chromatography of step 4) is separated by performing column chromatography using a filler selected from the group consisting of silica gel, Sephadex, RP-18, polyamide, Toyopearl and XAD resin. It can be purified. Column chromatography can be carried out several times by selecting the appropriate filler as required. In the embodiment of the present invention, the silica gel was used as the filler in the flash column chromatography, and the active fraction was obtained when the concentration of acetonitrile in water was increased from 60% to 100% by 80% in the step gradient. there was.
상기 제조방법에 있어서, 단계 5)의 HPLC(Phenomenex Luna 10μ m C18 컬럼)에서 물에 대한 아세토니트릴의 농도가 10%에서 100%로 10%씩 증가하는 단계 농도구배의 조건으로 60분 동안 조제(preparation)하여 26분대에 분리되어 나오는 물질 및 29분대에 분리되어 나오는 물질을 통해 활성 화합물을 수득할 수 있었다. 상기 26분대 및 29분대에 분리되어 나오는 물질을 핵자기공명(nuclear magnetic resonance, NMR)으로 그 구조를 확인한 결과, 26분대에 분리되어 나오는 물질은 화학식 1로 표시되는 아몰파스틸볼(Amorphastilbol)이며, 29분대에 분리되어 나오는 물질은 화학식 2로 표시되는 5,7-디하이드록시-6-게라닐플라바논(5,7-Dihydroxy-6-geranyl flavanone)로 밝혀졌다.In the above preparation method, the acetonitrile concentration in water was increased by 10% from 10% to 100% in HPLC (
본 발명은 상기 제조방법에 의해 제조된 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논, 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 PPAR작용에 의해 조절되는 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 치료용 약학적 조성물을 제공한다.The present invention is a mindonggashi extract prepared by the above production method, fractions thereof, or the compound separated from the fractions of ammol pastol or 5,7-dihydroxy-6-geranyl flavanone, or pharmaceutically thereof It provides a pharmaceutical composition for the prevention and treatment of any one disease selected from the group consisting of obesity, metabolic diseases, cardiovascular diseases and skin diseases controlled by PPAR action containing an acceptable salt as an active ingredient.
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 유효성분으로 함유하는 PPARγ 작용제를 제공한다.In another aspect, the present invention provides a PPARγ agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranylflavanone as an active ingredient. do.
또한, 본 발명은 상기 민둥아까시 추출물, 이의 분획물, 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논으로 이루어진 군에서 선택된 1종 이상을 유효성분으로 함유하는 PPARα 작용제를 제공한다.In another aspect, the present invention provides a PPARα agonist containing at least one selected from the group consisting of the Mindakashi extract, fractions thereof, amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone as an active ingredient. do.
상기 PPAR 작용에 의해 조절되는 대사성 질환은 당뇨, 고지질혈증, 고인슐린혈증, 고요산혈증, 고콜레스테롤혈증, 고중성지방혈증, 대사증후군(Syndrome X) 및 내피기능장애로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 한다.The metabolic disease controlled by the PPAR action is any one selected from the group consisting of diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, hypercholesterolemia, hypertriglyceridemia, metabolic syndrome (Syndrome X) and endothelial dysfunction It is characterized by.
상기 고콜레스테롤혈증은 저 HDL-콜레스테롤증, 고 LDL-콜레스테롤증, 고트리글리세라이드혈증로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 한다.The hypercholesterolemia is characterized in that any one selected from the group consisting of low HDL-cholesterolemia, high LDL-cholesterolemia, hypertriglyceridemia.
상기 PPAR 작용에 의해 조절되는 심혈관계 질환은 고혈압, 응집전 상태(precoagulant state), 이상 지질혈증 및 아테롬성 경화증성 질환으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 한다.The cardiovascular disease regulated by the PPAR action is characterized in that any one selected from the group consisting of hypertension, precoagulant state, dyslipidemia and atherosclerosis disease.
상기 PPAR 작용에 의해 조절되는 피부질환은 피부장벽강화, 아토피, 접촉성 피부염 및 염증성 질환으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 한다.The skin disease controlled by the PPAR action is characterized in that any one selected from the group consisting of skin barrier strengthening, atopic dermatitis, contact dermatitis and inflammatory diseases.
본 발명에서는 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 지방 및 당대사에 관여하는 PPAR γ의 활성화에 미치는 영향을 루시퍼라아제(luciferase) 에세이 시스템을 이용하여 측정하였다. 그 결과 PPAR γ의 활성화 정도는 PPAR γ 작용제로 알려진 트로글리타존 양성 대조군을 처리했을 때와 비교해볼 때 동등하거나 더욱 우수하였으며, 처리량이 높을수록 수치가 더 높아졌음을 확인하였다(표 1 및 도 1 참조).In the present invention, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, are involved in the activation of PPAR γ involved in fat and sugar metabolism. The effect was measured using a luciferase assay system. As a result, the degree of activation of PPAR γ was equal or better than when treated with a troglitazone positive control known as a PPAR γ agonist, and the higher the throughput, the higher the value (see Table 1 and FIG. 1). .
또한, 본 발명에서는 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 지방세포분화에 미치는 영향을 알아보았다. 당이나 지방대사의 개선을 위해 사용되는 글리타존류의 약물들은 기전이 핵수용체이자 전사인자인 PPAR γ를 활성화시켜 지방대사 관련 유전자들이 활성화되어 지방세포 내로 당의 유입을 촉진시켜 지방으로 축적되게 하고 이로 인해 지방세포의 분화가 촉진하게 되는 것이다. 지 방세포를 각 시험물질을 함유한 배지에서 배양함으로써 분화정도를 측정한 결과 지방축적효능은 PPAR γ 작용제로 알려진 트로글리타존 양성 대조군을 처리했을 때와 비교해볼 때 동등하거나 더욱 우수하였다. 따라서 본 발명의 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 지방세포의 분화를 촉진함을 확인함으로써 지방대사 개선에 아주 유효한 성분임을 알 수 있었다(도 2 참조). In addition, in the present invention, the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the adipocyte differentiation was examined. Glitazone drugs used to improve sugar or fat metabolism activate PPAR γ, a mechanism of nuclear receptor and transcription factor, which activates fat metabolism-related genes to promote the influx of sugar into fat cells and accumulate in fat. This will promote the differentiation of fat cells. The degree of differentiation was measured by culturing fat cells in a medium containing each test substance, and the fat accumulation effect was equal or better than that when treated with a troglitazone positive control known as a PPAR γ agonist. Therefore, it was found that amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone of the present invention is a very effective ingredient for improving fat metabolism by confirming that it promotes the differentiation of adipocytes (see FIG. 2). .
또한, 본 발명에서는 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 PPARγ 및 지방세포분화에 관련된 유전자들의 발현에 미치는 영향을 알아보기 위해 RT-PCR을 통해 PPARγ 및 지방세포와 관련된 유전자 C/EBPα(CCAAT Enhancer Binding Protein Alpha), Ap2(Adipocyte fatty acid-binding protein 2), 아디포넥틴(Adiponectin), 지방산 합성효소(fatty acid synthase, Fas), 글루코즈 트랜스포터 4(Glucose transporter 4, GLUT4) 및 레지스틴(Resistin)의 발현정도를 조사한 결과 PPAR γ 작용제로 알려진 트로글리타존 양성 대조군을 처리했을 때만큼 발현이 증가함을 확인하였다(도 3 참조). 따라서 본 발명의 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 PPAR γ 작용제로 기능하며 지방대사 개선에 유효한 성분임을 알 수 있다.In addition, in the present invention, PPARγ and fat through RT-PCR to determine the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the expression of genes involved in PPARγ and adipocyte differentiation Cell-related genes C / ATCA (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), Adiponectin, Fatty acid synthase (Fass), Glucose transporter 4 , GLUT4) and resistin (Resistin), the expression level was confirmed that the expression increased as much as treated with a troglitazone positive control known as PPAR γ agonist (see Figure 3). Therefore, it can be seen that amorphastyl ball or 5,7-dihydroxy-6-geranylflavanone of the present invention functions as a PPAR γ agonist and is an effective ingredient for improving fat metabolism.
또한, 본 발명에서는 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 PPAR α의 활성화에 미치는 영향을 루시퍼라아제(luciferase) 에세이 시스템을 이용하여 측정하였다. 그 결과 PPAR α의 활성화 정도는 PPARα의 작용제로 잘 알려진 Wy-14,643 양성대조군을 처리했을 때와 비교해볼 때 동등하거나 더욱 우수하였으며, 처리량이 높을수록 수치가 더 높아졌음을 확인하였다(표 2 및 도 4 참조). 따라서 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 PPAR α 작용제로 기능할 수 있음을 알 수 있다.In addition, in the present invention, the effect of alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone on the activation of PPAR α is lucifera. Measurements were made using a luciferase assay system. As a result, the degree of activation of PPAR α was equal or better than that of the Wy-14,643 positive control group, which is a well-known PPARα agonist, and it was confirmed that the higher the throughput, the higher the value (Table 2 and FIG. 4). Accordingly, it can be seen that the extract of Mindung-Ashok of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can function as a PPAR agonist. have.
또한, 본 발명에서는 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 PPARα 및 지방산 산화에 관련된 유전자들의 발현에 미치는 영향을 알아보기 위해 RT-PCR을 통해 PPARα 및 지방산 산화에 관련된 유전자 CPT1α(Carnitine Palmitoyl Transferase I alpha), ACO2(Acyl-CoA Oxidase 2)의 발현 정도를 조사한 결과 PPAR α의 작용제로 알려져 있는 Wy-14,643를 처리하였을 때만큼 발현이 증가함을 확인하였다(도 3 참조). 따라서 본 발명의 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 PPARα 작용제로 기능하며 지방산 산화에 유효한 성분임을 알 수 있다.In addition, in the present invention, in order to determine the effect of amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone on the expression of genes involved in PPARα and fatty acid oxidation, PPARα and fatty acid oxidation through RT-PCR As a result of examining the expression levels of the related genes CPT1α (Carnitine Palmitoyl Transferase I alpha) and ACO2 (Acyl-CoA Oxidase 2), it was confirmed that the expression increased as much as Wy-14,643, which is known to be an agonist of PPAR α (FIG. 3). Therefore, it can be seen that amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone of the present invention functions as a PPARα agonist and is an effective ingredient for fatty acid oxidation.
또한, 본 발명에서는 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 자외선에 의한 종양괴사인자 알파(TNF α)의 생합성을 억제하는 효과를 알아보기 위해 인체 각질형성세포에 자외선을 조사한 후 각 시험물질을 포함한 배지로 배양하여 ELISA 방법을 통해 측정하였다. 그 결과 TNF α의 생합성의 양은 어떤 물질도 처리하지 않은 음성대조군에 비해서 적은 양이 합성되었으며, 양성대조군인 Wy-14,643를 처리하였을 때와 비교해볼 때 동등하거나 높은 양이 합성되었으며, 시험물질의 처리량이 높을수록 TNF α의 생합성의 양은 더 적어졌음을 확인하였다(표 3 참조). 따라서, 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 TNF α의 생합성을 억제할 수 있음을 알 수 있다. In addition, in the present invention, agglutinin extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, a tumor necrosis factor alpha (TNF α) In order to examine the effect of inhibiting the biosynthesis of the human keratinocytes were irradiated with ultraviolet rays and cultured in a medium containing each test substance was measured by ELISA method. As a result, the amount of biosynthesis of TNF α was synthesized less than that of the negative control without any substance, and the same amount or higher than that of the positive control Wy-14,643 was synthesized. It was confirmed that the higher the amount of biosynthesis of TNF α was smaller (see Table 3). Thus, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can inhibit the biosynthesis of TNF α. Able to know.
또한, 본 발명에서는 종양괴사인자 알파(TNF α)와 자외선에 의한 타입 I 콜라게나제인 메탈로프로테아즈-1(Metalloelastase-1, MMP-1)의 생합성량의 관계를 알아보기 위해 인체 섬유아세포에 자외선을 조사한 후 각 시험물질을 포함한 배지에 배양하였고 그 후 TNF α 항체와 TNF α를 각각 처리하여 ELISA 방법을 통해 측정하였다. 그 결과 MMP-1의 생합성량은 TNF α의 항체를 처리하였을 때 감소하였고 TNF α를 처리하였을 때 증가함을 확인함으로써 서로 상관관계가 있음을 알 수 있었다(표 4 및 표 5 참조). 따라서 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 TNF α의 생합성을 감소시키므로 결국 타입 I 콜라게나제의 생합성을 감소시킬 수 있음을 알 수 있었다.In addition, in the present invention, to investigate the relationship between the tumor necrosis factor alpha (TNF α) and the amount of biosynthesis of metalloproteases-1 (MMP-1), a type I collagenase by ultraviolet light After irradiating with UV light, the medium was cultured in a medium containing each test substance, and then treated with TNF α antibody and TNF α, respectively, and measured by ELISA. As a result, the amount of biosynthesis of MMP-1 decreased when the TNF α antibody was treated and increased when the TNF α was treated, indicating a correlation with each other (see Table 4 and Table 5). Therefore, the extract of Mindonggashi (Pacaceae), the fractions thereof, or the compound isolated from the fractions of the present invention, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, reduce the biosynthesis of TNF α and thus eventually form I-cola. It was found that the biosynthesis of the genease can be reduced.
주름생성 및 탄력저하의 가장 큰 기전이 MMP-1의 생합성 증가로 인한 기질물질인 콜라젠의 감소이다. 자외선에 의한 TNF α의 생합성을 감소시키면 MMP-1의 생합성이 감소하므로 피부 염증, 피부 기질 물질의 감소, 탄력 저하 및 주름 형성 등을 효과적으로 예방 및 개선을 할 수 있음을 알 수 있다(Obayashi K, et.al., J Cosmet Sci . 56(1): 17-27. 2005). 따라서 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 피부 염증, 피부 기질 물질의 감소, 탄력 저하 또는 주름 형 성 예방 및 개선용 조성물로서 유용하게 사용될 수 있다.The biggest mechanism of wrinkle formation and loss of elasticity is the reduction of collagen, which is a substrate material due to the increased biosynthesis of MMP-1. Reducing the biosynthesis of TNF α by ultraviolet rays reduces the biosynthesis of MMP-1, which can effectively prevent and improve skin inflammation, reduction of skin matrix material, decreased elasticity and wrinkle formation (Obayashi K, et.al., J Cosmet Sci . 56 (1): 17-27. 2005). Therefore, the extract of Mindonggashashi, the fractions thereof, or the compound isolated from the fractions of the present invention, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, reduce skin inflammation, decrease skin matrix material, and decrease elasticity. Or it may be usefully used as a composition for preventing and improving wrinkle formation.
또한, 본 발명에서는 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 피부 보습 및 수화에 관련된 유전자들의 발현에 미치는 영향을 알아보았다. 필라그린(filaggrin)과 인볼루크린(Involucrin)이 피부 보습 및 수화에 관련된 내용은 출원번호 10-2000-7010163(국제출원번호 PCT/US1999/05413)에 기재되어 있다. 인체 각질형성세포에 각 시험물질을 처리하여 배양한 후 웨스턴블랏(Western Blot) 방법을 사용하여 필라그린(filaggrin)과 인볼루크린(Involucrin)의 생합성의 정도를 조사하였다. 그 결과 어떤 물질들을 처리하지 않은 음성대조군에 비해 시험물질을 처리했을 때 상기 유전자의 발현 정도를 증가시킬 수 있음을 확인하였다(표 6 참조). 따라서 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논이 피부 보습 및 수화를 증진시킬 수 있음을 알 수 있다.In addition, in the present invention, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are used for expression of genes related to skin moisturization and hydration. The impact was examined. Filaggrin and Involucrin related to skin moisturizing and hydration are described in Application No. 10-2000-7010163 (International Application No. PCT / US1999 / 05413). Each test substance was incubated in human keratinocytes and cultured, and then the degree of biosynthesis of filaggrin and Involucrin was examined using Western Blot. As a result, it was confirmed that the expression level of the gene could be increased when the test material was treated as compared to the negative control without any material (see Table 6). Therefore, it can be seen that the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone can enhance skin moisturization and hydration. Can be.
본 발명에 있어서, 상기 약학적으로 허용가능한 염은 유리산(free acid)에 의해 형성된 부가염이 유용하다. 적합한 유리산으로는 유기산과 무기산을 사용할 수 있으며, 무기산으로는 염산, 브롬산, 황산 및 인산 등을 사용할 수 있고 유기산으로는 구연산(citric acid), 초산, 젖산, 주석산(tartariac acid), 말레인산, 푸마르산(fumaric acid), 포름산, 프로피온산(propionic acid), 옥살산, 트리플루오로아세트산, 벤조산, 글루콘산, 메탄술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 갈룩투론산, 엠본산, 글루탐산 또는 아스파르트산 등을 사용할 수 있다. 나아가, 본 발명에 따른 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 약학적으로 허용가능한 염뿐만 아니라, 통상의 방법에 의해 조제될 수 있는 모든 염, 수화물 및 용매화물을 모두 포함할 수 있다. In the present invention, the pharmaceutically acceptable salt is an addition salt formed by free acid. Suitable free acids may be organic and inorganic acids, inorganic acids may be hydrochloric acid, bromic acid, sulfuric acid and phosphoric acid, and organic acids may be citric acid, acetic acid, lactic acid, tartariac acid, maleic acid, Fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, galluxuronic acid, embonic acid, glutamic acid or aspartic acid Etc. can be used. Furthermore, the extract of Mindong Acacia according to the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, is not only a pharmaceutically acceptable salt, All salts, hydrates, and solvates that can be prepared by conventional methods can be included.
본 발명의 PPARγ 및/또는 PPARα 작용에 의해 조절되는 질환 예방 및 치료용 약학적 조성물은 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논에서 하나 이상을 선택적으로 함유할 수 있으며, 상기 성분에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다.The pharmaceutical composition for preventing and treating diseases regulated by the action of PPARγ and / or PPARα of the present invention may be Amolpastilball or 5,7-dihydroxy- It may optionally contain one or more in 6-geranyl flavanone, and may further contain one or more active ingredients exhibiting the same or similar functions in addition to the above components.
본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 임상 투여 시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다. 즉, 본 발명의 PPARγ 및/또는 PPARα 작용에 의해 조절되는 질환 예방 및 치료용 약학적 조성물은 실제 임상 투여 시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제 및 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구 투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제 및 캡슐제 등이 포함되며, 이러한 고형 제제는 본 발명의 약학적 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로스, 락토오스 및 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제 및 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제 및 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제가 포함된다. 비수성용제와 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤 및 젤라틴 등이 사용될 수 있다. 본 발명의 PPARγ 및/또는 PPARα 작용에 의해 조절되는 질환 예방 및 치료용 약학적 조성물은 비경구 투여시 피하주사, 정맥주사 또는 근육내 주사를 통할 수 있다.Amorphastilball or 5,7-dihydroxy-6-geranylflavanone, which is a compound of the present invention, the extract of the wild locust, fractions thereof, or a compound isolated from the fractions can be administered orally or parenterally during clinical administration. It can be used in the form of a general pharmaceutical formulation. That is, the pharmaceutical composition for preventing and treating diseases regulated by the PPARγ and / or PPARα action of the present invention may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, commonly used fillers. And diluents or excipients such as extenders, binders, wetting agents, disintegrating agents and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules and capsules, and the like, which may be used in the pharmaceutical composition of the present invention at least one excipient such as starch, calcium carbonate, sucrose, lactose And gelatin etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups, and may include various excipients such as wetting agents, sweeteners, fragrances and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol and gelatin may be used. The pharmaceutical composition for preventing and treating diseases regulated by the PPARγ and / or PPARα action of the present invention may be via subcutaneous injection, intravenous injection or intramuscular injection during parenteral administration.
본 발명의 약학적 조성물을 랫트에 경구 투여하여 독성 실험을 수행한 결과, 경구 투여 독성시험에 의한 50% 치사량(LD50)은 적어도 5 g/kg 이상인 안전한 물질로 판단되며, 개별 투약량은 해당 질병에 대해 의사가 처방하는 범위에서 달라질 수 있다. 본 발명의 약학적 조성물은 PPARγ 및/또는 PPARα 작용에 의해 조절되는 질환 예방 및 치료를 위하여 단독으로, 또는 수술, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.As a result of toxicity experiments conducted by oral administration of the pharmaceutical composition of the present invention to rats, the 50% lethal dose (LD 50 ) by oral administration toxicity test is judged to be a safe substance of at least 5 g / kg or more, and the individual dosage is applicable to the disease. It can vary from the doctor's prescription for. The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, hormone therapy, chemotherapy and biological response modifiers for the prevention and treatment of diseases regulated by PPARγ and / or PPARα action.
또한, 본 발명은 상기 제조방법에 의하여 제조된 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 당뇨, 비만, 대사성 질환, 심혈관계 질환 및 피부질환으로 구성되는 군으로부터 선택된 어느 하나의 질환 예방 및 개선용 건강식품을 제공한다. In addition, the present invention is an active ingredient to the mindonggashi extract, fractions thereof, or a compound separated from the fractions prepared by the above production method, amorphastilball or 5,7-dihydroxy-6-geranylflavanone Provided is a health food for preventing and ameliorating any one disease selected from the group consisting of diabetes, obesity, metabolic disease, cardiovascular disease and skin disease, which are controlled by the PPAR action.
본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 발명의 약학적 조성물은 원료에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다. The extract of Mindonggashokja of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone, may be added as it is or may be used with other food or food ingredients. It can be used suitably according to a conventional method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment). Generally, in the preparation of food or beverages, the pharmaceutical compositions of the present invention are added in an amount of up to 15 parts by weight, preferably up to 10 parts by weight based on the raw materials. However, in the case of long-term intake for health and hygiene or health control purposes, the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.There is no particular limitation on the kind of food. Examples of the food to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, Alcoholic beverages and vitamin complexes, and the like and include all of the health foods in the conventional sense.
본 발명의 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천 연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다.The health beverage composition of the present invention may contain various flavors, natural carbohydrates, and the like as additional components, as in general beverages. The above-mentioned natural carbohydrates are glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used.
상기 외에 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 여러가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부당 0.01 ~ 0.1 중량부의 범위에서 선택되는 것이 일반적이다.In addition to the extract of the present invention, Min Dong-Agashi extract, fractions thereof, or a compound separated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone, various nutrients, vitamins, electrolytes, flavors, Colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. In addition, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound separated from the fraction, amorphastilball or 5,7-dihydroxy-6-geranylflavanone may be used as a natural fruit juice, fruit juice beverage or vegetable beverage. It may contain pulp for manufacture. These components can be used independently or in combination. The proportion of such additives is not critical but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
아울러, 본 발명은 상기 제조방법에 의하여 제조된 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논을 유효성분으로 함유하는 PPAR 작용에 의해 조절되는 피부노화, 저탄력, 주름, 피부건조 및 각질형성으로 이루어진 군으로부터 선택된 어느 하 나의 질환 예방 및 개선용 피부 외용제를 제공한다.In addition, the present invention is an active ingredient to the mindonggashi extract prepared by the above method, fractions thereof, or the compound separated from the fractions, amorphastilball or 5,7-dihydroxy-6-geranylflavanone Provided is a skin external preparation for preventing and ameliorating any one disease selected from the group consisting of skin aging, low elasticity, wrinkles, skin drying and keratinogenesis controlled by the PPAR action.
상기 피부외용제에는 상기 필수성분 이외에 통상 화장품이나 의약품등의 피부외용제에 사용되는 성분, 예컨대 수성성분, 유성성분, 분말성분, 알코올류, 보습제, 증점제, 자외선흡수제, 미백제, 방부제, 산화방지제, 계면활성제, 향료, 색제, 각종 피부 영양제등을 필요에 따라서 적절하게 배합할 수 있다.In addition to the essential ingredients, the skin external preparations are commonly used in skin external preparations such as cosmetics and pharmaceuticals, such as aqueous components, oily ingredients, powder components, alcohols, humectants, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, and surfactants. , Fragrances, colorants, and various skin nutrients can be appropriately blended as needed.
그밖에, 에데트산이나트륨, 에데트산삼나트륨, 시트르산나트륨, 폴리인산나트륨, 메타인산나트륨, 글루콘산 등의 금속봉쇄제, 카페인, 탄닌, 벨라파밀, 감초추출물, 글라블리딘, 칼린의 과실의 열수추출물, 각종생약, 아세트산토코페롤, 글리틸리틴산, 트라넥삼산 및 그 유도체 또는 그 염등의 약제, 비타민 C, 아스코르브산인산마그네슘, 아스코르브산글루코시드, 알부틴, 코지산, 글루코스, 프룩토스, 트레할로스 등의 당류등도 적절하게 배합할 수 있다.In addition, hydrothermal decay of metals such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, gluconic acid, caffeine, tannin, bellafamil, licorice extract, glablidine, and caline Extracts, various herbal medicines, tocopherol acetate, glytilinic acid, tranexamic acid and derivatives thereof or salts thereof, vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, trehalose, etc. Sugars etc. can also be mix | blended suitably.
상기 피부외용제는 크림, 겔, 연고, 피부 유화액, 피부 현탁액, 경피전달성 패치, 약물 함유 붕대일 수 있다. The external skin preparation may be a cream, gel, ointment, skin emulsion, skin suspension, transdermal patch, drug-containing bandage.
상기 피부외용제는 임상 투여시에 약제학적으로 허용가능한 통상의 담체, 부형제, 결합제, 붕해제, 가용화제, 현탁화제, 보존제 또는 증량제 등을 사용하여 조제할 수 있다. 상기 피부외용제에서, 본 발명의 조성물의 유효용량은 0.01 내지 300 mg/cm2이고, 바람직하게는 10 내지 50 mg/cm2이며, 하루 1 ~ 4 회 투여될 수 있다. 단, 특정 환자에 대한 투여용량 수준은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율, 질환의 중증도 등에 따라 변화될 수 있다.The external skin preparation may be prepared by using conventional carriers, excipients, binders, disintegrants, solubilizers, suspending agents, preservatives or extenders, etc., which are pharmaceutically acceptable at the time of clinical administration. In the external application for skin, the effective dose of the composition of the present invention is 0.01 to 300 mg / cm 2 , preferably 10 to 50 mg / cm 2 , may be administered 1 to 4 times a day. However, the dosage level for a particular patient may vary depending on the weight, age, sex, health status, diet, time of administration, administration method, excretion rate, severity of the disease, and the like of the patient.
이하, 본 발명을 실시예, 실험예 및 제제예에 의하여 상세히 설명한다.Hereinafter, the present invention will be described in detail by Examples, Experimental Examples and Formulation Examples.
단, 하기 실시예, 실험예 및 제제예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 실시예, 실험예 및 제제예에 의해 한정되는 것은 아니다.However, the following Examples, Experimental Examples, and Formulation Examples specifically illustrate the present invention, and the content of the present invention is not limited to Examples, Experimental Examples, and Formulation Examples.
<< 실시예Example 1> 1> 민둥아까시Min Dong 지상부 추출물의 제조 Preparation of Ground Extract
본 발명에서 사용된 민둥아까시나무는 대관령 고랭지에서 자생하고 있는 것을 사용하였으며, 지상부, 뿌리, 종자부분을 나누어서 추출하여 사용하였다.Mindong bark tree used in the present invention was used that is native to Daegwallyeong highland, and was used by dividing the ground portion, root, seed portion.
<1-1> <1-1> 민둥아까시Min Dong 지상부의 메탄올 추출물의 제조 Preparation of Methanol Extracts from Above Ground
잎과 잔가지, 줄기를 포함한 민둥아까시나무 지상부 100 g을 100 % 메탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 12.5 g을 얻었다. 100 g of the leaves of the leaves of twigs, including the stems and stems, were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.5 g of concentrate.
<1-2> <1-2> 민둥아까시Min Dong 지상부의 Above ground 물 water 추출물의 제조 Preparation of Extract
잎과 잔가지, 줄기를 포함한 민둥아까시나무 지상부 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 9.5 g을 얻었다. 100 g of the leaves of twigs of M. locust, including leaves, twigs and stems, were immersed in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.5 g of concentrate.
<1-3> <1-3> 민둥아까시Min Dong 지상부의 에탄올 추출물의 제조 Preparation of Ethanol Extracts from Above Ground
상기 민둥아까시나무 지상부 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 10.5 g을 얻었다. 100 g of the ground ash tree was dipped in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.5 g of concentrate.
<< 실시예Example 2> 2> 민둥아까시Min Dong 뿌리 추출물의 제조 Preparation of Root Extract
<2-1> <2-1> 민둥아까시Min Dong 뿌리의 메탄올 추출물의 제조 Preparation of Methanol Extracts of Roots
민둥아까시나무 뿌리 100 g을 100 % 메탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 11.2 g을 얻었다. 100 g of bark roots were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 11.2 g of concentrate.
<2-2> <2-2> 민둥아까시Min Dong 뿌리의 Root 물 water 추출물의 제조 Preparation of Extract
민둥아까시나무 뿌리 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 9.3 g을 얻었다. 100 g of the barberry roots were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.3 g of concentrate.
<2-3> <2-3> 민둥아까시Min Dong 뿌리의 에탄올 추출물의 제조 Preparation of Ethanol Extract of Roots
민둥아까시나무 뿌리 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 10.0 g을 얻었다. 100 g of bark roots were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.0 g of concentrate.
<< 실시예Example 3> 3> 민둥아까시Min Dong 종자 추출물의 제조 Preparation of Seed Extract
<3-1> <3-1> 민둥아까시Min Dong 종자의 메탄올 추출물의 제조 Preparation of Methanol Extracts of Seeds
잘 익은 민둥아까시나무 종자 100 g을 100 % 메탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 14.7 g을 얻었다. 100 g of ripe bark seeds were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 14.7 g of concentrate.
<3-2> <3-2> 민둥아까시Min Dong 종자의 Seed 물 water 추출물의 제조 Preparation of Extract
잘 익은 민둥아까시나무 종자 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 10.7 g을 얻었다. 100 g of ripe bark seeds were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.7 g of concentrate.
<3-3> <3-3> 민둥아까시Min Dong 종자의 에탄올 추출물의 제조 Preparation of Ethanol Extracts of Seeds
잘 익은 민둥아까시나무 종자 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압건조하여 농축하여 농축물 12.7 g을 얻었다. 100 g of ripe bark seeds were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.7 g of concentrate.
<< 실시예Example 4> 4> 민둥아까시Min Dong 추출물로부터 From extract 분획물의Fraction 제조 Produce
<4-1> <4-1> 분획물의Fraction 제조 Produce
상기 실시예<3-1>의 추출물을 디클로로메탄으로 2회 환류 추출한 후, 디클로로메탄 가용층을 버리고, 다시 메탄올로 2회 환류 추출하여 얻은 추출액을 감압건조하여 농축하여 분획물 11 g을 수득하였다.After extracting the extract of Example 3-1 under reflux with dichloromethane twice, the dichloromethane soluble layer was discarded, and the extract obtained by refluxing twice with methanol was dried under reduced pressure and concentrated to give 11 g of a fraction.
<4-2> 활성 <4-2> active 분획물의Fraction 제조 Produce
상기 분획물 중 7 g을 이산화규소 7 g과 흡착하여 플래쉬 컬럼(flash column)크로마토그래피(직접 제작)를 실시하였다. 상기 플래쉬 컬럼크로마토그래피는 충진제로는 Lichroprep RP-18(40-63 μm, MERCK, USA)을 사용하였으며, 시료는 celite(Diatomaceous earth, approx. 95%, Sigma, USA)에 흡착하여 적재(loading)하였다. 물에 대한 아세토나이트릴의 농도 60 %를 초기용매로 하여 100 %까지 10 %씩 농도구배(gradient)에서 중력에 의한 유속으로 각 분획물을 얻었다. 상기 각 조건의 분획물 중 농도구배 80 %일 때 분획물의 활성이 우수했다.7 g of the fraction was adsorbed with 7 g of silicon dioxide to perform flash column chromatography (manufacture). The flash column chromatography used Lichroprep RP-18 (40-63 μm, MERCK, USA) as a filler, the sample is loaded by adsorption on celite (Diatomaceous earth, approx. 95%, Sigma, USA) It was. Each fraction was obtained by gravitational flow rate in a gradient of 10% up to 100% with acetonitrile concentration of 60% in water as an initial solvent. The activity of the fraction was excellent when the concentration gradient of 80% in the fraction of each condition.
<< 실시예Example 5> 5> 아몰파스틸볼의Amorphous steel ball 분리 detach
상기 아세토니트릴 농도구배 80 %에서 수득한 분획물을 HPLC(분석용 HPLC, Waters 2996 Photodiode Array Detector, UV 210nm)로 분석하였다. 물에 대한 아세토나이트릴의 농도 10 %로부터 100 %의 농도구배 조건으로 페노메넥스 루나(Phenomenex Luna) 10 μm C18 컬럼으로 평균유속 분당 1ml로 하여 60 분 동안 조제(preparation)하여 26 분대에 분리되어 나오는 화합물을 수득하였다(도 6 참조). Fractions obtained at the acetonitrile concentration gradient 80% were analyzed by HPLC (analytic HPLC, Waters 2996 Photodiode Array Detector, UV 210 nm).
상기 화합물을 NMR(1H 및 13C-NMR, Varian 500MHz spectrometer, Varian USA)로 그 구조를 확인한 결과 26 분대에 분리되어 나오는 화합물은 아몰파스틸볼(Amorphastilbol)임을 확인되었다.Results confirmed the structure the compound NMR (1 H and 13C-NMR, Varian 500MHz spectrometer, Varian USA) compound is separated out on the component 26 has been confirmed that amorphastilbol Oh steel ball (Amorphastilbol).
<< 실시예Example 6> 5,7- 6> 5,7- 디하이드록시Dihydroxy -6--6- 게라닐Geranil 플라바논의Flavanese 분리 detach
상기 아세토니트릴 농도구배 80 %에서 수득한 분획물을 HPLC(분석용 HPLC, Waters 2996 Photodiode Array Detector, UV 210nm)로 분석하였다. 물에 대한 아세토나이트릴의 농도 10 %로부터 100 %의 농도구배 조건으로 페노메넥스 루나(Phenomenex Luna) 10 μm C18 컬럼으로 평균유속 분당 1ml로 하여 60 분 동안 조제(preparation)하여 29 분대에 분리되어 나오는 화합물을 수득하였다(도 6 참조).Fractions obtained at the acetonitrile concentration gradient 80% were analyzed by HPLC (analytic HPLC, Waters 2996 Photodiode Array Detector, UV 210 nm).
상기 화합물을 NMR(1H 및 13C-NMR, Varian 500MHz spectrometer, Varian USA)로 그 구조를 확인한 결과 29 분대에 분리되어 나오는 화합물은 5,7-디하이드록시-6-게라닐플라바논(5,7-Dihydroxy-6-geranyl flavanone)임을 확인하였다.The compound was identified by NMR ( 1 H and 13 C-NMR,
<< 실험예Experimental Example 1> 지방 및 당대사에 관여하는 1> Engaged in local and party metabolism PPARPPAR γ(γ ( PeroxisomePeroxisome ProliferatorProliferator ActivatedActivated Receptor Receptor gammagamma ) 활성화 실험Activation experiment
플라스미드(Plasmid)는 일반적인 배양 조건에서도 발현되는 유니버셜 프로모터(universal promoter) 뒤에 PPARγ 유전자를 지닌 것, 리간드 결합형의 PPARγ가 결합하여 활성화되는 PPRE(PPARs Response Element)를 프로모터로 가지고 뒤에 리 포터로서 역할을 하는 반디불 루시퍼라아제(firefly luciferase) 유전자를 지닌 것 그리고 레퍼런스(reference)로 사용될 유니버셜 프로모터에 레닐라 루시퍼라아제(Renilla luciferase) 유전자가 결합된 플라스미드(pRL-SV40, Promega, USA)가 사용되었다(KLIEWER SA., Proc . Nadl . Acad . Sci . USA, 91: 7355-7359, 1994).Plasmids have a PPARγ gene after a universal promoter, which is expressed even in normal culture conditions, and PPRE (PPARs Response Element), which is activated by binding of ligand-binding PPARγ, as a promoter. A plasmid (pRL-SV40, Promega, USA) with a firefly luciferase gene and a Renilla luciferase gene bound to a universal promoter to be used as a reference were used. KLIEWER SA., Proc . Nadl . Acad . Sci . USA, 91: 7355-7359, 1994).
CV-1 세포(CCL-70, ATCC)를 5x104의 농도로 24-웰(well)형 플레이트에 깐 후 24 시간 배양 후 상기 세 종류의 플라즈미드 유전자를 일시적 주입법(transient transfection) 하였다. 이후 24시간 동안 배양한 후 1 x 인산완충식염수(Phosphate Buffered Saline, PBS)로 세척하였다. 하기 후보물질들을 농도별로 처리 24시간 배양한 후 1 x PBS로 세척한 후 1 x 수동 라이시스 버퍼(Passive Lysis Buffer, PLB)로 세포를 깬 후 듀얼-루시퍼라아제 수용체 분석 시스템 키트(dual-LuciferaseR Reporter Assay System kit, Promega, USA)를 사용하여 샘플과 레퍼런스의 루시퍼라아제 활성(luciferase activity)을 측정하였다. 본 실험에서 양성대조군은 PPARγ의 리간드 중 하나로 알려진 트로글리타존(Troglitazone)을 사용하였고 음성대조군은 무처리군으로 하였다. 음성 대조군의 활성화 정도를 100으로 하여 비교치를 나타내었다. CV-1 cells (CCL-70, ATCC) were placed on a 24-well plate at a concentration of 5 × 10 4 and cultured for 24 hours, followed by transient transfection of the three plasmid genes. After incubation for 24 hours and washed with 1 x Phosphate Buffered Saline (PBS). The following candidates were treated by concentration for 24 hours, washed with 1 x PBS, and then cells were crushed with 1 x Passive Lysis Buffer (PLB), followed by a dual-luciferase receptor assay system kit (dual-Luciferase). R The luciferase activity of the samples and the reference was measured using the Reporter Assay System kit (Promega, USA). In this experiment, the control group used troglitazone, which is known as one of the ligands of PPARγ, and the control group was treated as the untreated group. A comparison was shown with the activation degree of the negative control group being 100.
그 결과 표 1 및 도 1에 나타난 바와 같이 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 상기 물질들을 처리하지 않은 대조군에 비해 처리하였을 때 PPAR γ의 활성화 정도가 더욱 높은 수치를 나타내었으며, 처리량이 높을수록 수치가 더 높아졌음을 확인하였다. 따라서 본 발명의 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물은 PPAR γ를 활성화시키는 경향을 보였으므로 지방 및 당 대사 개선 역할을 하는 우수한 성분들임을 알 수 있었다.As a result, as shown in Table 1 and FIG. 1, the extract of Mindung-Ashok, fractions thereof, or a compound separated from the fractions, Amorphpathyl Ball or 5,7-dihydroxy-6-geranylflavanone, were treated with the substances. When compared to the control group did not control the PPAR γ showed a higher activation level, the higher the throughput was confirmed that the higher the value. Therefore, the extract of Mindonggashashi of the present invention, a fraction thereof, or a compound isolated from the fraction is Since it showed a tendency to activate PPAR γ, it can be seen that it is an excellent component that serves to improve fat and sugar metabolism.
<< 실험예Experimental Example 2> 지방세포분화실험 2> Adipocyte Differentiation Experiment
마우스 전지방세포(preadipocyte)인 3T3L1 세포(CL-173, ATCC)를 6-웰 플레이트(well plate)에 well 당 3 X 105 개의 농도로 깔고, 48 시간 후 최종농도가 덱사메타손(dexamethasone) 1 uM, 인슐린(insulin) 10 ug/ml, 이소부틸메틸크산틴(isobutylmethylxantine, IBMX) 500 uM을 함유한 분화배지(differentiation media)로 교환해주었다. 이때, 분화군은 분화만 시킨 군이고, 양성대조군은 트로글리타존(troglitazone) 및 화합물은 각각 10 uM 농도로 동시에 처리하였다. 48 시간 후에 인슐린(insulin) 10 ug/ml와 양성대조군 및 실험에 사용한 시료를 함유한 배지로 교환해주었다. 이후 48 시간마다 배지를 교체해주며, 분화의 진행정도를 체크하였다. 분화가 진행된 후 진행된 정도는 오일 레드 O(Oil red O) 염색을 통해 확인하였다. 상기 오일 레드 O 염색은 분화된 세포를 37 ℃의 인산완충식염수(phosphate buffered saline, PBS)으로 2 회 세척하고 3.7% 포르말린(in PBS)으로 상온에서 30 분간 고정하였다. 그 후 포르말린을 제거하고 고정된 세포를 PBS로 2회, 70 % 에탄올로 1회 씻어 준 후 오일 레드 O(이소프로판올에 0.5 %로 제조한 후 사용할 때마다 stock : DDW = 6 : 4로 희석하여 사용)로 상온에서 30 분 동안 염색한 후 현미경을 사용하여 염색된 정도를 관찰하였다.3T3L1 cells (CL-173, ATCC), which are mouse preadipocytes, were spread on a 6-well plate at a concentration of 3 X 10 5 per well, and after 48 hours, the final concentration was 1 uM of dexamethasone. It was exchanged with differentiation media containing 10 ug / ml insulin and 500 uM of isobutylmethylxantine (IBMX). At this time, the differentiation group was only differentiated, and the positive control group was treated simultaneously with the concentration of troglitazone (troglitazone) and the compound at 10 uM. After 48 hours, the cells were replaced with a medium containing 10 ug / ml of insulin and a positive control group and the samples used in the experiment. After that, the medium was changed every 48 hours, and the progress of differentiation was checked. After the differentiation progressed, the progress was confirmed by oil red O (Oil red O) staining. The oil red O staining was performed to wash the differentiated cells twice with phosphate buffered saline (PBS) at 37 ℃ and fixed for 30 minutes at room temperature with 3.7% formalin (in PBS). Thereafter, formalin was removed and the fixed cells were washed twice with PBS and once with 70% ethanol, and then used with oil red O (0.5% in isopropanol and diluted with stock: DDW = 6: 4 whenever used). ) And dyeing at room temperature for 30 minutes and then observed the degree of staining using a microscope.
그 결과 도 2에서 나타나는 바와 같이 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논를 처리한 각 군은 트로글리타존(troglitazone)을 처리한 만큼의 지방축적효능을 보였으므로 지방대사 개선에 아주 유효한 성분임을 알 수 있었다(도 2 참조). As a result, as shown in Figure 2, each group treated with amorphastilball and 5,7-dihydroxy-6-geranyl flavanone showed the fat accumulation effect as treated with troglitazone (fat metabolism) It was found to be a very effective ingredient for improvement (see FIG. 2).
<< 실험예Experimental Example 3> 3> PPARPPAR γ 및 지방세포분화에 관련된 유전자들의 발현γ and expression of genes involved in adipocyte differentiation
마우스 전지방세포(preadipocyte)인 3T3L1 세포를 60 파이 디쉬(dish)에 5 X 105 개의 농도로 깔고, 48 시간 후 최종농도가 덱사메타손(dexamethasone) 1 uM, 인슐린(insulin) 10 ug/ml, IBMX 500 uM을 함유한 분화배지(differentiation media)로 교환해주었다. 이때, 분화군은 분화만 시킨 군이고, 양성대조군은 트로글리타존(troglitazone) 10 uM, 나머지는 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 각 10 uM씩 동시에 처리하였다. 48시간 후에 인슐린(insulin) 10 ug/ml와 양성대조군 및 실험에 사용한 시료를 함유한 배지로 교환해주었다. 이후 48 시간마다 배지를 교체해주며, 분화의 진행 정도를 체크하였다. 분화가 진행된 후 트리졸(trizol)을 이용하여 전체 RNA를 추출하고, RT-PCR을 통해 지방세포 분화 관련 유전자들의 발현정도를 확인하였다. 상기 RT-PCR에서 역전사(reverse transcription)는 시중에 판매되는 키트(reverse transcription system, Promega)를 사용하여 수행하였으며, PCR은 변성(denaturation)은 94℃, 1분, 풀림(annealing)은 54℃, 1분, 연장(extension)은 72℃, 1분씩 총 30 사이클(cycle)로 수행하였다. PCR에 사용된 프라이머(primer)들은 아래와 같다.3T3L1 cells, which are mouse preadipocytes, were plated at 5 x 10 5 in 60 pie dishes, and after 48 hours the final concentration was 1 uM of dexamethasone, 10 ug / ml of insulin, and IBMX. Exchange was carried out with differentiation media containing 500 uM. At this time, the differentiation group was a group that differentiated only, the positive control group was treated with 10 uM of troglitazone (troglitazone) and the remainder was simultaneously treated with 10 uM of amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone. . After 48 hours, the cells were replaced with a medium containing 10 ug / ml of insulin and a positive control group and the samples used in the experiment. Thereafter, the medium was changed every 48 hours, and the progress of differentiation was checked. After differentiation progressed, total RNA was extracted using trizol, and the expression level of adipocyte differentiation-related genes was confirmed by RT-PCR. Reverse transcription in the RT-PCR was performed using a commercially available kit (reverse transcription system, Promega), PCR denatured (denaturation) 94 ℃, 1 minute, annealing (54 ℃), One minute, extension was performed at 72 ° C., one minute for a total of 30 cycles. Primers used for PCR are as follows.
PPARPPAR γγ
포워드(forward) 5' ttcgctgatgcactgcctat 3'(서열번호 1)Forward 5 'ttcgctgatgcactgcctat 3' (SEQ ID NO: 1)
리버스(reverse) 5' gccaacagcttctccttctc 3'(서열번호 2)Reverse 5 'gccaacagcttctccttctc 3' (SEQ ID NO: 2)
C/C / EBPEBP αα
포워드(forward) 5' aggtgctggagttgaccagt 3'(서열번호 3)Forward 5 'aggtgctggagttgaccagt 3' (SEQ ID NO: 3)
리버스(reverse) 5' cagcctagagatccagcgac 3'(서열번호 4)Reverse 5 'cagcctagagatccagcgac 3' (SEQ ID NO: 4)
Ap2Ap2
포워드(forward) 5' atgtgtgatgcctttgtggga 3'(서열번호 5)Forward 5 'atgtgtgatgcctttgtggga 3' (SEQ ID NO: 5)
리버스(reverse) 5' tgccctttcataaactcttgt 3'(서열번호 6)Reverse 5 'tgccctttcataaactcttgt 3' (SEQ ID NO: 6)
AdiponectinAdiponectin
포워드(forward) 5' agcctggagaagccgcttat 3'(서열번호 7)Forward 5 'agcctggagaagccgcttat 3' (SEQ ID NO: 7)
리버스(reverse) 5' ttgcagtagaacttgccagtgc 3'(서열번호 8)Reverse 5 'ttgcagtagaacttgccagtgc 3' (SEQ ID NO: 8)
FasFas
포워드(forward) 5' ctgcgtggctatgattatggc 3'(서열번호 9)Forward 5 'ctgcgtggctatgattatggc 3' (SEQ ID NO: 9)
리버스(reverse) 5' cgtgaggttgctgtcgtctgt 3'(서열번호 10)Reverse 5 'cgtgaggttgctgtcgtctgt 3' (SEQ ID NO: 10)
GLUT4GLUT4
포워드(forward) 5' tcgtcattggcattctggtt 3'(서열번호 11)Forward 5 'tcgtcattggcattctggtt 3' (SEQ ID NO: 11)
리버스(reverse) 5' ggtcatcaagatggcacagc 3'(서열번호 12)Reverse 5 'ggtcatcaagatggcacagc 3' (SEQ ID NO: 12)
ResistinResistin
포워드(forward) 5' tcaactccctgtttccaaatgc 3'(서열번호 13)Forward 5 'tcaactccctgtttccaaatgc 3' (SEQ ID NO: 13)
리버스(reverse) 5' tcttcacgaatgtcccacga 3'(서열번호 14)Reverse 5 'tcttcacgaatgtcccacga 3' (SEQ ID NO: 14)
GAPDHGAPDH
포워드(forward) 5' accacagtccatgccatcac 3'(서열번호 15)Forward 5 'accacagtccatgccatcac 3' (SEQ ID NO: 15)
리버스(reverse) 5' tccaccaccctgttgctgta 3'(서열번호 16)Reverse 5 'tccaccaccctgttgctgta 3' (SEQ ID NO: 16)
그 결과 도 3에서 보이는 것처럼 PPARγ및 이와 관련 유전자인 C/EBPα(CCAAT Enhancer Binding Protein Alpha), Ap2(Adipocyte fatty acid-binding protein 2), 아디포넥틴(Adiponectin), 지방산 합성효소(fatty acid synthase, Fas), 글루코즈 트랜스포터 4(Glucose transporter 4, GLUT4), 레지스틴(Resistin)은 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 처리한 각 군에서 양성대조군으로 사용한 트로글리타존(Troglitazone) 만큼 증가함을 확인함으로써, 당 및 지방 대사에 관여함을 알 수 있었다.As a result, as shown in Figure 3 PPARγ and its related genes C / EBPα (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), Adiponectin, Fatty acid synthase (Fass) , Glucose transporter 4 (GLUT4), Resistin (Resistin) is a troglitazone (Troglitazone) used as a positive control in each group treated with amorphastilball and 5,7-dihydroxy-6-geranylflavanone By confirming the increase by), it can be seen that it is involved in sugar and fat metabolism.
<< 실험예Experimental Example 4> 4> 피부세포Skin cells 분화촉진/증식억제 및 지질 생합성 촉진과 항염에 있어 역할을 하는 Promotes differentiation / proliferation, promotes lipid biosynthesis and plays a role in anti-inflammatory PPARPPAR α(α ( PeroxisomePeroxisome ProliferatorProliferator ActivatedActivated ReceptorReceptor alphaalpha ) 활성화 시험Activation test
플라즈미드(Plasmid)는 PPARγ 대신 PPARα를 사용하고 상기 실험예 1에서 사용한 것과 동일한 것을 사용하였다.Plasmid used PPARα instead of PPARγ and the same one used in Experimental Example 1 above was used.
CV-1 세포를 5x104의 농도로 24-웰(well)형 플레이트에 깐 후 24시간 배양 후 상기 세 종류의 플라즈미드 유전자를 일시적 주입(transient transfection) 하였다. 이후 24시간 배양 후 1 x 인산완충식염수(Phosphate Buffered Saline, PBS)로 세척한 후, 본 발명의 물질들을 농도별로 처리 24시간 배양 후 1xPBS로 세척 후 1xPLB로 세포를 깬 후 듀얼-루시퍼라아제 수용체 분석 시스템 키트(Dual-Luciferase® Reporter Assay System kit, Promega, USA)를 사용하여 사용자 지시서에 따라 샘플과 레퍼런스(reference)의 루시퍼라아제 활성(luciferase activity)을 측정하였다. 본 실험에서 양성대조군은 PPARα의 리간드 중 가장 강력한 것으로 알려진 Wy-14,643(Sigma, USA)을 사용하였고 음성대조군은 무처리군으로 하였다.CV-1 cells were placed on 24-well plates at a concentration of 5 × 10 4 , and then cultured for 24 hours, followed by transient transfection of the three kinds of plasmid genes. After 24 hours of incubation, 1 x phosphate buffered saline (Phosphate Buffered Saline, PBS), washed with the material of the present invention for 24 hours after incubation with 1xPBS after washing for 24 hours after breaking the cells with 1xPLB dual-luciferase receptor The luciferase activity of the samples and references was measured according to user instructions using an assay system kit (Dual-Luciferase ® Reporter Assay System kit, Promega, USA). In this experiment, the positive control group used Wy-14,643 (Sigma, USA), which is known to be the strongest of PPARα ligands, and the negative control group was untreated.
그 결과 표 2 및 도 4에 나타나는 바와 같이 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 상기 물질들을 처리하지 않은 대조군에 비해 처리하였을 때 PPAR α의 활성화 정도가 더욱 높은 수치를 나타내었으며, 처리량이 높을수록 수치가 더 높아졌음을 확인하였다. As a result, as shown in Table 2 and FIG. 4, the extract of Mindung-Ashok, fractions thereof, or a compound separated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, were treated with the substances. Compared with the control group, the PPAR α activation level was higher than that of the control group, and the higher the throughput, the higher the level.
<< 실험예Experimental Example 5> 5> PPARPPAR α 및 지방산 산화에 관련된 유전자들의 발현Expression of genes involved in α and fatty acid oxidation
사람의 간암세포주인 HepG2 세포(HB-8065, ATCC, USA)를 60 파이 디쉬(dish)에 1 X 106 개의 농도로 깔고, 24시간 후 최종농도가 10 uM이 되게 양성대조군인 Wy-14,643, 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 각각 처리하였다. 24시간 후에 트리졸(trizol)을 이용하여 전체 RNA를 추출하고, RT-PCR을 통해 지방산 산화 관련 유전자들의 발현 정도를 확인하였다. 상기 RT-PCR에서 역전사(reverse transcription)는 시중에 판매되는 키트(reverse transcription system, Promega)를 사용하여 수행하였으며, PCR은 변성(denaturation)은 94℃, 1분, 풀림(annealing)은 54℃, 1분, 연장(extension)은 72℃, 1분씩 총 30 사이클(cycle)로 수행하였다. PCR에 사용된 프라이머(primer)들은 아래와 같다.HepG2 cells (HB-8065, ATCC, USA), a human hepatocellular carcinoma cell line, were placed in 60 pie dishes at a concentration of 1
PPARPPAR αα
포워드(forward) 5' acggaaagcccactctgccccctctc 3'(서열번호 17)Forward 5 'acggaaagcccactctgccccctctc 3' (SEQ ID NO: 17)
리버스(reverse) 5' cttgtccccgcagattctacattcg 3'(서열번호 18)Reverse 5 'cttgtccccgcagattctacattcg 3' (SEQ ID NO: 18)
CPT1CPT1 αα
포워드(forward) 5' agacggtggaacagaggctgaag 3'(서열번호 19)Forward 5 'agacggtggaacagaggctgaag 3' (SEQ ID NO: 19)
리버스(reverse) 5' tgagaccaaacaaagtgatgatgtcag 3'(서열번호 20)Reverse 5 'tgagaccaaacaaagtgatgatgtcag 3' (SEQ ID NO: 20)
ACO2ACO2
포워드(forward) 5' gcggacatggctactcaaagc 3'(서열번호 21)Forward 5 'gcggacatggctactcaaagc 3' (SEQ ID NO: 21)
리버스(reverse) 5' gcagtgcaccttagcagcctg 3'(서열번호 22)Reverse 5 'gcagtgcaccttagcagcctg 3' (SEQ ID NO: 22)
GAPDHGAPDH
포워드(forward) 5' accacagtccatgccatcac 3'(서열번호 23)Forward 5 'accacagtccatgccatcac 3' (SEQ ID NO: 23)
리버스(reverse) 5' tccaccaccctgttgctgta 3'(서열번호 24)Reverse 5 'tccaccaccctgttgctgta 3' (SEQ ID NO: 24)
그 결과 도 5에서 나타나는 바와 같이 PPARα 및 이와 관련된 유전자인 CPT1α(Carnitine Palmitoyl Transferase I alpha), ACO2(Acyl-CoA Oxidase 2)는 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 처리한 각 군은 양성대조군으로 사용한 Wy-14643을 처리한 군만큼 증가함을 확인함으로써, 지방산 산화에 관여함을 알 수 있었다.As a result, as shown in FIG. 5, PPARα and its related genes, CPT1α (Carnitine Palmitoyl Transferase I alpha) and ACO2 (Acyl-CoA Oxidase 2), are amorphastyl ball and 5,7-dihydroxy-6-geranyl flap. Each group treated with banone increased as much as the group treated with Wy-14643 used as a positive control group, indicating that it was involved in fatty acid oxidation.
<< 실험예Experimental Example 6> 자외선에 의한 종양괴사인자 알파( 6> Tumor necrosis factor alpha (UV) TNFTNF α)의 생합성 억제 효능 측정 Determination of Biosynthesis Inhibitory Effect of α)
신생아 포피에서 직접 분리한 인체 각질형성세포를 105 개의 농도로 12공 평판배양기에 배양하고, 자외선 B를 30 mJ/cm2로 조사한 후, 각 시험물질을 10 uM, 추출물의 경우는 10 ppm 포함한 배지로 교체하였다. 배양 6 ~ 24 시간 후 세포를 수확(harvest)해서 ELISA(Pharmingen 555212) 방법을 사용하여 생성된 종양괴사인자 알파(TNF α)의 양을 정량하였다. 그 값은 자외선 대조군을 100으로 하여 비교치를 표 3에 나타내었다.Human keratinocytes directly isolated from neonatal foreskin were incubated in a 12-hole plate incubator at 10 5 concentrations, irradiated with UV B at 30 mJ / cm 2 , and each test substance contained 10 uM and 10 ppm for extract. Replaced with medium. After 6 to 24 hours of culture, the cells were harvested and the amount of tumor necrosis factor alpha (TNF α) generated was quantified using ELISA (Pharmingen 555212) method. The value is shown in Table 3 comparing the UV control to 100.
그 결과 표 3에 나타나는 바와 같이 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 자외선에 의한 종양괴사인자 알파의 생합성을 감소시켰음을 알 수 있다. As a result, as shown in Table 3, alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are tumor necrosis factor alpha. It can be seen that the biosynthesis of.
<< 실험예Experimental Example 7> 자외선에 의한 타입 I 7> Type I by UV 콜라게나제인Collagenase 메탈로프로테아즈Metalloproteinases -1(Metalloelastase-1,-1 (Metalloelastase-1, MMPMMP -1)의 생합성 억제 효능 측정-1) biosynthesis inhibition efficacy measurement
<7-1> <7-1> TNFTNF α와 α and MMPMMP -1의 관계측정-1 relationship measurement
신생아 포피에서 직접 분리한 1차세포(primary cell)인 인체 섬유아세포를 104 개의 농도로 48공 평판배양기에 배양하고, 24시간 후에 자외선 A를 15 J/cm2로 조사한 후, 종양괴사인자 알파에 대한 항체를 1 ug/ml 농도로 가하였다. 배양 2일째 상등액을 수확(harvest)해서 ELISA(AP biotech RPN2610) 방법을 사용하여 생성된 타입 I 콜라게나제의 양을 정량하였다. 그 값은 아무처리도 하지 않은 대조군을 100으로 한 비교치로 나타내었다.Human fibroblasts, primary cells directly isolated from neonatal foreskin, were cultured in a 48-hole plate incubator at 10 4 concentrations, and after 24 hours of irradiation with UV A at 15 J / cm 2 , the tumor necrosis factor alpha Antibody against was added at a concentration of 1 ug / ml. The supernatant was harvested on day 2 of culture and the amount of type I collagenase produced was quantified using ELISA (AP biotech RPN2610) method. The value was shown by the comparison value which made the control group which did not carry out 100.
그 결과 표 4에 나타나는 바와 같이, 자외선 A와 염증 매개 인자인 TNF α 처리시 타입 I 콜라게나제의 생합성이 증가됨을 확인할 수 있었으며, 자외선에 의한 타입 I 콜라게나제의 증가는 TNF α에 대한 항체를 처리 시 감소됨을 알 수 있다. 즉 자외선 A에 의해 염증 매개 인자인 TNF α가 증가하여 이로 인해 타입 I 콜라게나제가 증가하고, 중간 염증 매개 인자의 차단시 타입 I 콜라게나제의 생합성이 감소됨을 알 수 있었다. 신생아 섬유아세포에 PPARα 활성화제인 아래 시험물질 처리시 타입 I 콜라게나제의 생합성이 감소됨을 보았으며, 이는 다시 염증 매개인자인 TNF α 처리시 원래대로 회복됨을 보았다.As a result, as shown in Table 4, it was confirmed that the biosynthesis of type I collagenase increased by treatment with UVA and inflammatory mediator TNF α, and the increase of type I collagenase by UV light is due to the antibody against TNF α. It can be seen that the decrease in processing. In other words, it was found that TNF α, which is an inflammation mediator, increased due to ultraviolet rays A, thereby increasing type I collagenase and decreasing type I collagenase biosynthesis upon blocking of intermediate mediators. The treatment of neonatal fibroblasts with PPARα activator, the test substance below, reduced the biosynthesis of type I collagenase, which was restored to normal after treatment with inflammatory mediator TNFα.
<7-2> 각 시험물질과 <7-2> each test substance TNFTNF α의 관계 relationship of α
신생아 포피에서 직접 분리한 1차세포(primary cell)인 인체 섬유아세포를 104개의 농도로 48공 평판배양기에 배양하고, 24시간 후에 자외선 A를 15 J/cm2로 조사한 후, 각각의 시험물질 10 uM 또는 10 ppm씩을 함유한 배지로 갈아준 후 TNF α 10 ng/ml씩을 가하였다. 배양 2일째 상등액을 수확(harvest)해서 ELISA(AP biotech RPN2610) 방법을 사용하여 생성된 타입 I 콜라게나제의 양을 정량하였다. 그 값은 자외선 조사군을 100으로 한 비교치를 나타내었다.Human fibroblasts, primary cells directly isolated from neonatal foreskin, were incubated in a 48-hole plate incubator at 10 4 concentrations, irradiated with UV A at 15 J / cm 2 after 24 hours, and then tested. After changing to a medium containing 10 uM or 10 ppm each TNF α 10 ng / ml was added. The supernatant was harvested on day 2 of culture and the amount of type I collagenase produced was quantified using ELISA (AP biotech RPN2610) method. The value showed the comparison value which made the
그 결과 표 4 및 5에 나타난 바와 같이, 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 자외선에 의한 타입 I 콜라게나제의 생합성을 감소시키고, 이는 PPARα를 활성화시켜 염증 매개 인자의 생합성 감소에 영향을 줄 수 있음을 알 수 있었다.As a result, as shown in Tables 4 and 5, alfalfa extract, a fraction thereof, or a compound separated from the fraction, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, was typed by ultraviolet rays. It was found that reducing the biosynthesis of I collagenase, which may activate PPARα may affect the reduction of biosynthesis of inflammatory mediators.
<< 실험예Experimental Example 8> 피부 보습 및 수화에 관련된 유전자들의 발현 8> Expression of genes related to skin moisturizing and hydration
신생아 포피에서 직접 분리한 인체 각질형성세포를 106개의 농도로 100 파이 디쉬(dish)에 배양하고, 각 시험물질을 10 uM, 추출물의 경우는 10 ug/ml 포함한 배지로 교체하였다. 배양 24 시간 후 세포를 수확(harvest)해서 단백질을 얻었으며 단백질량은 BCA 키트(Pierce Biotechnology, USA)를 사용하여 정량하였다. 웨스턴블랏(Western Blot) 방법을 사용하여 생성된 필라그린(filaggrin)과 인볼루크린(Involucrin)의 양을 정량하였다. 상기 웨스턴블랏은 레인(lane) 당 30 ug의 단백질을 SDS-PAGE 겔에 적재(loading)하여 전기영동한 후 단백질 이동키트(transfer kit)(Invitrogen, USA)을 사용하여 PVDF 막(membrane)(Amersham, USA)으로 단백질을 이동시켰다. 이동 후 1차 항체로 각각 필라크린과 인볼루크린에 대한 항체(Santacruz Biotechnology, USA)를 37℃에서 1시간 정도 붙여주고, PBS로 3회 세척한 후 HRP가 붙은 2차 항체를 37℃에서 1시간 정도 붙여주고, PBS로 3회 세척 후 ECL 키트을 사용하여 그 발광정도를 필름에 노출시키고, 밴드의 강도를 덴시토미터(densitometer)를 사용하여 정량하였다. 그 값은 자외선 대조군을 100으로 하여 비교치를 나타내었다.Human keratinocytes directly isolated from neonatal foreskin were incubated in 100 pie dishes at 10 6 concentrations, and each test substance was replaced with a medium containing 10 uM and extracts of 10 ug / ml. After 24 hours of culture, cells were harvested to obtain protein, and the amount of protein was quantified using a BCA kit (Pierce Biotechnology, USA). Western Blot method was used to quantify the amount of filaggrin and Involucrin produced. The western blot was electrophoresed by loading 30 ug of protein per lane on an SDS-PAGE gel, followed by PVDF membrane (Amersham) using a protein transfer kit (Invitrogen, USA). , USA). After transfer, the antibody against pilarcrine and involukrin (Santacruz Biotechnology, USA) were attached at 37 ° C. for about 1 hour, washed three times with PBS, and the HRP-attached secondary antibody at 37 ° C. was used as the primary antibody. After attaching for about 3 hours, washing with PBS three times, the degree of luminescence was exposed to the film using the ECL kit, and the intensity of the band was quantified using a densitometer. The value was compared with the
그 결과 표 6에 나타난 바와 같이, 민둥아까시 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 각질형성세포에서 천연보습인자인 필라그린 및 인볼루크린의 생합성량을 증가시킴으로서 피부보습을 증진할 수 있음을 알 수 있었다. As a result, as shown in Table 6, the extract of Mindung-Ashok, fractions thereof, or the compound isolated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are naturally moisturized in keratinocytes. It was found that the skin moisturization can be enhanced by increasing the amount of biosynthesis of the filaggrin and involukrin factors.
<< 실험예Experimental Example 9> 9> 민둥아까시Min Dong 추출물, 이의 Extract, its 분획물Fraction 및 상기 And said 분획물에서In fractions 분리한 화합물의 경구투여 급성 독성실험 Acute Toxicity Test of Oral Administration of Isolated Compounds
본 발명자들은 민둥아까시 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물의 급성 독성을 알아보기 위하여 하기와 같은 실험을 수행하였다. 6주령의 특정병원부재(SPF) SD계 랫트를 사용하여 급성 독성실험을 실시하였다. 민둥아까시의 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물을 각각 0.5% 메틸셀룰로오스 용액에 현탁하여 5 g/kg/15 ㎖의 용량으로 단회 경구 투여하였다. 실험물질 투여 후 동물의 폐사 여부, 임상 증상, 체중 변화를 관찰하여 혈액학적 검사와 혈액 생화학적 검사를 실시하였으며, 부검하여 육안으로 복강장기와 흉강장기의 이상 여부를 관찰하였다.The present inventors performed the following experiment to determine the acute toxicity of the extract of Min Dong, the fractions thereof and the compounds isolated from the fractions. Acute toxicity experiments were performed using 6 week-old SPF SD rats. The extract of Mindung-Ash, its fractions, and the compounds isolated from the fractions were each suspended orally administered in a 0.5% methylcellulose solution at a dose of 5 g / kg / 15 ml. Hematology and blood biochemical tests were performed by observing the mortality, clinical symptoms, and weight changes of the animals after the administration of the test substance.
실험 결과, 실험물질을 투여한 모든 동물에서 특기할 만한 임상증상이나 폐사된 동물은 없었으며, 체중변화, 혈액검사, 혈액생화학검사, 부검소견 등에서도 독성 변화는 관찰되지 않았다.As a result, no significant clinical symptoms or dead animals were noted in all animals treated with the test substance, and no toxic changes were observed in weight changes, blood tests, blood biochemistry tests, and autopsy findings.
그 결과, 랫트에서 5 g/kg까지 독성 변화를 나타내지 않으며, 경구 투여 최소 치사량 (LD50)은 5 g/kg 이상인 안전한 물질로 판명되었다. As a result, the rats showed no toxicity change up to 5 g / kg, and the minimum lethal dose (LD 50 ) for oral administration was found to be a safe substance of 5 g / kg or more.
하기에 본 발명의 조성물을 위한 제제예를 예시한다.Examples of preparations for the compositions of the present invention are illustrated below.
<< 제제예Formulation example 1> : 약학적 제제의 제조 1>: Preparation of pharmaceutical preparation
1. 산제의 제조1. Preparation of powder
실시예<1-3>의 추출물 2 g2 g extract of Example <1-3>
유당 1 g1 g lactose
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.The above ingredients were mixed and filled in airtight cloth to prepare a powder.
2. 정제의 제조2. Preparation of Tablets
실시예<1-3>의 추출물 100 ㎎100 mg of extract of Example <1-3>
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎2 mg magnesium stearate
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.
3. 캡슐제의 제조3. Preparation of Capsule
실시예<2-3>의 추출물 100 ㎎100 mg of extract of Example <2-3>
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎2 mg magnesium stearate
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.After mixing the above components, the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.
4. 환의 제조4. Manufacture of rings
실시예<2-3>의 추출물 1 g1 g extract of Example <2-3>
유당 1.5 gLactose 1.5 g
글리세린 1 g1 g of glycerin
자일리톨 0.5 gXylitol 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1 환 당 4 g이 되도록 제조하였다.After mixing the above components, it was prepared to be 4 g per ring in a conventional manner.
5. 과립의 제조5. Preparation of Granules
실시예<2-3>의 추출물 150 ㎎150 mg of extract of Example <2-3>
대두 추출물 50 ㎎Soybean Extract 50mg
포도당 200 ㎎Glucose 200 mg
전분 600 ㎎Starch 600 mg
상기의 성분을 혼합한 후, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60℃에서 건조하여 과립을 형성한 후 포에 충진하였다.After mixing the above components, 100 mg of 30% ethanol was added and dried at 60 ° C. to form granules, which were then filled into fabrics.
<< 제제예Formulation example 2> : 식품의 제조 2>: Manufacture of food
본 발명의 민둥아까시 추출물을 포함하는 식품들을 다음과 같이 제조하였다.Food products containing the extract of Mindonggashashi of the present invention were prepared as follows.
1. 조리용 양념의 제조1. Preparation of Cooking Seasonings
본 발명의 실시예<1-2>의 추출물 20~95 중량부로 건강 증진용 조리용 양념을 제조하였다.20 ~ 95 parts by weight of the extract of Example <1-2> of the present invention to prepare a cooking seasoning for health promotion.
2. 토마토 케찹 및 소스의 제조2. Preparation of Tomato Ketchup and Sauce
본 발명의 실시예<1-2>의 추출물 0.2~1.0 중량부를 토마토 케찹 또는 소스에 첨가하여 건강 증진용 토마토 케찹 또는 소스를 제조하였다.0.2 ~ 1.0 parts by weight of the extract of Example <1-2> of the present invention was added to tomato ketchup or sauce to prepare tomato ketchup or sauce for health promotion.
3. 밀가루 식품의 제조3. Manufacturing of Flour Foods
본 발명의 실시예<1-2>의 추출물 0.5~5.0 중량부를 밀가루에 첨가하고, 이 혼합물을 이용하여 빵, 케이크, 쿠키, 크래커 및 면류를 제조하여 건강 증진용 식품을 제조하였다.0.5 to 5.0 parts by weight of the extract of Example <1-2> of the present invention was added to the flour, and bread, cake, cookies, crackers and noodles were prepared using the mixture to prepare foods for health promotion.
4. 스프 및 육즙(gravies)의 제조4. Preparation of soups and gravy
본 발명의 실시예<2-2>의 추출물 0.1~5.0 중량부를 스프 및 육즙에 첨가하여 건강 증진용 육가공 제품, 면류의 수프 및 육즙을 제조하였다.0.1 ~ 5.0 parts by weight of the extract of Example <2-2> of the present invention was added to soups and broth to prepare meat products for health promotion, soups and noodles of noodles.
5. 그라운드 비프(ground beef)의 제조5. Preparation of Ground Beef
본 발명의 실시예<2-2>의 추출물 10 중량부를 그라운드 비프에 첨가하여 건강 증진용 그라운드 비프를 제조하였다.10 parts by weight of the extract of Example <2-2> of the present invention was added to the ground beef to prepare a ground beef for health promotion.
6. 유제품(dairy products)의 제조6. Manufacture of Dairy Products
본 발명의 실시예<2-2>의 추출물 5~10 중량부를 우유에 첨가하고, 상기 우유를 이용하여 버터 및 아이스크림과 같은 다양한 유제품을 제조하였다.5 to 10 parts by weight of the extract of Example <2-2> of the present invention was added to milk, and various dairy products such as butter and ice cream were prepared using the milk.
7. 선식의 제조7. Manufacture of wire
현미, 보리, 찹쌀, 율무를 공지의 방법으로 알파화시켜 건조시킨 것을 배전한 후 분쇄기로 입도 60 메쉬의 분말로 제조하였다.Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh.
검정콩, 검정깨, 들깨도 공지의 방법으로 쪄서 건조시킨 것을 배전한 후 분쇄기로 입도 60 메쉬의 분말로 제조하였다.Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh.
본 발명의 실시예<1-2>의 추출물을 진공 농축기에서 감압농축하고, 분무, 열풍건조기로 건조하여 얻은 건조물을 분쇄기로 입도 60 메쉬로 분쇄하여 건조분말을 얻었다.The extract of Example <1-2> of the present invention was concentrated under reduced pressure in a vacuum concentrator, and the dried product obtained by drying with a spray and a hot air dryer was pulverized with a particle size of 60 mesh to obtain a dry powder.
상기에서 제조한 곡물류, 종실류 및 실시예<3-2>의 추출물의 건조분말을 다음의 비율로 배합하여 제조하였다.The dry powders of the grains, seeds and extracts of Example 3-3 prepared above were formulated in the following ratios.
곡물류(현미 30 중량부, 율무 15 중량부, 보리 20 중량부),Cereals (30 parts by weight brown rice, 15 parts by weight brittle, 20 parts by weight of barley),
종실류(들깨 7 중량부, 검정콩 8 중량부, 검정깨 7 중량부),Seeds (7 parts by weight perilla, 8 parts by weight black beans, 7 parts by weight black sesame seeds),
실시예<3-2>의 추출물에서 분리한 화합물의 건조분말(3 중량부),Dry powder (3 parts by weight) of the compound isolated from the extract of Example <3-2>,
영지(0.5 중량부),Ganoderma lucidum (0.5 parts by weight),
지황(0.5 중량부)Foxglove (0.5 part by weight)
<< 제제예Formulation example 3> : 음료의 제조 3>: Manufacture of beverage
1. 건강음료의 제조1. Manufacture of health drinks
실시예<3-2>의 추출물 1000 ㎎ 1000 mg of extract of Example <3-2>
구연산 1000 ㎎ Citric acid 1000 mg
올리고당 100 g 100 g oligosaccharides
매실농축액 2 g Plum concentrate 2 g
타우린 1 g 1 g of taurine
정제수를 가하여 전체 900 ㎖ Add 900 ml of purified water
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 ℓ용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강음료 조성물 제조에 사용한다. After mixing the above components according to the conventional healthy beverage manufacturing method, and stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and then refrigerated and stored Used to prepare the healthy beverage composition of the invention.
상기 조성비는 비교적 기호 음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용 용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.Although the composition ratio is a composition suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and intended use.
2. 야채쥬스의 제조2. Preparation of Vegetable Juice
본 발명의 실시예<3-2>의 추출물 5 g을 토마토 또는 당근 쥬스 1,000 ㎖에 가하여 건강 증진용 야채쥬스를 제조하였다.5 g of the extract of Example <3-2> of the present invention was added to 1,000 ml of tomato or carrot juice to prepare a vegetable juice for health promotion.
3. 과일쥬스의 제조3. Preparation of Fruit Juice
본 발명의 실시예<3-2>의 추출물 1 g을 사과 또는 포도 쥬스 1,000㎖ 에 가하여 건강 증진용 과일쥬스를 제조하였다.1 g of the extract of Example <3-2> of the present invention was added to 1,000 ml of apple or grape juice to prepare a fruit juice for health promotion.
<< 제제예Formulation example 4> : 연고의 제조 4>: Manufacture of ointment
본 발명의 민둥아까시 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물 유효성분으로 함유하는 피부용 외용제를 제조할 수 있다. 본 발명자들은 민둥아까시 추출물을 함유하는 일반 연고를 제조하였다.A topical preparation for skin containing the extract of Mindonggashi of the present invention, a fraction thereof and a compound active ingredient separated from the fraction can be prepared. The inventors have prepared a general ointment containing the extract of Mind.
<< 제제예Formulation example 5> : 화장품의 제조 5>: Manufacture of cosmetics
본 발명의 민둥아까시 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물 유효성분으로 함유하는 기능성 화장품을 제조할 수 있다. 본 발명자들은 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논을 함유하는 기능성 화장품으로 영양화장수, 크림, 에센스 등의 유화 제형의 화장품 및 유연화장수 등의 가용화 제형의 화장품을 제조하였다.Functional cosmetics containing as an extract active ingredient of Mindonggashashi of the present invention, fractions thereof and compounds isolated from the fractions can be prepared. The inventors of the present invention are functional cosmetics containing amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone and cosmetics of emulsified formulations such as nutrient cosmetics, creams, essences, and solubilized formulations such as soft cosmetics. Prepared.
<5-1> 유화 제형의 화장품 제조<5-1> Cosmetic Preparation of Emulsion Formulation
표 8에 기재된 조성으로 유화제형의 화장품을 제조하였다. 제조 방법은 하기와 같다.Cosmetics of emulsifier type were prepared with the composition shown in Table 8. The manufacturing method is as follows.
1) 1 내지 9의 원료를 혼합한 혼합물을 65∼70℃로 가열하였다.1) The mixture which mixed the raw materials of 1-9 was heated at 65-70 degreeC.
2) 10의 원료를 상기 단계 1)의 혼합물에 투입하였다.2) 10 was added to the mixture of step 1).
3) 11 내지 13의 원료의 혼합물을 65∼70℃로 가열하여 완전히 용해시켰다.3) The mixture of the raw materials of 11-13 was heated at 65-70 degreeC, and was completely dissolved.
4) 상기 단계 3)을 거치면서, 상기 2)의 혼합물을 서서히 첨가하여 8,000 rpm에서 2∼3분간 유화시켰다.4) While passing through step 3), the mixture of 2) was slowly added and emulsified for 2 to 3 minutes at 8,000 rpm.
5) 14의 원료를 소량의 물에 용해시킨 후 상기 단계 4)의 혼합물에 첨가하고 2분간 더 유화시켰다.5) The raw material of 14 was dissolved in a small amount of water, and then added to the mixture of step 4) and emulsified for 2 minutes.
6) 15 내지 17의 원료를 각각 평량한 후 상기 단계 5)의 혼합물에 넣고 30초간 더 유화시켰다.6) 15 to 17 of the raw materials were weighed, respectively, and added to the mixture of step 5) and emulsified for 30 seconds.
7) 상기 단계 6)의 혼합물을 유화 후 탈기과정을 거쳐 25∼35℃로 냉각시킴으로서 유화제형의 화장품을 제조하였다.7) After emulsifying the mixture of step 6) through a degassing process to cool to 25 ~ 35 ℃ to prepare an emulsion-type cosmetics.
<5-2> <5-2> 가용화Solubilization 제형의 화장품 제조 Cosmetic preparation of the formulation
표 9에 기재된 조성으로 가용화 제형의 화장품을 제조하였다. 제조 방법은 하기와 같다.A cosmetic of solubilized formulation was prepared with the composition shown in Table 9. The manufacturing method is as follows.
1) 2 내지 6의 원료를 1의 원료(정제수)에 넣고 아직믹서를 이용하여 용해시켰다.1) Raw materials 2 to 6 were placed in raw material 1 (purified water) and dissolved using a still mixer.
2) 8 내지 11의 원료를 7의 원료(알코올)에 넣고 완전용해시켰다.2) The raw materials of 8-11 were put into the raw material of 7 (alcohol), and it melt | dissolved completely.
3) 상기 단계 2)의 혼합물을 상기 단계 1)의 혼합물에 서서히 첨가하면서 가용화시켰다.3) The mixture of step 2) was solubilized with slow addition to the mixture of step 1).
도 1은 민둥아까시 지상부, 뿌리, 종자의 메탄올 추출물, 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논의 PPARγ에 대한 활성화 정도를 나타낸 그래프이고,1 is a graph showing the degree of activation of PPARγ on the ground, root, seed, methanol extract of Mindungashok, compound Amorphastilball or 5,7-dihydroxy-6-geranylflavanone isolated from the fractions. ,
도 2는 상기 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논의 지방세포에 대한 분화 정도를 나타낸 그림이고,Figure 2 is a diagram showing the degree of differentiation of adipocytes of the compound, amorphastyl ball or 5,7-dihydroxy-6-geranyl flavanone,
도 3은 상기 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논의 PPARγ관련 유전자들의 발현정도를 RT-PCR로 확인한 결과를 나타낸 그림이고,3 is a diagram showing the results of confirming the expression level of the PPARγ-related genes of the compound Amorphastilball or 5,7-dihydroxy-6-geranyl flavanone by RT-PCR,
도 4는 민둥아까시 지상부, 뿌리, 종자의 메탄올 추출물, 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논의 PPARα에 대한 활성화 정도를 나타낸 그래프이고,Figure 4 is a graph showing the degree of activation of PPARα of the ground portion, roots, methanol extract of the seed, amorphastilball or 5,7-dihydroxy-6-geranylflavanone which is a compound isolated from the fractions. ,
도 5는 상기 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논의 PPARα관련 유전자들의 발현정도를 RT-PCR로 확인한 결과를 나타낸 그림이고,5 is a diagram showing the results of confirming the expression level of the PPARα-related genes of the compound Amorphastilball or 5,7-dihydroxy-6-geranyl flavanone by RT-PCR,
도 6은 상기 화합물인 아몰파스틸볼 및 5,7-디하이드록시-6-게라닐플라바논을 나타낸 HPLC 크로마토그램이다.FIG. 6 is an HPLC chromatogram showing the compound Amorphastilbol and 5,7-dihydroxy-6-geranylflavanone.
<110> Korea Institute of Science and Technology <120> A composition that is comprising extracts, fractions and/or isolated single compounds of Robinia pseudo-acacia var. umbraculifera <130> 7p-06-37 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> PPAR gamma forward primer <400> 1 ttcgctgatg cactgcctat 20 <210> 2 <211> 20 <212> DNA <213> PPAR gamma reverse primer <400> 2 gccaacagct tctccttctc 20 <210> 3 <211> 20 <212> DNA <213> C/EBP alpha forward primer <400> 3 aggtgctgga gttgaccagt 20 <210> 4 <211> 20 <212> DNA <213> C/EBP alpha reverse primer <400> 4 cagcctagag atccagcgac 20 <210> 5 <211> 21 <212> DNA <213> Ap2 forward primer <400> 5 atgtgtgatg cctttgtggg a 21 <210> 6 <211> 21 <212> DNA <213> Ap2 reverse primer <400> 6 tgccctttca taaactcttg t 21 <210> 7 <211> 20 <212> DNA <213> Adiponectin forward primer <400> 7 agcctggaga agccgcttat 20 <210> 8 <211> 22 <212> DNA <213> Adiponectin reverse primer <400> 8 ttgcagtaga acttgccagt gc 22 <210> 9 <211> 21 <212> DNA <213> Fas forward primer <400> 9 ctgcgtggct atgattatgg c 21 <210> 10 <211> 21 <212> DNA <213> Fas reverse primer <400> 10 cgtgaggttg ctgtcgtctg t 21 <210> 11 <211> 20 <212> DNA <213> GLUT4 forward primer <400> 11 tcgtcattgg cattctggtt 20 <210> 12 <211> 20 <212> DNA <213> GLUT4 reverse primer <400> 12 ggtcatcaag atggcacagc 20 <210> 13 <211> 22 <212> DNA <213> Resistin forward primer <400> 13 tcaactccct gtttccaaat gc 22 <210> 14 <211> 20 <212> DNA <213> Resistin reverse primer <400> 14 tcttcacgaa tgtcccacga 20 <210> 15 <211> 20 <212> DNA <213> GAPDH forward primer <400> 15 accacagtcc atgccatcac 20 <210> 16 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 16 tccaccaccc tgttgctgta 20 <210> 17 <211> 26 <212> DNA <213> PPAR alpha forward primer <400> 17 acggaaagcc cactctgccc cctctc 26 <210> 18 <211> 25 <212> DNA <213> PPAR alpha reverse primer <400> 18 cttgtccccg cagattctac attcg 25 <210> 19 <211> 23 <212> DNA <213> CPT1 alpha forward primer <400> 19 agacggtgga acagaggctg aag 23 <210> 20 <211> 27 <212> DNA <213> CPT1 alpha reverse primer <400> 20 tgagaccaaa caaagtgatg atgtcag 27 <210> 21 <211> 21 <212> DNA <213> ACO2 forward primer <400> 21 gcggacatgg ctactcaaag c 21 <210> 22 <211> 21 <212> DNA <213> ACO2 reverse primer <400> 22 gcagtgcacc ttagcagcct g 21 <210> 23 <211> 20 <212> DNA <213> GAPDH forward primer <400> 23 accacagtcc atgccatcac 20 <210> 24 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 24 tccaccaccc tgttgctgta 20 <110> Korea Institute of Science and Technology <120> A composition that is comprising extracts, fractions and / or isolated single compounds of Robinia pseudo-acacia var. umbraculifera <130> 7p-06-37 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> PPAR gamma forward primer <400> 1 ttcgctgatg cactgcctat 20 <210> 2 <211> 20 <212> DNA <213> PPAR gamma reverse primer <400> 2 gccaacagct tctccttctc 20 <210> 3 <211> 20 <212> DNA <213> C / EBP alpha forward primer <400> 3 aggtgctgga gttgaccagt 20 <210> 4 <211> 20 <212> DNA <213> C / EBP alpha reverse primer <400> 4 cagcctagag atccagcgac 20 <210> 5 <211> 21 <212> DNA <213> Ap2 forward primer <400> 5 atgtgtgatg cctttgtggg a 21 <210> 6 <211> 21 <212> DNA <213> Ap2 reverse primer <400> 6 tgccctttca taaactcttg t 21 <210> 7 <211> 20 <212> DNA <213> Adiponectin forward primer <400> 7 agcctggaga agccgcttat 20 <210> 8 <211> 22 <212> DNA <213> Adiponectin reverse primer <400> 8 ttgcagtaga acttgccagt gc 22 <210> 9 <211> 21 <212> DNA <213> Fas forward primer <400> 9 ctgcgtggct atgattatgg c 21 <210> 10 <211> 21 <212> DNA <213> Fas reverse primer <400> 10 cgtgaggttg ctgtcgtctg t 21 <210> 11 <211> 20 <212> DNA <213> GLUT4 forward primer <400> 11 tcgtcattgg cattctggtt 20 <210> 12 <211> 20 <212> DNA <213> GLUT4 reverse primer <400> 12 ggtcatcaag atggcacagc 20 <210> 13 <211> 22 <212> DNA <213> Resistin forward primer <400> 13 tcaactccct gtttccaaat gc 22 <210> 14 <211> 20 <212> DNA <213> Resistin reverse primer <400> 14 tcttcacgaa tgtcccacga 20 <210> 15 <211> 20 <212> DNA <213> GAPDH forward primer <400> 15 accacagtcc atgccatcac 20 <210> 16 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 16 tccaccaccc tgttgctgta 20 <210> 17 <211> 26 <212> DNA <213> PPAR alpha forward primer <400> 17 acggaaagcc cactctgccc cctctc 26 <210> 18 <211> 25 <212> DNA <213> PPAR alpha reverse primer <400> 18 cttgtccccg cagattctac attcg 25 <210> 19 <211> 23 <212> DNA <213> CPT1 alpha forward primer <400> 19 agacggtgga acagaggctg aag 23 <210> 20 <211> 27 <212> DNA <213> CPT1 alpha reverse primer <400> 20 tgagaccaaa caaagtgatg atgtcag 27 <210> 21 <211> 21 <212> DNA <213> ACO2 forward primer <400> 21 gcggacatgg ctactcaaag c 21 <210> 22 <211> 21 <212> DNA <213> ACO2 reverse primer <400> 22 gcagtgcacc ttagcagcct g 21 <210> 23 <211> 20 <212> DNA <213> GAPDH forward primer <400> 23 accacagtcc atgccatcac 20 <210> 24 <211> 20 <212> DNA <213> GAPDH reverse primer <400> 24 tccaccaccc tgttgctgta 20
Claims (17)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020070074991A KR100902338B1 (en) | 2007-07-26 | 2007-07-26 | A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo?acacia var. umbraculifera |
PCT/KR2008/003283 WO2009014315A1 (en) | 2007-07-26 | 2008-06-12 | A composition that is comprising extracts, fractions or isolated single compounds of robinia pseudo-acacia var. umbraculifera |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020070074991A KR100902338B1 (en) | 2007-07-26 | 2007-07-26 | A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo?acacia var. umbraculifera |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20090011428A true KR20090011428A (en) | 2009-02-02 |
KR100902338B1 KR100902338B1 (en) | 2009-06-12 |
Family
ID=40281535
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020070074991A KR100902338B1 (en) | 2007-07-26 | 2007-07-26 | A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo?acacia var. umbraculifera |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR100902338B1 (en) |
WO (1) | WO2009014315A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101055676B1 (en) * | 2008-09-18 | 2011-08-09 | 관동대학교산학협력단 | A pharmaceutical composition for preventing or treating a disease controlled by the action of PPAR, a PARARγ agonist, a PPARα agonist, a method for producing a health food and a pharmaceutical composition for preventing or ameliorating a disease regulated by the action of PPAR |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140030721A (en) * | 2012-09-03 | 2014-03-12 | 한국과학기술연구원 | Composition containing extract of amorpha fruticosa |
US9457007B2 (en) | 2013-03-29 | 2016-10-04 | Naturewise Biotech & Medicals Corporation | Prenylflavanone compounds for modulating diabetes |
JP6877332B2 (en) * | 2015-03-06 | 2021-05-26 | サントリーホールディングス株式会社 | Matrix metalloproteinase production inhibitor |
WO2020153413A1 (en) * | 2019-01-22 | 2020-07-30 | 株式会社 沖縄リサーチセンター | COMPOSITION FOR PPARγ ACTIVATION AND COMPOSITION FOR IMPROVING SUGAR UPTAKE PROMOTION ABILITY |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6552085B2 (en) * | 2000-08-16 | 2003-04-22 | Insmed Incorporated | Compositions containing hypoglycemically active stilbenoids |
CA2516710A1 (en) * | 2003-02-26 | 2004-09-10 | Unigen Pharmaceuticals, Inc. | Formulation for use in the prevention and treatment of carbohydrate induced diseases and conditions |
CA2521429A1 (en) * | 2003-04-04 | 2004-10-21 | Unigen Pharmaceuticals, Inc. | Formulation of dual cycloxygenase (cox) and lipoxygenase (lox) inhibitors for mammal skin care |
BRPI0607571A2 (en) * | 2005-03-10 | 2009-09-15 | Unigen Pharmaceuticals Inc | substance composition comprised of a mixture of flavan free ring b flavonoids |
-
2007
- 2007-07-26 KR KR1020070074991A patent/KR100902338B1/en not_active IP Right Cessation
-
2008
- 2008-06-12 WO PCT/KR2008/003283 patent/WO2009014315A1/en active Application Filing
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101055676B1 (en) * | 2008-09-18 | 2011-08-09 | 관동대학교산학협력단 | A pharmaceutical composition for preventing or treating a disease controlled by the action of PPAR, a PARARγ agonist, a PPARα agonist, a method for producing a health food and a pharmaceutical composition for preventing or ameliorating a disease regulated by the action of PPAR |
Also Published As
Publication number | Publication date |
---|---|
WO2009014315A1 (en) | 2009-01-29 |
KR100902338B1 (en) | 2009-06-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101982326B1 (en) | Composition for prevention, improvement or treatment of muscular disorder or improvement of muscular functions | |
KR102141080B1 (en) | Composition for skin cell regeneration, anti-wrinkle, anti-imflammation, or skin whitening | |
KR102047222B1 (en) | Composition comprising extract of chrysanthemum as an effective ingredient for preventing or treating of muscular disorder or improvement of muscular functions | |
KR100902338B1 (en) | A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo?acacia var. umbraculifera | |
KR101618116B1 (en) | Composition of extracts of Arctium lappa or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR101497109B1 (en) | Composition for preventing, improving, or treating a disease controlled by PPAR action | |
KR20100032670A (en) | PHARMACEUTICAL COMPOSITION FOR PREVENTION OR MEDICAL TREATMENT OF DISEASE CONTROLLED BY PPAR, PPARγ AGONIST, PPARΑ AGONIST, HEALTH FOOD FOR PREVENTION OR IMPROVEMENT OF DISEASE CONTROLLED BY PPAR AND METHOD FOR PREPARATION OF PHARMACEUTICAL COMPOSITION | |
KR101567573B1 (en) | Composition comprising extracts of Codonopsis lanceolata or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR20130047458A (en) | Composition for preventing, improving, or treating a disease controlled by ppar action | |
KR102201312B1 (en) | Pharmaceutical Composition Comprising Extracts of Ginseng and Ginseng Berry for Preventing or Treating Muscle Disease | |
KR101557934B1 (en) | Composition comprising extracts of Codonopsis lanceolata or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR102342437B1 (en) | Composition comprising extract of Hibiscus manihot for anti-obesity | |
KR102138262B1 (en) | Composition for skin cell regeneration, anti-wrinkle, antioxidant, anti-inflammation, and skin whitening comprising N-Methylveratramine | |
KR101436213B1 (en) | Compositions for prevention and/or treatment of obesity comprising extracts of Boehmeria sieboldiana | |
KR101077916B1 (en) | Pharmaceutical compositions for prevention and treatment of obesity comprising extract of eremochloa ophiuroides as an active ingredient | |
KR100921971B1 (en) | A composition comprising Chamaenerion angustifolium extract as an active ingredient | |
KR20180120120A (en) | Composition for skin anti-aging or moisturization comprising extract of marian plum | |
KR102309425B1 (en) | Pharmaceutical Composition Comprising Red Ginseng Oil for Preventing or Treating Prostatic Hyperplasia | |
KR102522975B1 (en) | An anti-obesity composition containing a fermented Moringa oleifera extract produced using a novel Monascus purpureus SL1 strain as an active ingredient | |
KR102025572B1 (en) | Composition for preventing, ameliorating or treating metabolic diseases comprising mixture of Diospyros lotus leaf and grape fruit stem extract as effective component | |
KR101854960B1 (en) | Composition for anti-diabete comprising extract of hull and sprout parts from germinated rough rice as an effective component | |
KR102138265B1 (en) | Composition for skin cell regeneration, anti-wrinkle, antioxidant, anti-inflammation, and skin whitening comprising 3,23-Diacetyl-N-methylveratramine | |
KR102090689B1 (en) | Cosmetic composition containing Oriental Herb Fragrance Active Component alpha-fenchone for Skin Benefit Ingredient | |
KR102138264B1 (en) | Composition for skin cell regeneration, anti-wrinkle, antioxidant, anti-inflammation, and skin whitening comprising triacetylveratramine | |
KR101207527B1 (en) | Antiobesity composition comprising 1β-hydroxy-2-oxopomolic acid |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20130531 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20140701 Year of fee payment: 6 |
|
LAPS | Lapse due to unpaid annual fee |