WO2009014315A1 - A composition that is comprising extracts, fractions or isolated single compounds of robinia pseudo-acacia var. umbraculifera - Google Patents

Abstract

The present invention relates to a composition containing the extract of Robinia pseudo-acacia var. umbraculifera(Robinia pseudo-acacia var. umbraculifera) , fractions thereof and compounds isolated therefrom as an active ingredient, more precisely a composition containing the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and compounds isolated therefrom such as amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone, or its pharmaceutically acceptable salts which can activate peroxisome proliferator-activated receptor (PPAR) to bring the effect of prevention or treatment of obesity, diabetes, inflammation, skin aging, wrinkles. So, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom of the present invention can be effectively used as an active ingredient for medicines, food and drink or compositions for skin external application.

Description

[DESCRIPTION]

[invention Title]

A COMPOSITION THAT IS COMPRISING EXTRACTS, FRACTIONS OR ISOLATED SINGLE COMPOUNDS OF ROBINIA PSEUDO-ACACIA VAR. UMBRACULIFERA

[Technical Field]

The present invention relates to a composition comprising the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom as an active ingredient, more precisely a composition comprising the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and the compounds isolated therefrom such as amorphastilbol and 5 , 7-Dihydroxy-6-geranyl flavanone or pharmaceutically acceptable salts thereof as an active ingredient.

[Background Art] According to the changes of way of life including habits, diseases attributed to metabolism disorder such as hyperlipidemia, diabetes and obesity are increasing. The reasons of this kind of disease are not only genetic problems but also nutritional matters. Peroxisome is one of intracellular organelles which are believed to be a cause of metabolism disorder. Peroxisome has been regarded as a minor factor affecting cell functions, but recently confirmed by numbers of studies that it plays an important role in metabolisms of oxygen, glucose, lipid and hormone. Peroxisome is widely- involved in regulations of cell proliferation/differentiation and inflammatory mediators. Peroxisome affects insulin sensitivity and formations of cell membrane and adipocytes by being involved in lipid metabolism and glucose metabolism. It also plays an important role in aging and tumorigenesis mediated by oxidative stress (Smith. KJ et.al., J Cutan Med Surg 5(3):231-43, 2001; smith. KJ et.al., J Cutan Med Surg 5(4) :315-22, 2001). Intensive studies have been made for the last decade and as a result it was proved that peroxisome proliferator- activated receptors (PPARs), which are the nuclear hormone receptors, can be an excellent target of pharmacological approaches regarding the above diseases. PPAR is one of 48 nuclear receptors and regulates gene expression by ligand binding. Farnesoid X receptor, also one of nuclear receptors, binds to bile acid, and liver X receptor binds to oxysterols. In the meantime, various fatty acids of PPAR act as endogenous ligands. Numbers of publications (Michel Rivier, et.al., J. Invest. Dermatol 111, p.1116 1121, 1998) and reports (Timothy M et.al., Med. Chem. , VoI,

43, p. 527 ~ 550, 2000) on PPARs are attached as references.

Till today, three of PPARs have been identified, which are PPARα, PPARβ/δ and PPARy. Particularly, PPARα is largely found in blood vessel wall, liver, heart, muscle, kidney and brown adipose tissue. Fibrates such as fenofibrate, bezafibrate, ciprofibrate and gemfibrozil are functioning as PPARα agonists, which prevent or postpone arteriosclerosis in human and rats and have anti-obesity activity by accelerating lipid oxidation. In addition, these play an important role in promoting differentiation of keratinocytes in the outer skin, inhibiting proliferation of the keratinocytes, accelerating skin barrier formation by lipid metabolism, inhibiting inflammation, and wound recovery. It was also reported that PPARα suppresses inflammation mediator generation by UV and stigmatism (Kippenberger S, et.al., JID 117(6): 1430-6, 2001).

PPARδ is also called PPARβ and is found in a variety of tissues including skin, brain and adipose tissues. PPARδ is involved in cholesterol reverse transport, myelination and wound healing. It is also functioning as a very important regulator of fatty acid metabolism and energy homeostasis (Hwang HS, et.al., Journal of Korean Society of Endocrinology, 19(3): 250, 2004). PPARY is dominant in adipose tissue but is also found in vascular endothelium, macrophages and pancreatic β-cells. However, PPARγ is hardly found in liver, heart and skeletal muscle where PPARα is found. PPARY is the most promising target most widely studied among the three PPAR subtypes. It is because PPARY plays a crucial role in regulation of fat cell differentiation and in systemic lipid homeostasis. In particular, WO 96/33724 describes that the PPARy specific compound, for example prostaglandin J2 or D2 , is the potential activator for the treatment of obesity and diabetes. FR 98/02894 describes the use of the PPARγ activator compound in the preparation of a pharmaceutical composition for the treatment of skin trouble related to epidermal cell differentiation disorder. The compound that activates PPARγ either partially or entirely can be used for the preparation of a therapeutic agent of obesity owing to its fat cell differentiation inhibitory activity. Particularly, the compound partially activating PPARγ is very effective not only in the treatment of obesity but also in the regulation of hyperglycemia. So, the compound activating PPARγ partially or entirely can be effectively used for the treatment of general symptoms caused by obesity and non-insulin dependent diabetes such as increase of glucose, triglyceride and insulin (WO 01/30343, WO 02/08188, WO 2004/020408 ) (Berger et al . , Trends Pharmacol. Sci. , vol. 26, p.244-51, 2005). Thiazolidinediones have been approved as a hypoglycemic agent for type II diabetes patients in USA in January, 1997. But, troglitazone was recalled from markets because of its hepatotoxicity . The PPARY agonists now on the market are rosiglitazone and pioglitazone, approved in USA in 1999.

Most of patents related to PPARs are composed of novel agents as PPARy activators, screening methods thereof and uses of them for the treatment of diabetes and obesity. Novel agents as PPARγ activators described in those patents are exemplified by substituted-4-hydroxy-phenylalkanone derivatives having PPARγ activating activity (Korean Patent No. 474202), novel compounds usable for the treatment of PPAR mediated diseases (Korean Patent Publication No. 2005-0055790), chorale oxazole-arylpropionic acid derivatives and their use as a PPAR activator (Korean Patent Publication No. 2005-0055750) and novel PPAR ligands not inducing fluid retention, edema or congestive heart failure (Korean Patent Publication No. 2005- 0055701), N-substituted-lH-indole-5-propionic acid compound acting as a PPAR activator for the treatment of diabetes (Korean Patent Publication No. 2005-0042809), novel compounds increasing the activities of PPARy and PPARα, together with their preparation methods and pharmaceutical compositions including the said agents (Korean Patent Publication No. 2005-0040746), benzoic acid derivatives as PPARγ and PPARα regulators (Korean Patent Publication No. 2005-0014014) and oral anti-diabetic agent (Korean Patent Publication No. 2004-0044515). The screening methods shown in the above patents are exemplified by the screening method of obesity and diabetic control material (Korean Patent No. 468046), the screening method of peroxisomal proliferator response element of βGK gene (Korean Patent No. 4434948), the screening method of disease related regulators particularly for inflammation, cancer and metabolic diseases by using monoclonal antibody against PPARα, specific antibody secreting hybridoma and antibodies (Korean Patent Publication No. 2005-0027808). The uses according to the previous patents are exemplified by the composition for the prevention and treatment of PPARα mediated diseases comprising macelignan extracted from nutmeg or its pharmaceutically acceptable salts as an active ingredient (Korean Patent Publication No. 2007- 0033938), the composition for cosmetics specifically designed to inhibit sebaceous lipid comprising catechin and kaempferol (Korean Patent Publication No. 2007-0028902), the composition comprising labdane diterpene extracted from Andrographis paniculata which is effective in the treatment of PPARY receptor activation mediated autoimmune disease and Alzheimer's disease (Korean Patent Publication No. 2007-0026398), the composition for the prevention and treatment of diabetes comprising Cinnamomum camphora leaf extract or fractions thereof as an active ingredient (Korean Patent Publication No. 2007-0019344), the composition comprising ginseng PPT as a PPARY agonist (Korean Patent Publication No. 2006-0131012), the composition containing Cucurbitaceae plant extracts having anti-adipogenesity and anti-obesity activities or purified compounds therefrom (Korean Patent Publication No. 2005- 0054009 and No. 2005-0054006), the composition and food for improvement of lipid metabolism (Korean Patent Publication No. 2004-0084908), treatment and prevention of cardiac insulin resistance associated conditions (Korean Patent Publication No. 2003-0019434), the composition for the regulation of bone formation (Korean Patent Publication No. 0093808), benzoic acid derivatives for the treatment of diabetes mellitus (Korean Patent Publication No. 2002-0087382), the composition for skin care (Korean Patent Publication No. 2002-0047101), the PPARδ inhibitor for the treatment of cardiovascular diseases (Korean Patent Publication No. 2002-0012323), the composition for the treatment of Alzheimer's disease, central nervous system injury and inflammatory disease and the treatment method (Korean Patent Publication No. 2001-0101085), and the use of PPARα and PPARγ agonist for the treatment of syndrome X (Korean Patent Publication No. 1999-0077099).

Robinia pseudo-acacia var. umbraculifera is a naturalized plant originated from North America, belonging to pea family. Robinia pseudo-acacia var. umbraculifera is spread in every mountain and field all over Korea. This tree is approximately 25 m tall and has yellow-brown bark which is cracked vertically. The small stems of the tree have no hairs and prickles. The leaves of the tree are crossed each other and pinnate compound leaves. The numbers of small leaves are 9 - 19. The small leaves have oval or egg shape and are 2.5 - 4.5 cm long. Both sides are round and flat and small petiole is 2 - 4 mm long. This tree does not bloom and has no prickles and has round crown. The way of propagation of this tree is cuttage or division (Doosan EnCyber).

There has been no patent describing the use of Robinia pseudo-acacia var. umbraculifera. Only those patents each describing a natural tea product having hangover curing effect and liver function recovery effect made from Robinia pseudo-acacia L. (Korean Patent Publication No. 2004-0005848), the use of Robinia pseudo- acacia L. originated lectin for food (European Patent No. 1009418), and the use of Robinia pseudo-acacia L. for the preparation of feeds (Korean Patent Publication No. 2001- 0063743) have been reported. Amorphastilbol described in the present invention has been known only for its antibacterial activity so far (Mitscher, LA., et.al., Phytochemistry, 27(4): 1481-83, 1985). And, the effect or activity of 5 , 7-dihydroxy-6-geranyl flavanone on obesity, diabetes and skin aging has not been reported, yet.

Thus, the present inventors studied biological information, effects and functions of PPARs, particularly on obesity, diabetes, skin aging and moisturizing. During the screening of ligands thereof, the present inventors disclosed that the extract of Robinia pseudo-acacia var. umbraculifera living in highland, fractions thereof and compounds isolated therefrom were functioning as a PPARα or

PPARY activator, and thereby the present inventors completed this invention by confirming that the extract of

Robinia pseudo-acacia var. umbraculifera living in highland, fractions thereof and compounds isolated therefrom could be effectively used as a preventive or therapeutic agent for obesity, diabetes, skin aging, and wrinkles or a moisturizing agent for dry skin.

[Disclosure] [Technical Problem] It is an object of the present invention to provide a composition for the prevention and treatment of PPARY or PPARα mediated disease which comprises the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone, or their pharmaceutically acceptable salts as an active ingredient.

[Technical Solution] To achieve the above object, the present invention provides a composition comprising the extract of Robinia pseudo-acacia var. umbraculifera as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

The present invention also provides a composition comprising the fractions extracted from the Robinia pseudo- acacia var. umbraculifera extract by using an organic solvent as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

The present invention also provides a composition comprising the active fraction obtained from the above fractions by silica gel column chromatography when the ratio of acetonitrile to water reaches 80% while the ratio of acetonitrile to water is raised from 60% to 100%, 10% by 10%, as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

The present invention also provides a composition containing amorphastilbol compound represented by formula 1 or pharmaceutically acceptable salts thereof as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

[Formula l]

The present invention also provides a composition containing 5 , 7-dihydroxy-6-geranyl flavanone compound represented by formula 2 or its pharmaceutically acceptable salt as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

[Formula 2]

Wherein,

Ri, R₂ and R₃ are independently H, OH or OCH₃.

The present invention also provides a method for treating obesity, metabolic disease, cardiovascular disease or skin disease comprising the step of administering an effective dose of one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone to a subject with obesity, metabolic disease, cardiovascular disease or skin disease.

The present invention also provides a method for preventing obesity, metabolic disease, cardiovascular disease or skin disease comprising the step of administering an effective dose of one or more substances selected from the group consisting of the extract of Roblnia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone to a subject with obesity, metabolic disease, cardiovascular disease or skin disease.

The present invention also provides a use of one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone for the prevention and treatment of obesity, metabolic disease, cardiovascular disease or skin disease. The present invention also provides a PPARγ agonist containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6- geranyl flavanone as an active ingredient.

The present invention also provides a PPARα agonist containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5, 7-dihydroxy-6- geranyl flavanone as an active ingredient.

The present invention also provides a health food containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6- geranyl flavanone for the prevention and improvement of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

The present invention also provides a composition for external application on skin containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone for the prevention and improvement of a disease selected from the group consisting of PPAR mediated diseases such as skin aging, low elasticity, wrinkles, skin drying and keratin formation.

Hereinafter, the present invention is described in detail .

The present invention provides a composition comprising the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof or amorphastilbol or 5,7- dihydroxy-6-geranyl flavanone isolated from the fractions or pharmaceutically acceptable salts thereof as an active ingredient for the prevention and treatment of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease.

The active ingredient of the present invention such as the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom can be prepared by the isolation-purification method comprising the following steps:

1 ) extracting Robinia pseudo-acacia var. umbraculifera by using an extraction solvent;

2) filtering and concentrating the Robinia pseudo- acacia var. umbraculifera extract of step 1);

3) extracting additionally the concentrate of step 2) by using an organic solvent; 4 ) obtaining active fractions from the fractions of step 3) by column chromatography; and

5 ) obtaining active compounds from the active fractions of step 4) by HPLC.

In the above method, the Robinia pseudo-acacia var. umbraculifera of step 1) can be purchased or cultivated and any part of aerial part of the plant, roots and seeds can be used.

In the above method, the extraction solvent of step 1) is water, alcohol or a mixture thereof. Herein, the alcohol is preferably Ci - C₄ lower alcohol and the lower alcohol is exemplified by ethanol or methanol. The preferable amount of the solvent is 5 - 15 times the amount of Rob±nia pseudo-acacia var. umbracullfera, and more preferably 10 times the amount, but not always limited thereto. After adding the solvent, reflux-extraction is preferably performed, but not always limited thereto. The temperature of the extraction solvent is 60 - 100 ^°C and preferably 80^°C, but not always limited thereto. The extraction time is preferably 2 - 4 hours and more preferably 3 hours, but not always limited thereto. The extraction is preferably repeated 1 - 5 times and more preferably 3 times, but not always limited thereto. The Robinia pseudo-acacia var. umbraculifera is extracted according to the above method and then filtered, concentrated and freeze-dried to give the extract.

In the above method, the organic solvent of step 3) is hexane, dichloromethane, acetone or acetonitrile. It is preferred to add dichloromethane and then soluble layer is discarded before methanol is added, but not always limited thereto. In the above method, the column chromatography of step 4) is performed by using a filler selected from the group consisting of silica gel, sephadex, RP-18, polyamide, Toyopearl and XAD resin for the isolation and purification. The column chromatography can be repeated several times with a properly selected filler loaded. In a preferred embodiment of the present invention, flash column chromatography was performed by using silica gel as a filler and at this time the concentration ratio of acetonitrile to water was increased from 60% to 100% by 10% every step, during which the active fraction was obtained at 80%.

In step 5) of the above method, HPLC (Phenomenex Luna lOμ m Ci₈ column) is performed. In a preferred embodiment of the present invention, the concentration ratio of acetonitrile to water was increased from 10% to 100%, by 10% per each for 60 minutes. During this preparation, active compounds were isolated at the time points of the Rt(Retetion time) 26 minute and the Rt 29 minute. These isolated compounds were identified with their structures by nuclear magnetic resonance (NMR) . As a result, the compound isolated at the Rt 26 minute was identified as amorphastilbol represented by formula 1 and the compound isolated at the Rt 29 minute was identified as 5,7- dihydroxy-6-geranyl flavanone represented by formula 2. The present invention also provides a PPARY agonist containing one or more substances selected from the group consisting of the extract of Robinla pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5, 7-dihydroxy-6- geranyl flavanone as an active ingredient.

The present invention also provides a PPARα agonist containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5, 7-dihydroxy-6- geranyl flavanone as an active ingredient.

The metabolic disease mediated by PPAR in this invention is selected from the group consisting of diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, hypercholesterolemia, hypertriglyceridemia, syndrome X and endothelial dysfunction.

The hypercholesterolemia is selected from the group consisting of hypo-HDL-cholesterolemia, hyper-LDL- cholesterolemia and hypertriglyceridemia.

The cardiovascular disease mediated by PPAR herein is selected from the group consisting of hypertension, precoagulant state, dyslipidemia and atherosclerosis. The skin disease mediated by PPAR herein is selected from the group consisting of skin barrier enhancement, atopy, contact dermatitis and inflammatory disease.

In this invention, the extract of Robinia pseudo- acacia var. umbracul±fera, fractions thereof or amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone was tested by luciferase assay system to investigate its effect on the activation of PPARY involved in lipid metabolism and glucose metabolism . As a result, the PPARy activation level was similar to or higher than that of the positive control treated with troglitazone, known as a PPARy agonist. The higher the dose, the higher the activation level went (see Table 1 and Figure 1).

It was also investigated in this invention the effect of amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone on the fat cell differentiation. The conventional glitazone drugs used for the improvement of glucose or lipid metabolism have the mechanism that PPARy, the nuclear receptor and at the same time the transcription factor, is activated to activate lipid metabolism related genes, so that glucose influx into fat cells is accelerated, resulting in the accumulation of fat, which accordingly induces fat cell differentiation. Fat cells were cultured in media each containing different test samples, followed by observation of fat cell differentiation. As a result, the accumulation of fat was similar to or higher than that of the positive control treated with troglitazone, known as a PPARY agonist. The above result indicates that the amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone of the present invention accelerates the differentiation of fat cells and thus it is a very effective component in the improvement of lipid metabolism (see Figure 2).

It was also investigated the effect of amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone on the expression of PPARY and fat cell differentiation related genes. Particularly, RT-PCR was performed to investigate the expressions of PPARγ and fat cell related genes, C/EBPα (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), adiponectin, fatty acid synthase (Fas), glucose transporter 4 (GLUT4) and resistin. As a result, the expressions were increased similarly to when the positive control, troglitazone which is known as a PPARY agonist, was treated (see Figure 3). This result indicates that amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone is functioning as a PPARγ agonist and thus is a very effective component for the improvement of lipid metabolism.

In this invention, luciferase assay was performed to investigate the effect of the extract of Robinla pseudo- acacia var. umbraculifera, fractions thereof or active compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone on the activation of PPARα. As a result, the activation inducing effect of the same was similar to or greater than when the positive control, Wy-14,643 which is known as a PPARα agonist, was treated. At that time, the higher the dose, the higher the effect was (see Table 2 and Figure 4). This result suggests that the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions, amorphastilbol or 5,7- dihydroxy-6-geranyl flavanone, can be effectively functioning as a PPARα agonist.

To investigate the effect of amorphastilbol or 5,7- dihydroxy-6-geranyl flavanone on the expressions of PPARα and fatty acid oxidation related genes, RT-PCR was performed and the expressions of PPARα and CPTlα (Carnitine Palmitoyl Transferase I alpha), AC02 (Acyl-CoA Oxidase 2) were investigated. As a result, the expressions were increased similarly to when Wy-14,643 known as a PPARα agonist was treated (see Figure 3). Therefore, it was confirmed that amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone of the present invention is functioning as a PPARα agonist that is very effective in fatty acid oxidation. It was also investigated whether or not the extract of Roblnia pseudo-acacia var. umbracullfera, fractions thereof and compounds isolated therefrom, amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone, could inhibit the UV- mediated biosynthesis of TNF α. Human keratinocytes were irradiated with UV, which were then cultured in media each containing different samples, followed by ELISA. As a result, biosynthesis of TNF α was reduced, compared with non-treated cells (negative control), but similar or increased, compared with Wy-14,643 (positive control) treated cells. The higher the dose of the sample, the lower the biosynthesis of TNF α was (see Table 3). The above result indicates that the extract of Robinia pseudo- acacia var. umbraculifera, fractions thereof and compounds isolated therefrom, amorphastilbol or 5, 7-dihydroxy-6- geranyl flavanone, can inhibit the biosynthesis of TNF α.

The present inventors further examined the relationship of TNF α and the biosynthesis of type I colagenase, metalloelastase-1 (MMP-I), by UV. Human fibroblasts were irradiated with UV and then cultured in media each containing different samples. Then, the cells were treated with TNF α antibody and TNF α, followed by ELISA. As a result, the biosynthesis of MMP-I was reduced when TNF α antibody was treated, while it was increased when TNF α was treated, suggesting the inter-relationship between TNF α and biosynthesis of type I colagenase (see Tables 4 and 5). Therefore, it was suggested that the extract of Robinia pseudo-acacia var. umbraculifera of the present invention, fractions thereof and compounds isolated therefrom, amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone, could reduce type I collagenase biosynthesis by inhibiting TNF α biosynthesis.

The major reason of wrinkles and loss of elasticity is the decrease of collagen, the substrate for MMP-I biosynthesis. Thus, when TNF α biosynthesis induced by UV is reduced, MMP-I biosynthesis is reduced, resulting in the prevention and improvement of skin inflammation, loss of dermal matrix, loss of elasticity or wrinkles (Obayashi K, et.al., J Cosmet Sci. 56(1): 17-27. 2005). Therefore, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom, amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone, of the present invention can be effectively used as a composition for the prevention and improvement of skin inflammation, loss of dermal matrix, loss of elasticity or wrinkles. In this invention, it was also investigated the effect of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy- 6-geranyl flavanone, on skin moisturization and hydration related gene expressions. PCT/US1999/05413 (Korean Patent Application No. 10-2000-7010163) describes the effect of filaggrin and involucrin on skin moisturization and hydration. Human keratinocytes were treated with each sample and then cultured, followed by Western blotting to investigate the biosynthesis of filaggrin or involucrin. As a result, the expressions of the genes were increased when the samples were treated, compared with non- treated negative control cells (see Table 6). This result indicates that the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions, amorphastilbol or 5 , 7-dihydroxy-6- geranyl flavanone, can increase skin moisturization and hydration.

To confirm whether amorphastilbol was the ligand of PPARY receptor or not, PolarScreen™ PPAR Competitor Assay was performed using troglitazone as the positive control and amorphastilbol as the experimental group. As a result, IC50 of troglitazone was 658 nM, and ICs₀ of amorphastilbol was 1.2 uM, suggesting that it might be the ligand of PPARy receptor.

Anti-obesity activity of the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol of the present invention was also investigated. The extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol were treated to mice fed with high fat diet and then weights, food and water consumptions were measured. As a result, as shown in Figure I₁ weights of mice treated with the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol were reduced, compared with the non-treated control group, suggesting that the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol of the present invention had anti-obesity activity (Figure 7). However, food and water consumptions were not much increased or decreased. Anti-diabetic activity of the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol of the present invention was also investigated. The extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol were administered to leptin receptor knock- out db/db mice, and then weights, food/water consumptions and blood glucose levels were measured. As a result, as shown in Figure 8, the experimental group mice treated with the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol maintained normal weights similarly to the non-treated control group mice (see Figure 8). However, as shown in Figure 9, blood glucose of the mice treated with the extract of Robinia pseudo-acacia var. umbraculifera and amorphastilbol was reduced dose- dependentIy, compared with the non-treated control (see Figure 9). As shown in Figure 10, water consumption of the mice treated with the extract of Roblnia pseudo-acacia var. umbraculifera and amorphastilbol was reduced, suggesting that drinking-a-lot symptom, one of symptoms by diabetes, can be relieved (see Figure 10).

As for the pharmaceutically acceptable salt, it is preferably an acid addition salt prepared by using a free acid. Whether it is inorganic or organic, a free acid can be used if it is pharmaceutically acceptable. Examples of the inorganic free acid include hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid. Available organic free acids are exemplified by citric acid, acetic acid, lactic acid, tartaric acid, malic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4- toluenesulfonic acid, galacturonic acid, embonic acid, glutamic acid and aspartic acid. The extract of Robinia pseudo-acacia var. umbraculifera of the present invention, fractions thereof and compounds isolated from the fractions, amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone, can additionally include not only one of those pharmaceutically acceptable salts but also any salts, hydrates and solvates which can be prepared by the conventional method. The pharmaceutical composition of the present invention for the prevention and treatment of PPARY and/or PPARα mediated diseases can contain one or more compounds consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone, and additionally one or more active ingredients having the same or similar functions to the above .

The extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5 , 7-dihydroxy- 6-geranyl flavanone of the present invention can be administered orally or parenterally and be used in general forms of pharmaceutical formulation. The pharmaceutical composition of the present invention for the prevention and treatment of PPARy and/or PPARα mediated diseases can be prepared for oral or parenteral administration by mixing with generally used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactant. Solid formulations for oral administration are tablets, pills, powders, granules and capsules. These solid formulations are prepared by mixing the pharmaceutical composition of the present invention with one or more suitable excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. Liquid formulations for oral administrations are suspensions, solutions, emulsions and syrups, and the above-mentioned formulations can contain various excipients such as wetting agents, sweeteners, aromatics and preservatives in addition to generally used simple diluents such as water and liquid paraffin. Formulations for parenteral administration are sterilized aqueous solutions, water-insoluble excipients, suspensions, emulsions, lyophilized preparations, suppositories and injections. Water insoluble excipients and suspensions can contain, in addition to the active compound or compounds, propylene glycol, polyethylene glycol, vegetable oil like olive oil, injectable ester like ethylolate, etc. Suppositories can contain, in addition to the active compound or compounds, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin, etc. The pharmaceutical composition of the present invention for the prevention and treatment of PPARy and/or PPARα mediated diseases can be administered by parenterally and the parenteral administration includes subcutaneous injection, intravenous injection and intramuscular injection.

The pharmaceutical composition of the present invention is evaluated to be a safe substance since its estimated LD₅₀ value is much greater than 5 g/kg in rats, which is confirmed by acute toxicity assay with rats tested via oral administration. Unit dose can be adjusted by a doctor in charge according to a target disease. The pharmaceutical composition of the present invention can be administered alone or together with surgical operation, hormone therapy, chemo-therapy and biological regulators to prevent and treat PPARy and/or PPARα mediated diseases.

The present invention also provides a method for treating obesity, metabolic disease, cardiovascular disease or skin disease comprising the step of administering an effective dose of one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone to a subject with obesity, metabolic disease, cardiovascular disease or skin disease.

The present invention also provides a method for preventing obesity, metabolic disease, cardiovascular disease or skin disease comprising the step of administering an effective dose of one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone to a subject with obesity, metabolic disease, cardiovascular disease or skin disease. The present invention also provides a use of one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, amorphastilbol and 5, 7-dihydroxy-β- geranyl flavanone for the prevention and treatment of obesity, metabolic disease, cardiovascular disease or skin disease.

The present invention also provides a health food containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone for the prevention and improvement of a disease selected from the group consisting of PPAR mediated diseases such as obesity, metabolic disease, cardiovascular disease and skin disease. The extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy- 6-geranyl flavanone of the present invention can be used as food additive. In that case, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone can be added as it is or as mixed with other food components according to the conventional method. The mixing ratio of active ingredients can be regulated according to the purpose of use (prevention, health enhancement or treatment). In general, to produce health food or beverages, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5,7-dihydroxy- 6-geranyl flavanone is added preferably by up to 15 weight part and more preferably by up to 10 weight part. However, if long term administration is required for health and hygiene or regulating health condition, the content can be lower than the above but higher content can be accepted as well since the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5 , 7-dihydroxy- 6-geranyl flavanone have been proved to be very safe. The food herein is not limited. For example, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone can be added to meats, sausages, breads, chocolates, candies, snacks, cookies, pizza, ramyuns, flour products, gums, dairy products including ice cream, soups, beverages, tea, drinks, alcohol drinks and vitamin complex, etc, and in wide sense, almost every food applicable in the production of health food can be included. The composition for health beverages of the present invention can additionally include various flavors or natural carbohydrates, etc, like other beverages. The natural carbohydrates above can be one of monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and glucose alcohols such as xilytole, sorbitol and erythritol. Besides, natural sweetening agents such as thaumatin and stevia extract, and synthetic sweetening agents such as saccharin and aspartame can be included as a sweetening agent.

In addition to the ingredients mentioned above, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone of the present invention can include in variety of nutrients, vitamins, minerals, flavors, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acid, protective colloidal viscosifiers , pH regulators, stabilizers, antiseptics, glycerin, alcohols, carbonators which used to be added to soda, etc. The extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone of the present invention can also include natural fruit juice, fruit beverages and/or fruit flesh addable to vegetable beverages. All the mentioned ingredients can be added singly or together. The mixing ratio of those ingredients does not matter in fact, but in general, each can be added by 001-0.1 weight part per 100 weight part of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the fractions such as amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone of the invention.

The present invention also provides a composition for skin external application containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone for the prevention and improvement of a disease selected from the group consisting of PPAR mediated diseases such as skin aging, low elasticity, wrinkles, skin drying and keratin formation.

The composition for skin external application can additionally include, in addition to the above essential components, a general cosmetic component or medicinal material used for a composition for skin external application such as water components, oil components, powder components, alcohols, moisturizers, thickening agents, UV absorbers, whitening agents, antiseptics, antioxidants, surfactants, flavors, coloring agents, various nutritional materials for skin, etc.

In addition, sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate and gluconic acid, caffein, tannin, verapamil, licorice extract, glablidin, carlin hot water extract, herb medicines, acetic acid tocopherol, glytyltinic acid, tranexamic acid and their derivatives or salts, vitamin C, magnesium phosphate ascorbate, glucoside ascorbate, albutin, kojic acid, and glucoses such as glucose, fructose, trehalose can be mixed properly.

The composition for skin external application is preferably cream, gel, ointment, skin emulsion, skin suspension, transdermal patch, drug containing bandage, etc.

The composition for skin external application can be formulated for the administration with a pharmaceutically acceptable carrier, an excipient, a binder, a disintegrating agent, a solubilizer, a suspension, a preserving agent or a thickening agent. The effective dose of the composition is 0.01-300 mg/cm² per day and preferably 10-50 mg/cm² per day, and administration frequency is 1 - 4 times a day. The dose, however, can be regulated according to weight, age, gender, health condition, diet, administration frequency, administration method, excretion and severity of a disease.

[Advantageous Effect]

The extract of Robinia pseudo-acacia var. umbraculifera of the present invention, fractions thereof and compounds isolated from the same, amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone, or pharmaceutically acceptable salts thereof are effective in the prevention and treatment of obesity and diabetes by activating PPAR and also effective as a composition for skin external application in the prevention of skin aging and the improvement of wrinkles by inhibiting TNF α and matrix metalloproteinase-1 (MMP-I) biosynthesis, suggesting that the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated from the same of the present invention can be an effective composition for the prevention and treatment of the said diseases.

[Description of Drawings] The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:

Figure 1 is a graph illustrating the activation of PPARY by the methanol extracts of Robinia pseudo-acacia var. umbraculifera extracted from aerial parts, roots and seeds, fractions thereof and compounds isolated from the same such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone, Figure 2 is a diagram illustrating the fat cell differentiation induced by amorphastilbol or 5,7-dihydroxy-

6-geranyl flavanone,

Figure 3 is a diagram illustrating the expressions of

PPARY related genes induced by amorphastilbol or 5,7- dihydroxy-6-geranyl flavanone, confirmed by RT-PCR,

Figure 4 is a graph illustrating the activation of

PPARα by the methanol extracts of Roblnia pseudo-acacia var. umbraculifera extracted from aerial parts, roots and seeds, fractions thereof and compounds isolated from the same such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone,

Figure 5 is a diagram illustrating the expressions of

PPARα related genes induced by amorphastilbol or 5,7- dihydroxy-6-geranyl flavanone, confirmed by RT-PCR, Figure 6 is a diagram illustrating the HPLC chromatogram of amorphastilbol or 5 , 7-dihydroxy-6-geranyl flavanone,

Figure 7 is a graph illustrating the anti-obesity activity of the methanol extract of Robinia pseudo-acacia var. umbraculifera seeds and amorphastilbol in high fat diet mouse model,

Figure 8 is a graph illustrating the weight changes by the methanol extract of Robinia pseudo-acacia var. umbracullfera seeds and amorphastilbol in leptin receptor knock-out mouse model,

Figure 9 is a graph illustrating the blood glucose lowering effect of the methanol extract of Robinia pseudo- acacia var. umbraculifera seeds and amorphastilbol in leptin receptor knock-out mouse model, Figure 10 is a graph illustrating the changes of water consumption by the methanol extract of Robinia pseudo-acacia var. umbraculifera seeds and amorphastilbol in leptin receptor knock-out mouse model.

[Mode for Invention]

Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

Example 1 : Preparation of extract of Robinia pseudo-acacia var. umbraculifera aerial part In this invention, Robinia pseudo-acacia var. umbraculifera grown naturally in highland of Daekwallyung,

Korea was used. Aerial part, roots and seeds of Robinia pseudo-acacia var. umbraculifera were extracted respectively.

<!-!> Preparation of methanol extract of Robinia pseudo- acacia var. umbraculifera aerial part

100 g of Robinia pseudo-acacia var. umbraculifera aerial part including leaves, short branches and steins was soaked in 1 L of 100% methanol, followed by reflux- extraction for 3 hours . The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.5 g of concentrate.

<l-2> Preparation of water extract of Robinia pseudo- acacia var. umbraculifera aerial part

100 g of Robinia pseudo-acacia var. umbraculifera aerial part including leaves, short branches and stems was soaked in 1 L of water, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.5 g of concentrate.

<l-3> Preparation of ethanol extract of Robinia pseudo- acacia var. umbraculifera aerial part

100 g of Robinla pseudo-acacia var. umbraculifera aerial part including was soaked in 1 L of 100% ethanol, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.5 g of concentrate.

Example 2 ; Preparation of extract of Robinia pseudo-acacia var. umbraculifera root

<2-l> Preparation of methanol extract of Robinia pseudo- acacia var. umbraculifera root

100 g of Robinia pseudo-acacia var. umbraculifera roots was soaked in 1 L of 100% methanol, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 11.2 g of concentrate.

<2-2> Preparation of water extract of Robinia pseudo- acacia var. umbraculifera root

100 g of Robinia pseudo-acacia var. umbraculifera roots was soaked in 1 L of water, followed by reflux- extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.3 g of concentrate. <2-3> Preparation of ethanol extract of Robinia pseudo- acacia var. umbracullfera root

100 g of Robinia pseudo-acacia var. umbraculifera roots was soaked in 1 L of 100% ethanol, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.0 g of concentrate.

Example 3 : Preparation of extract of Robinia pseudo-acacia var. umbraculifera seed

<3-l> Preparation of methanol extract of Robinia pseudo- acacia var. umbraculifera seed

100 g of well ripen seeds of Robinia pseudo-acacia var. umbraculifera was soaked in 1 L of 100% methanol, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 14.7 g of concentrate.

<3-2> Preparation of water extract of Robinia pseudo- acacia var. umbraculifera seed

100 g of well ripen seeds of Robinia pseudo-acacia var. umbraculifera was soaked in 1 L of water, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.7 g of concentrate.

<3-3> Preparation of ethanol extract of Robinia pseudo- acacia var. umbraculifera seed

100 g of well ripen seeds of Robinia pseudo-acacia var. umbraculifera was soaked in 1 L of 100% ethanol, followed by reflux-extraction for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.7 g of concentrate .

Example 4 ; Preparation of fractions from Robinia pseudo- acacia var. umbraculifera extract <4-i> Preparation of fractions

The extract prepared in Example <3-l> was reflux- extracted twice with dichloromethane. Dichloromethane soluble layer was discarded. Reflux-extraction was performed twice with methanol. The resultant extract was dried under reduced pressure and concentrated to give 11 g of fractions.

<4-2> Preparation of active fractions

7 g of the fraction was absorbed to 7 g of silicon dioxide, which proceeded to flash column chromatography (prepared by the present inventors). For the flash column chromatography, Lichroprep RP-18 (40-63 μm, MERCK, USA) was used as a filler. The sample was absorbed to celite

(Diatomaceous earth, approx. 95%, Sigma, USA) for loading. The primary solvent was prepared by adjusting the concentration ratio of acetonitrile to water as 60%. The concentration was raised to 100% by 10% gradient, during which each fraction was obtained by flow by gravity. Among these fractions obtained from each gradient, the fraction obtained at 80% gradient exhibited the highest activity.

Example 5: Isolation of amorphastilbol

The fraction obtained at 80% acetonitrile gradient was analyzed by HPLC (analytical HPLC, Waters 2996 Photodiode Array Detector, UV 210nm). Particularly, preparation was made for 60 minutes with average flow of 1 ml/minute by Phenomenex Luna 10 μm Ci₈ column with raising acetonitrile concentration ratio to water from 10% to 100%. The compound isolated therefrom at the Rt 26 minute was obtained ( see Figure 6 ) .

The structure of the compound was confirmed by NMR (¹H and ¹³C-NMR, Varian 500MHz spectrometer, Varian USA) . As a result, the compound isolated at the Rt 26 minute was identified as amorphastilbol. Example 6: Isolation of 5, 7-dihydroxy-6-geranyl flavanone

The fraction obtained at 80% acetonitrile gradient was analyzed by HPLC (analytical HPLC, Waters 2996 Photodiode Array Detector, UV 210nm). Particularly, preparation was made for 60 minutes with average flow of 1 ml/minute by Phenomenex Luna 10 μm Ci₈ column with raising acetonitrile concentration ratio to water from 10% to 100%. The compound isolated therefrom at the Rt 29 minute was obtained (see Figure 6). The structure of the compound was confirmed by NMR (¹H and ¹³C-NMR, Varian 500MHz spectrometer, Varian USA). As a result, the compound isolated at the Rt 29 minute was identified as 5, 7-dihydroxy-6-geranyl flavanone.

Experimental Example 1; Activation of PPARy (Peroxisome Proliferator Activated Receptor gamma) involved in lipid and glucose metabolism

Plasmids used herein were the plasmid containing PPARY gene behind universal promoter that could be expressed in general culture condition, the plasmid containing PPRE (PPARs Response Element) activated by the ligand-bound PPARY as a promoter and containing firefly luciferase gene acting as a reporter, and the plasmid containing Renilla luciferase gene conjugated with universal promoter (pRL-SV40, Promega, USA) as a reference (KLIEWER SA., Proc. Nadl. Acad. Sci. USA, 91: 7355-7359, 1994).

CV-I cells (CCL-70, ATCC) were distributed in a 24- well plate at the concentration of 5xlO⁴ cells/well, followed by culture for 24 hours. Transient transfection was performed with the above three plasmids. After 24 hours of culture, the cells were washed with 1 x phosphate buffered saline (PBS). Candidates were treated at different concentrations for 24 hours, followed by washing with 1 x PBS. The cells were lysed with 1 x passive lysis buffer (PLB), and then luciferase activity was measured by using Dual-Luciferase^R Reporter Assay System kit (Promega, USA) . As the positive control in this invention, troglitazone known as one of PPARy ligands, was used. The negative control was treated with nothing. The activity of the negative control was considered as 100 and the activities were compared.

[Table l] Activation of PPARy by the extract of Robinia pseudo-acacia var. umbracul±fera, fractions thereof and compounds isolated therefrom

As shown in Table 1 and Figure 1, PPARY activity was higher when the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom, amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone, were treated to the cells, compared with the non-treated negative control. At this time, the higher the concentration, the higher the activity was. Therefore, it was confirmed that the extract of Robinla pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom were excellent components which can be effectively used for the improvement of lipid metabolism and glucose metabolism by activating PPARy.

Experimental Example 2: Fat cell differentiation

3T3L1 cells (CL-173, ATCC), the mouse preadipocytes, were inoculated in a 6-well plate at the concentration of 3 X 10⁵ cells/well. After 48 hours of culture, the media were replaced with differentiation media containing 1 uM dexamethasone, 10 ug/ml insulin and 500 uM isobutylmethylxantine (IBMX). The differentiation group was induced with differentiation only, while the positive control group was treated with troglitazone and the experimental group was treated with the compound at the concentration of 10 uM respectively. 48 hours later, media were replaced with those containing 10 ug/ml insulin and the compounds used in the positive control and the experimental group. Media were replaced every 48 hours, during which differentiation process was observed. The progress of differentiation was checked by oil red 0 staining. For the oil red 0 staining, the differentiated cells were washed with 37 °C phosphate buffered saline (PBS) twice and then fixed with 3.7% formalin (in PBS) at room temperature for 30 minutes. Then, formalin was eliminated and the fixed cells were washed twice with PBS and then once with 70% ethanol, followed by staining with oil red O (prepared at the concentration of 0.5% in isopropanol, and diluted at the ratio of stock: DDW=6 : 4 for every use) at room temperature for 30 minutes. The staining was measured under microscope.

As a result, as shown in Figure 2, fat accumulation in the groups treated with amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone was similar to that of the group treated with troglitazone, suggesting that the compounds of the present invention are very effective in the improvement of lipid metabolism (see Figure 2).

Experimental Example 3; Expressions of PPARy and fat cell differentiation related genes

3T3L1 cells, the mouse preadipocytes, were inoculated in 60φ dish at the concentration of 5 X 10⁵ cells/dish.

After 48 hours of culture, the media were replaced with differentiation media containing 1 uM dexamethasone, 10 ug/ml insulin and 500 uM isobutylmethylxantine (IBMX). The differentiation group was induced with differentiation only, the positive control group was treated with 10 uM of troglitazone , and the experimental group was treated with 10 uM of amorphastilbol or 5,7-dihydroxy-6-geranyl flavanone respectively. 48 hours later, media were replaced with those containing 10 ug/ml insulin and the compounds used in the positive control and the experimental group. Media were replaced every 48 hours, during which differentiation process was observed. Upon completion of the differentiation, total RNA was extracted by using trizol, and RT-PCR was performed to measure the expressions of fat cell differentiation related genes. Reverse transcription was performed by using a commercial kit (reverse transcription system, Promega) and PCR conditions were as follows: denaturation at 94 ^°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 1 minute, 30 cycles from denaturation to extension. Primers used for the PCR were as follows.

PPARY

Forward; 5' ttcgctgatgcactgcctat 3¹ (SEQ. ID. NO: 1)

Reverse; 5' gccaacagcttctccttctc 3¹ (SEQ. ID. NO: 2)

C/EBPα Forward; 5' aggtgctggagttgaccagt 3' (SEQ. ID. NO: 3) Reverse; 5¹ cagcctagagatccagcgac 3¹ (SEQ. ID. NO: 4)

Ap2

Forward; 5' atgtgtgatgcctttgtggga 3' (SEQ. ID. NO:

5) Reverse; 5' tgccctttcataaactcttgt 3¹ (SEQ. ID. NO:

6)

Adiponectin

Forward; 5' agcctggagaagccgcttat 3¹ (SEQ. ID. NO: 7) Reverse; 5¹ ttgcagtagaacttgccagtgc 3' (SEQ. ID. NO: 8)

Fas

Forward; 5¹ ctgcgtggctatgattatggc 3" (SEQ. ID. NO:

9)

Reverse; 5¹ cgtgaggttgctgtcgtctgt 3' (SEQ. ID. NO: 10)

GLUT4

Forward; 5' tcgtcattggcattctggtt 3¹ (SEQ. ID. NO:

H)

Reverse; 5' ggtcatcaagatggcacagc 3' (SEQ. ID. NO: 12)

Resistin

Forward; 5' tcaactccctgtttccaaatgc 3' (SEQ. ID. NO: 13)

Reverse; 5' tcttcacgaatgtcccacga 3' (SEQ. ID. NO: 14) GAPDH

Forward; 5¹ accacagtccatgccatcac 3' (SEQ. ID. NO: 15)

Reverse; 5¹ tccaccaccctgttgctgta 3' (SEQ. ID. NO: 16)

As a result, as shown in Figure 3, the expressions of PPARY and fat cell differentiation related genes, C/EBPα (CCAAT Enhancer Binding Protein Alpha), Ap2 (Adipocyte fatty acid-binding protein 2), adiponectin, fatty acid synthase (Fas), glucose transporter 4 (GLUT4) and resistin were increased by the treatment of amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone similarly to the level induced by the treatment of troglitazone used as the positive control, suggesting that the compounds of the present invention are involved in glucose and lipid metabolism.

Experimental Example 4: Effect of PPARα (Peroxisome Proliferator Activated Receptor alpha) on the acceleration of skin cell differentiation/suppression of proliferation, the promotion of lipid biosynthesis and the anti- inflammation.

An experiment was performed by the same manner as described in Experimental Example 1 except that PPARα was used as the plasmid instead of PPARγ.

CV-I cells were inoculated in a 24-well plate at the concentration of 5xlO⁴ cells/well, followed by culture for 24 hours. Then, transient transfection was performed with the three plasmid genes. After 24 hours of culture, the cells were washed with 1 x PBS and then treated with the substances of the present invention at the different concentrations, followed by further culture for 24 hours. After washing with 1 x PBS, the cells were lysed with 1 x PLB. Then, luciferase activity in samples and references was measured by using Dual-Luciferase^R Reporter Assay System kit (Promega, USA) according to the manufacturer's instruction. In this experiment, Wy-14,643 (Sigma, USA) known as the strongest ligand among PPARα ligands was used for the positive control and the negative control was treated with nothing.

[Table 2]

Activation of PPARα by the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom

As a result, as shown in Table 2 and Figure 4, PPARα activation was promoted when the extract of Robinia pseudo- acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone, were treated, compared with the non-treated negative control. And the higher the concentration, the higher the activation level was.

Experimental Example 5: Expressions of genes involved in PPARα and fatty acid oxidation

HepG2 cells (HB-8065, ATCC, USA), the human hepatoma cells, were inoculated in 60φ dish at the concentration of

1 X 10⁶ cells/dish. 24 hours later, Wy-14,643 (positive control), amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone were treated thereto at the concentration of 10 uM. 24 hours later, total RNA was extracted by using trizol and RT-PCR was performed to investigate the expressions of fatty acid oxidation related genes. Reverse transcription was performed by using a commercial kit

(reverse transcription system, Promega) and PCR conditions were as follows: denaturation at 94 ^°C for 1 minute, annealing at 54 ^°C for 1 minute, extension at 72 ^°C for 1 minute, 30 cycles from denaturation to extension. Primers used for the PCR were as follows.

PPARα

Forward; 5¹ acggaaagcccactctgccccctctc 3' (SEQ. ID. NO: 17)

Reverse; 5¹ cttgtccccgcagattctacattcg 3¹ (SEQ. ID. NO: 18) CPTloc

Forward; 5¹ agacggtggaacagaggctgaag 3' (SEQ. ID. NO:

19)

Reverse; 5¹ tgagaccaaacaaagtgatgatgtcag 3' (SEQ. ID, NO: 20)

ACO2

Forward; 5' gcggacatggctactcaaagc 3¹ (SEQ. ID. NOJ 21)

Reverse; 5' gcagtgcaccttagcagcctg 3¹ (SEQ. ID. NO; 22)

GAPDH

Forward; 5' accacagtccatgccatcac 3'(SEQ. ID. NO: 23)

Reverse; 5' tccaccaccctgttgctgta 3'(SEQ. ID. NO: 24)

As a result, as shown in Figure 5, the expressions of PPARα and fatty acid oxidation related genes, CPTlα (Carnitine Palmitoyl Transferase I alpha) and ACO2 (Acyl-CoA Oxidase 2) were increased by the treatment of amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone similarly to the level induced by the treatment of Wy-14643 used as the positive control, suggesting that the compounds of the present invention are involved in fatty acid oxidation.

Experimental Example 6: Inhibitory effect of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom on the TNF α biosynthesis induced by UV

Human keratinocytes isolated directly from newborn skin were distributed in a 12-well culture plate at the concentration of 10⁵ cells/well, followed by culture. The cells were irradiated with UV B (30 mJ/cm²). Then, media were replaced with those containing 10 uM of each experimental sample or 10 ppm of the extract. After 6-24 hours of culture, the cells were harvested, followed by ELISA (Pharmingen 555212) to quantify the level of TNFα. Considering the level of the UV control as 100, the levels of the experimental groups were compared and the results are shown in Table 3.

[Table 3]

Inhibitory effect of the extract of Robinia pseudo- acacia var. umbraculifera, fractions thereof and compounds isolated therefrom on the TNFα biosynthesis induced by UV

As a result, as shown in Table 3, the extract of

Roblnia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone, inhibited TNFα biosynthesis induced by UV. Experimental Example 7: Inhibitory effect of the extract of Roblnla pseudo-acacia var. umbracullfera, fractions thereof and compounds isolated therefrom on the metalloelastase-1 (MMP-I) biosynthesis induced by UV <7-l> Relation of TNFα with MMP-I

Human fibroblasts, the primary cells isolated directly from newborn skin, were distributed in a 48-well culture plate at the concentration of 10⁴ cells/well, followed by culture. 24 hours later, the cells were irradiated with UV A (15 J/cm²). Then, TNFα antibody was treated thereto at the concentration of 1 ug/ml. On the second day of culture, the supernatant was harvested, followed by ELISA (AP biotech RPN2610) to quantify the level of type I collagenase. Considering the level of the control as 100, the levels of the experimental groups were compared.

[Table 4] Relation of type I collagenase biosynthesis with

TNFα antibody

As a result, as shown in Table 4, the biosynthesis of type I collagenase was increased by the treatment of UV A and TNFα. And the type I collagenase biosynthesis induced by UV was reduced by the treatment of TNFα antibody. That is, UV A increases TNFα, which results in the increase of type I collagenase. So, if TNFα, the intermediate inflammatory mediator, is interrupted, the biosynthesis of type I collagenase can be reduced. When the experimental samples, which are PPARα agonists, were treated to newborn fibroblasts, the biosynthesis of type I collagenase was reduced and reversely, when TNFα, the inflammatory mediator, was treated to the cells, the biosynthesis level was recovered.

<7-2> Relation of TNF α with each experimental sample

Human fibroblasts, the primary cells isolated directly from newborn skin, were distributed in a 48-well culture plate at the concentration of 10⁴ cells/well, followed by culture. 24 hours later, the cells were irradiated with UV A (15 J/cm²). The media were replaced with those containing 10 uM of each experimental sample or 10 ppm of the extract. Then, TNFα was treated thereto at the concentration of 10 ng/ml. On the second day of culture, the supernatant was harvested, followed by ELISA (AP biotech RPN2610) to quantify the level of type I collagenase. Considering the level of the UV control as 100, the levels of the experimental groups were compared.

[Table 5]

Relation of type I collagenase biosynthesis with

TNFα

As a result, as shown in Table 4 and Table 5, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone, could inhibit the type I collagenase biosynthesis induced by UV, which induced PPARα activation consecutively to reduce the biosynthesis of an inflammatory mediator.

Experimental Example 8: Expressions of genes involved in skin moisturization and hydration Human keratinocytes isolated directly from newborn skin were cultured in lOOφ dish at the concentration of 10⁶ cells/well. The media were replaced with the new ones containing 10 uM of each experimental sample or 10 ug/ml of the extract. After 24 hours of culture, the cells were harvested and proteins were obtained. The proteins were quantified by BCA kit (Pierce Biotechnology, USA) . Western blotting was performed to quantify filaggrin and involucrin generated. Particularly, proteins were loaded on SDS-PAGE gel (30 ug/lane), followed by electrophoresis and then those proteins were transferred onto PVDF membrane (Amersham, USA) by using transfer kit (Invitrogen, USA). Then, antibodies against filaggrin and involucrin (Santacruz Biotechnology, USA) were treated thereto at 37 ^°C for 1 hour, followed by washing three times with PBS. The membrane was treated with HRP conjugated secondary antibody at 37^°C for 1 hour, followed by washing three times with PBS again. The membrane was exposed on film by using ECL kit and the strength of band was measured with a densitometer. Considering the level of the control as 100, the levels of the experimental groups were compared.

[Table 6]

Effect of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated

As a result, as shown in Table 6, the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof, and compounds isolated therefrom such as amorphastilbol and 5 , 7-dihydroxy-6-geranyl flavanone increased the biosynthesis of filaggrin and involucrin, the natural moisturizing factors of keratinocytes, so that they demonstrated skin moisturizing effect.

Experimental Example 9; Acute toxicity of the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom in rats tested via oral administration

The following experiments were performed to see if the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom have acute toxicity in rats. 6-week old SPF SD line rats were used in the tests for acute toxicity. The extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom were suspended in 0.5% methylcellulose solution and orally administered once to rats at the dosage of 5 g/kg/15 vαi. Death, clinical symptoms, and weight change in rats were observed, hematological tests and biochemical tests of blood were performed, and any abnormal signs in the gastrointestinal organs of chest and abdomen were checked with eyes during autopsy.

The results showed that the test substances did not cause any specific clinical symptoms, weight change, or death in rats. No change was observed in hematological tests, biochemical tests of blood, and autopsy.

The substances used in this experiment were evaluated to be safe substances since they did not cause any toxic change in rats up to the level of 5 g/kg and their estimated LD₅₀ values were much greater than 5 g/kg in rats.

Experimental Example 10; Ligand-receptor binding assay (PPARy competitor assay)

In this experiment, PolarScreen™ PPAR Competitor Assay, Green (cat. No. PV3355, Invitrogen) was used. Troglitazone was used for the control group, and the compound of Example 5 was used for the experimental group. Each compound was diluted stepwise from the concentration of 25μM to 1.5 nM in Complete PPAR Green Screening Buffer. 20 μi of 2X sample and 20 /i of 2X PPAR-LBD (0.002 mg/ml) Fluormone™ PPAR Green complex were added to 40 βi of reaction solution, which was loaded in each well of a 384- well plate and well mixed in plate shaker. Reaction was induced for 2 hours at room temperature without light, followed by measuring fluorescence polarization (excitation: 485 nm, emission: 535 nm) with safire²™ micro- plate reader (Tecan, Salzburg, Austria). mP by- concentration was calculated. Considering the value of the non-treated control as 0 and considering the value of the group finished with the reaction for 2 hours in the 384- well plate only with 40 μi of IX PPAR-LBD (0.002 mg/ml) Fluormone™ PPAR Green complex without sample compound as 100, IC₅₀ values were calculated.

As a result, IC₅₀ of the positive control treated with troglitazone was 658 nM and IC₅₀ of the group treated with the compound of Example 5 was 1.2 uM, suggesting that this compound might be the ligand of PPARY receptor.

Experimental Example 11: Anti-obesity activity in high fat diet mouse model 7-week old C57BL/6 mice were purchased from SLC, Japan, which were adapted for 1 week in an animal lab before experiment. Standard diet (AIN-76 diet # 100000) and high fat diet (AIN-76 diet #101772) were used. The high fat diet was formulated to contain fat to take 65% of energy source. Each group was composed of 8 mice. Experimental groups were divided as normal group, high fat diet group, high fat diet and rosiglitazone treated group, high fat diet and the compound of Example <3-l> treated group, and high fat diet and the compound of Example 5 treated group. Experiments were continued for 8 weeks. Weights, food and water consumptions were measured every day at a fixed schedule. Weights were presented as mean values of 8 mice.

As shown in Figure 7 , the group treated with the compound of Example <3-l> exhibited 3.2% weight reduction at the concentration of 100 mg/kg, and 11.8% weight reduction at the concentration of 200 mg/kg of the compound of Example <3-l>, suggesting that the compound of Example 3 had anti-obesity activity (Figure 7). In the meantime, the group treated with the compound of Example 5 demonstrated 6% weight reduction at the concentration of 10 mg/kg, and 1.8% weight reduction at the concentration of 20 mg/kg. There were no significant changes in food and water consumptions. In general, food consumption was approximately 1.8-2g/day per mouse and water consumption was approximately 2.5 -3 ml/day per mouse.

Experimental Example 12: Anti-diabetic activity in leptin receptor knock-out db/db mouse model 5-week old C57BLKS/6-db/db mice were purchased from SLC, Japan, which were adapted for 1 week in an animal lab before experiment. The mice were fed with standard diet. Each group was composed of 8 mice. Experimental groups were divided as control group, rosiglitazone treated group, the compound of Example <3-l> treated group, and the compound of Example 5 treated group. Experiments were continued for 8 weeks. Weights, food and water consumptions were measured every day at a fixed schedule. Weights were presented as the mean value of 8 mice. Blood glucose was measured once per 1 - 2 weeks. Weights, water consumption and blood glucose were presented as the mean value of 8 mice.

As shown in Figure 8, the group treated with rosiglitazone for 8 weeks demonstrated approximately 14% weight increase, compared with the non-treated control group. The groups each treated with the compound of Example <3-l> and the compound of Example 5 demonstrated 5% weight increase or loss, compared with the control group, suggesting that the groups maintained almost normal weights (Figure 8) . As for blood glucose, as shown in Figure 9, the group treated with rosiglitazone for 8 weeks exhibited approximately 75% blood glucose reduction, compared with the non-treated control group. In the meantime, the group treated with the compound of Example <3-l> demonstrated 48% reduced blood glucose level at the concentration of 100 mg/kg and 56% reduced level at the concentration of 200 mg/kg, compared with the control. And the group treated with the compound of Example 5 demonstrated 26% reduced blood glucose level at the concentration of 10 mg/kg and 53% reduced level at the concentration of 20 mg/kg, indicating that the compounds of the present invention had dose-dependent blood glucose reducing effect (Figure 9).

As for water consumption, as shown in Figure 10, the group treated with rosiglitazone for 8 weeks showed 83% reduced water consumption, compared with the non-treated control group. The group treated with the compound of Example <3-l> showed 20% reduced water consumption at the concentration of 100 mg/kg and 35% reduced water consumption at the concentration of 200 mg/kg, compared with the control. The group treated with the compound of Example 5 showed 22% reduced water consumption at the concentration of 20 mg/kg, suggesting that the experimental compounds of the present invention could relieve drinking- a-lot symptom, one of symptoms by diabetes (Figure 10). The Manufacturing Examples of the composition for the present invention are described hereinafter.

Manufacturing Example 1; Preparation of pharmaceutical formulations <!-!> Preparation of powders

Extract of Example <l-3> 2 g

Lactose 1 g Powders were prepared by mixing all the above components, which were filled in airtight packs according to the conventional method for preparing powders.

<l-2> preparation of tablets Extract of Example <l-3> 100 rag

Corn starch 100 IDg

Lactose 100 mg

Magnesium stearate 2 rag

Tablets were prepared by mixing all the above components by the conventional method for preparing tablets .

<l-3> Preparation of capsules

Extract of Example <2-3> 100 rag

Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

Capsules were prepared by mixing all the above components, which were filled in gelatin capsules according to the conventional method for preparing capsules.

<l-4> Preparation of pills

Extract of Example <2-3> 1 g

Lactose 1.5 g

Glycerin 1 g Xylitol 0.5 g

Pills were prepared by mixing all the above components according to the conventional method for preparing pills. Each pill contained 4 g of the mixture.

<l-5> Preparation of granules

Extract of Example <2-3> 150 mg

Soybean extract 50 mg

Glucose 200 mg

Starch 600 mg All the above components were mixed, to which 100 mg of 30% ethanol was added. The mixture was dried at 60^°C and the prepared granules were filled in packs.

Manufacturing Example 2 ; Preparation of foods Foods containing the extract of Robinia pseudo-acacia var. umbraculifera were prepared as follows.

<2-l> Preparation of spices for cooking

Health enhancing spices for cooking was prepared with 20 - 95 weight part of the extract of Example <l-2> according to the conventional method.

<2-2> Preparation of tomato ketchup and sauce

Health enhancing tomato ketchup or sauce was prepared by mixing 0.2 ~ 1.0 weight part of the extract of Example <l-2> with tomato ketchup or sauce according to the conventional method.

<2-3> Preparation of flour food 0.5 - 5.0 weight part of the extract of Example <l-2> was added to the flour. Health enhancing foods such as bread, cake, cookies, crackers and noodles were prepared with the flour mixture according to the conventional method.

<2-4> Preparation of soups and gravies

0.1 - 5.0 weight part of the extract of Example <2-2> was added to soups and gravies. Health enhancing meat products, soups and gravies were prepared with this mixture by the conventional method. <2-5> Preparation of ground beef

Health enhancing ground beef was prepared by mixing 10 weight part of the extract of Example <2-2> with ground beef according to the conventional method.

<2-6> Preparation of dairy products

5 - 10 weight part of the extract of Example <2-2> was added to milk. Health enhancing dairy products such as butter and ice cream were prepared with the milk mixture according to the conventional method.

<2-7> Preparation of Sun-Sik

Brown rice, barley, glutinous rice and Yulmu (Job's tears) were gelatinized according to the conventional method, dried and pulverized to obtain 60-mesh powders.

Black soybean, black sesame and wild sesame were steamed and dried according to the conventional method and pulverized to obtain 60-mesh powders.

The extract of Example <l-2> was concentrated under reduced pressure, spray-dried and pulverized to obtain 60- mesh dry powders .

Sun-Sik was prepared by mixing the dry powders of the grains, seeds and the extract of Example <3-2> according to the below ratio. Grains (brown rice: 30 weight part, Yulmu: 15 weight part, barley: 20 weight part) ,

Seeds (wild sesame: 7 weight part, black soybean: 8 weight part, black sesame: 7 weight part),

Dry powders of the compound isolated from the extract of Example <3-2> (3 weight part),

Ganoderma lucidum (0.5 weight part),

Rehmannia glutinosa (0.5 weight part)

Manufacturing Example 3: Preparation of beverages <3-l> Preparation of health beverages

Extract of Example <3-2> 1000 rag

Citric acid 1000 rag

Oligosaccharide 100 g

Maesil (Prunus mume) Extract 2 g Taurine 1 g

Purified water up to 900 mi

The above constituents were mixed according to the conventional method for preparing health beverages. The mixture was heated at 85 ^°C for 1 hour with stirring and then filtered. The filtrate was loaded in 2 liter sterilized containers, which were sealed and sterilized again, stored in a refrigerator until they would be used for the preparation of a composition for health beverages.

The constituents appropriate for favorite beverages were mixed according to the preferred mixing ratio but the composition ratio can be adjusted according to regional and national preferences, etc.

<3-2> Preparation of vegetable juice Health enhancing vegetable juice was prepared by adding 5 g of the extract of Example <3-2> of the present invention to 1,000 ΪΆI of tomato or carrot juice according to the conventional method.

<3-3> Preparation of fruit juice

Health enhancing vegetable juice was prepared by adding 1 g of the extract of Example <3-2> of the present invention to 1,000 ml of apple or grape juice according to the conventional method.

Manufacturing Example 4 : Preparation of ointment

The composition for skin external application containing the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom as an active ingredient can be prepared. The present inventors prepared a general ointment containing the Robinia pseudo-acacia var. umbraculifera extract.

[Table 7] Composition of ointment

Manufacturing Example 5; Preparation of cosmetics

Functional cosmetics containing the extract of Robinia pseudo-acacia var. umbraculifera, fractions thereof and compounds isolated therefrom of the present invention as an active ingredient can be prepared. The present inventors prepared functional cosmetics containing amorphastilbol or 5, 7-dihydroxy-6-geranyl flavanone as an active ingredient, which are exemplified by such emulsified cosmetics as lotion, cream and essence; and such solubilized cosmetics as skin, etc.

<5-l> Preparation of emulsified cosmetics

Emulsified cosmetics were prepared according to the composition shown in Table 8. The method for the preparation is as follows.

1) heating the mixture comprising the raw materials 1-9 at 65-70°C; 2) adding the raw material 10 to the mixture of step

1)

3) dissolving the mixture comprising the raw materials 11-13 by heating at 65-70^°C;

4) slowly adding the mixture of step 2) during performing step 3), followed by emulsification at 8,000 rpm for 2-3 minutes;

5) dissolving the raw material 14 in water and then adding the solution to the mixture of step 4), followed by emulsification for 2 minutes;

6) weighing the raw materials 15-17, which were added to the mixture of step 5), followed by emulsification for 30 seconds; and

7) degassing the mixture of step 6) finished with the emulsification process and then cooling thereof at 25-35 ^°C to give emulsified cosmetics.

[Table 8]

<5-2> Preparation of solubilized cosmetics

Solubilized cosmetics were prepared according to the composition shown in Table 9. The method for the preparation is as follows.

1) adding the raw materials 2-6 to the raw material 1 (purified water), which were dissolved by using Agi-mixer;

2) adding the raw materials 8-11 to the raw material 7 (alcohol) and completely dissolved; and

3) slowly adding the mixture of step 2) to the mixture of step 1), followed by solubilization.

[Table 9]

Compositions of solubilized formulations 1, 2 and 3

Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Claims

[CLAIMS]

[Claim l]

A composition containing the extract of Robinia pseudo-acacia var. umbraculifera as an active ingredient for the prevention and treatment of peroxisome proliferator-activated receptor (PPAR) mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease.

[Claim 2]

The composition according to claim 1, wherein the extract of Robinia pseudo-acacia var. umbraculifera is extracted with water, Ci - C₄ lower alcohol or a mixture thereof as a solvent.

[Claim 3]

The composition according to claim 2, wherein the lower alcohol is ethanol or methanol.

[Claim 4]

The composition according to claim 1, wherein the PPAR is PPARY or PPARα.

[Claim 5] A composition containing the fraction of the extract of Robinia pseudo-acacia var. umbraculifera which is additionally extracted with an organic solvent from the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent as an active ingredient for the prevention and treatment of a PPAR mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease.

[Claim 6]

The composition according to claim 5, wherein the fraction is methanol soluble layer obtained by the processes of adding dichloromethane as an organic solvent to the extract of Robinia pseudo-acacia var. umbraculifera} and discarding the dichloromethane soluble layer; and then adding methanol again to give methanol soluble layer.

[Claim 7] A composition containing the active fraction obtained from the extract of Robinia pseudo-acacia var. umbraculifera by column chromatography, precisely by the processes of absorbing the fraction of claim 6 on silica gel; raising acetonitrile concentration ratio to water from 60% to 100% stepwise by 10%; and obtaining active fraction at 80% gradient, as an active ingredient for the prevention and treatment of A PPAR mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease.

[Claim 8]

A composition containing amorphastilbol represented by formula 1 or its pharmaceutically acceptable salts as an active ingredient for the prevention and treatment of A PPAR mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease.

<Formula 1>

[Claim 9]

A composition containing 5, 7-dihydroxy-6-geranyl flavanone represented by formula 2 or its pharmaceutically acceptable salts as an active ingredient for the prevention and treatment of A PPAR mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease. <Formula 2>

Wherein, Ri, R₂ and R₃ are independently H, OH or OCH₃.

[Claim 10]

The composition according to claim 1, claim 5, claim 7, claim 8 or claim 9, wherein the metabolic disease mediated by PPAR is selected from the group consisting of diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, hypercholesterolemia, hypertriglyceridemia, syndrome X and endothelial dysfunction.

[Claim ll]

The composition according to claim 10, wherein the hypercholesterolemia is selected from the group consisting of hypo-HDL-cholesterolemia, hyper-LDL-cholesterolemia and hypertriglyceridemia .

[Claim 12] The composition according to claim 1, claim 5, claim 7, claim 8 or claim 9, wherein the cardiovascular disease mediated by PPAR is selected from the group consisting of hypertension, precoagulant state, dyslipidemia and atherosclerosis .

[Claim 13]

The composition according to claim 1, claim 5, claim

7, claim 8 or claim 9, wherein the skin disease mediated by

PPAR is selected from the group consisting of skin barrier enhancement, atopy, contact dermatitis and inflammatory disease.

[Claim 14]

A method for the treatment of obesity, metabolic disease, cardiovascular disease or skin disease containing the step of administering a pharmaceutically effective dose of the extract of Roblnia pseudo-acacia var. umbraculifera of claim 1, the fraction of claim 5, or the compound of claim 8 or claim 9 to a subject with obesity, metabolic disease, cardiovascular disease or skin disease.

[Claim 15]

A method for the prevention of obesity, metabolic disease, cardiovascular disease or skin disease containing the step of administering a pharmaceutically effective dose of the extract of Robinia pseudo-acacia var. umbraculifera of claim 1, the fraction of claim 5, or the compound of claim 8 or claim 9 to a subject with obesity, metabolic disease, cardiovascular disease or skin disease.

[Claim 16]

A use of the extract of Robinia pseudo-acacia var. umbracul±fera of claim 1, the fraction of claim 5, or the compound of claim 8 or claim 9 for the prevention and treatment of obesity, metabolic disease, cardiovascular disease or skin disease.

[Claim 17]

A PPARY agonist containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and compounds isolated from the fractions such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone, as an active ingredient.

[Claim 18]

A PPARα agonist containing one or more substances selected from the group consisting of the extract of

Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and compounds isolated from the fractions such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone, as an active ingredient.

[Claim 19]

A health food containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and compounds isolated from the fractions such as amorphastilbol and 5, 7-dihydroxy-6-geranyl flavanone for the prevention and improvement of a PPAR mediated disease selected from the group consisting of obesity, metabolic disease, cardiovascular disease and skin disease.

[Claim 20]

A composition for skin external application containing one or more substances selected from the group consisting of the extract of Robinia pseudo-acacia var. umbraculifera extracted with water, alcohol or a mixture thereof as a solvent, fractions thereof and compounds isolated from the fractions such as amorphastilbol and 5,7- dihydroxy-6-geranyl flavanone for the prevention and improvement of a PPAR mediated disease selected from the group consisting of skin aging, low elasticity, wrinkles, skin drying and keratin formation