KR20140030721A - Composition containing extract of amorpha fruticosa - Google Patents
Composition containing extract of amorpha fruticosa Download PDFInfo
- Publication number
- KR20140030721A KR20140030721A KR1020120097228A KR20120097228A KR20140030721A KR 20140030721 A KR20140030721 A KR 20140030721A KR 1020120097228 A KR1020120097228 A KR 1020120097228A KR 20120097228 A KR20120097228 A KR 20120097228A KR 20140030721 A KR20140030721 A KR 20140030721A
- Authority
- KR
- South Korea
- Prior art keywords
- composition
- extract
- weasel
- group
- weight
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/105—Plant extracts, their artificial duplicates or their derivatives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/05—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/351—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom not condensed with another ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline
- A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
Abstract
Description
본 발명은 족제비싸리 (Amorpha fruticosa) 추출물을 포함하는 PTP 저해용 또는 PPAR 활성화용 조성물에 관한 것이다. The present invention is a weasel ( Amorpha) The present invention relates to a composition for inhibiting PTP or activating PPAR, including an extract of fruticosa ).
PTPs (Protein tyrosine phosphatases) 는 정상적인 생리환경에서는 음성 조절제로 작용하고, 인슐린 내성상태를 유도하는 어떤 역할을 한다고 알려져 있다. (Koren and Fantus, 2007). Protein tyrosine phosphatases (PTPs) are known to act as negative regulators in normal physiological environments and to play a role in inducing insulin resistance. (Koren and Fantus, 2007).
이 중 PTP1B는 당뇨와 비만의 주요 타겟으로 확인되었으며, 이후 PTPs는 새롭게 기대되는 신호전달 타겟으로 대두되고 있다. (Hooft etal.,2002). Among them, PTP1B has been identified as a major target for diabetes and obesity. Since then, PTPs have emerged as newly expected signaling targets. (Hooft et al ., 2002).
구체적으로, PTP1B 녹아웃 마우스는 내당능시험 (glucose tolerance test)에서 인슐린 감수성을 증가시켰고, 그 결과 IRS-1 인산화를 오랫동안 지속시켜서 조직이 인슐린에 대해서 잘 반응하여 당내성을 나타내지 않게 하는 좋은 효능을 보여주었다. (Elcheblyetal.,1999).Specifically, PTP1B knockout mice increased insulin sensitivity in the glucose tolerance test, and as a result, they showed long-lasting IRS-1 phosphorylation and showed good efficacy in preventing tissues from responding well to insulin. . (Elchebly et al ., 1999).
아울러, 마우스모델에서 PTP1B 의 발현 (Expression)을 감소시켰을 때도 인슐린 감수성이 증가한다는 내용이 보고된 바 있어서 이는 PTP1B의 발현 조절이 인슐린 감수성 조절에 매우 중요한 요소이며, 비만 및 당뇨의 개선의 주요 타겟이 될수 있다. (Zinkeretal.,2002;Gumetal.,2003). In addition, it has been reported that insulin sensitivity is increased even when the expression of PTP1B is reduced in the mouse model, which indicates that the regulation of PTP1B expression is a very important factor in the regulation of insulin sensitivity and is a major target for improving obesity and diabetes. Can be. (Zinker et al ., 2002; Gum et al ., 2003).
한편, 퍼옥시좀(Peroxisome)은 이러한 대사기능 이상의 원인이 되는 세포 내 소기관 중 하나로 오랫동안 세포 기능상에 있어 마이너(minor)한 역할을 하는 것으로 여겨져 왔으나 최근의 많은 연구를 통해 산소, 포도당, 지질, 호르몬의 대사 등에 있어 중요한 역할을 담당하며, 또한, 세포증식/분화의 조절, 염증 매개체들의 조절에도 폭 넓은 영향을 가지는 것으로 보고 되어지고 있다. 지질대사와 포도당대사를 통하여 퍼옥시좀은 인슐린 감수성뿐만 아니라 세포막과 비만세포(adipocyte) 형성에 영향을 주고 산화적 스트레스에 대한 영향을 통해서 노화 및 종양 발생(tumorigenesis)에서도 중요한 역할을 하는 것으로 알려지고 있다(smith. KJ et.al., J Cutan Med Surg 5(3):231-43, 2001; smith. KJ et.al., J Cutan Med Surg 5(4):315-22, 2001). 퍼옥시좀 증식체 활성화 수용체(peroxisome proliferator-activated receptors, PPARs)는 48가지의 핵수용체 (nuclear receptors)중 하나이며 리간드(ligand) 결합에 의해 유전자 발현을 조절한다.On the other hand, peroxysomes (Peroxisome) is one of the intracellular organelles that cause these metabolic abnormalities have been considered to play a minor role in cellular function for a long time, but through the recent research, oxygen, glucose, lipids, hormones It has been reported to play an important role in metabolism, and also have a wide range of effects on the regulation of cell proliferation / differentiation and the regulation of inflammatory mediators. Through lipid metabolism and glucose metabolism, peroxysomes are known to play an important role in not only insulin sensitivity but also in cell membrane and adipocyte formation and in aging and tumorigenesis through effects on oxidative stress. (Smith.KJ et.al., J Cutan Med Surg 5 (3): 231-43, 2001; smith.KJ et.al., J Cutan Med Surg 5 (4): 315-22, 2001). Peroxisome proliferator-activated receptors (PPARs) are one of 48 nuclear receptors and regulate gene expression by ligand binding.
본 발명자들은 족제비싸리 추출물이 PTP1B 저해시키거나 또는 PPAR 활성화시켜서, 이에 따라 인슐린 감수성을 증가시켜 비만/당뇨를 조절할 수 있음을 확인하고 본 발명을 완성하게 되었다. The present inventors have completed the present invention by confirming that weasel extract may inhibit PTP1B or activate PPAR, thereby increasing insulin sensitivity and controlling obesity / diabetes.
본 발명의 목적은 천연물을 함유하는 PTP 저해용 또는 PPAR 활성화용 조성물을 제공하는 것이다. An object of the present invention is to provide a composition for inhibiting PTP or activating PPAR containing natural products.
상기 목적을 달성하기 위하여, 본 발명은 족제비싸리 (Amorpha fruticosa) 추출물 또는 그의 분획물을 유효성분으로 포함하는 PTP1B 저해용 조성물을 제공한다.In order to achieve the above object, the present invention is a weasel ( Amorpha fruticosa ) provides a composition for inhibiting PTP1B comprising an extract or a fraction thereof as an active ingredient.
본 발명은 또한 족제비싸리 (Amorpha fruticosa) 추출물 또는 그의 분획물을 유효성분으로 포함하는 PPARα 활성화용 조성물을 제공한다. The invention is also a weasel ( Amorpha) fruticosa ) provides a composition for activating PPARα comprising an extract or a fraction thereof as an active ingredient.
본 발명의 조성물은 족제비싸리 추출물을 포함하여, PTP1B을 저해시킨다. 뿐만 아니라, 족제비싸리 추출물에서 분리한 아몰파스틸볼 및 5,7-디하이드록시게라닐플라바논 화합물 역시 우수한 PTP1B 저해 효능을 가진다. 구체적으로, 본 발명의 조성물은 PTP1B의 활성과 발현 모두를 저해시킴에 따라 인슐린에 대한 감수성을 증가시켜 혈당을 감소시킬 수 있고, 근육세포내 포도당 uptake에 대해 매우 우수한 활성을 보인다. 더불어, 본 발명의 조성물은 몸무게 증가를 저해시키고, 공복혈당 및 총콜레스테롤, LDL-콜레스테롤의 증가를 저하시킬 수 있다. The composition of the present invention comprises a weasel extract, which inhibits PTP1B. In addition, amorphastilball and 5,7-dihydroxygeranyl flavanone compounds isolated from weasel extract also have excellent PTP1B inhibitory effect. Specifically, the composition of the present invention can decrease blood sugar by increasing the sensitivity to insulin as it inhibits both the activity and expression of PTP1B, and shows very good activity against glucose uptake in muscle cells. In addition, the composition of the present invention may inhibit the increase in weight, decrease the fasting blood sugar and total cholesterol, LDL-cholesterol increase.
본 발명의 조성물은 또한 족제비싸리 추출물을 포함하여, PPARα를 활성화시킨다. 뿐만 아니라, 족제비싸리 추출물에서 분리한 아몰파스틸볼 및 5,7-디하이드록시게라닐플라바논 화합물 역시 우수한 PPARα 활성화 효능을 가진다. The composition of the present invention also includes a weasel extract, which activates PPARα. In addition, amorphastilball and 5,7-dihydroxygeranyl flavanone compounds isolated from weasel extract also have excellent PPARα activation efficacy.
본 발명의 조성물은 상기와 같은 효능을 가지면서도 천연물을 유효성분으로 함유하여 독성이 없어서, 비만 또는 당뇨의 예방 또는 치료에 유용하다. The composition of the present invention is not toxic because it contains the natural ingredients as an active ingredient while having the above-mentioned efficacy, it is useful for the prevention or treatment of obesity or diabetes.
도 1은 족제비싸리 추출물 및 이로부터 분리된 화합물 각각의 인슐린신호전달 및 PTP1B발현에 미치는 영향에 관한 것이다.
도 2는 정상조건 및 인슐린 내성조건에서 족제비싸리 추출물 및 이로부터 분리된 화합물 각각의 세포내 포도당 uptake에 대한 활성에 관한 것이다.
도 3은 족제비싸리 추출물 및 분획물 각각의 공복혈당, 총콜레스테롤, LDL-콜레스테롤에 미치는 영향을 측정한 것이다.
도 4는 마우스의 간 무게를 측정한 결과이다.
도 5는 PPAR α의 활성화 정도를 관찰한 것이다.
도 6은 PPARα 및 이와 관련된 유전자의 활성화에 관한 것이다.FIG. 1 relates to the effects of ferret extract and compounds isolated therefrom on insulin signaling and PTP1B expression.
Figure 2 relates to the activity on the intracellular glucose uptake of each of the weasel extract and the compounds isolated therefrom under normal conditions and insulin resistance conditions.
Figure 3 measures the effects on fasting blood glucose, total cholesterol, LDL-cholesterol of the weasel extract and fractions.
4 is a result of measuring the liver weight of the mouse.
5 shows the degree of activation of PPAR α.
6 relates to the activation of PPARα and related genes.
본 발명은 일 관점에서, 족제비싸리 (Amorpha fruticosa) 추출물 또는 그의 분획물을 유효성분으로 포함하는 PTP1B 저해용 조성물에 관한 것이다. The present invention in one aspect, weasel ( Amorpha fruticosa ) relates to a composition for inhibiting PTP1B comprising an extract or a fraction thereof as an active ingredient.
본 명세서에서 '족제비싸리(Amorpha fruticosa)'는 쌍떡잎식물 장미목 콩과의 낙엽관목으로, 쪽싸리 또는 왜싸리라고도 하며, 북아메리카가 원산지이다. 잎은 싸리나무와 같고 씨앗은 백태콩깍지와 비슷하다. 높이는 3m 내외이고, 나무가지에 털이 있으나 성장하면서 점점 없어진다. 잎은 어긋나고 1회 깃꼴겹잎이다. 작은 잎은 11~25개씩이고 달걀 모양 또는 타원형이며 가장자리가 밋밋하다. 꽃은 5~6월에 피고 자줏빛이 도는 하늘색이며 향기가 강하다. 열매는 9월에 결실하며 협과이다. 열매에는 1개의 종자가 들어 있으며 신장 모양이다.In the present specification, 'weasel ( Amorpha) fruticosa ) 'is a deciduous shrub of the dicotyledonous rosemary legaceae, also known as prunus saxor, or native to North America. The leaves are like a birch and the seeds are similar to baektae pods. It is about 3m high and has hairs on the branches, but gradually disappears as it grows. The leaves are shifted and the pinnate leaf is 1 time. The leaflets are 11-25 each, egg-shaped or oval, and the edges are flat. Flowers bloom in May-June and have a purplish blue color with a strong scent. Fruits are fruiting and fruiting in September. Fruit contains one seed and is kidney-shaped.
본 명세서에서 사용되는 족제비싸리는 그 입수 방법에 제한이 없으며, 재배하여 사용하거나 시판되는 것을 구입하여 사용할 수도 있다. 아울러 본 명세서에서 사용되는 족제비싸리는 족제비싸리 초본의 지상부 또는 지하부의 일부 또는 전부를 사용할 수 있다. 본 발명의 일 실시예에서는 족제비싸리의 지상부 (잎, 잔가지, 줄기), 뿌리 및 종자를 이용하였으나, 이에 제한되는 것은 아니다. Weasel used in the present specification is not limited to the method of obtaining the cultivation, may be used by cultivating or commercially available. In addition, weasel is used herein may use part or all of the above ground or underground part of weasel herbaceous. In one embodiment of the present invention, but the ground portion (leaves, twigs, stems), roots and seeds of weasel, but not limited thereto.
본 명세서에서 상기 'PTP1B'는 단백질 타이로신 탈인산화 효소 (Protein tyrosine phosphatases, PTP)의 일종으로, 상기 PTP는 정상적인 생리환경에서는 음성 조절제로 작용하고, 인슐린 내성상태를 유도할 수 있다. In the present specification, 'PTP1B' is a type of protein tyrosine phosphatases (PTP), and the PTP may act as a negative regulator in a normal physiological environment and induce insulin resistance.
본 명세서에서 상기 'PTP1B를 저해'한다는 것은 PTP1B 유전자의 활성을 저해 또는 억제하여 상기 유전자의 발현을 저해 또는 억제하거나 PTP1B 효소의 활성을 저해 또는 억제하는 모든 기작을 포함하는 것이나, 이에 제한되는 것은 아니다. In the present specification, 'inhibiting PTP1B' includes all mechanisms that inhibit or inhibit the activity of the PTP1B gene to inhibit or inhibit the expression of the gene or inhibit or inhibit the activity of the PTP1B enzyme, but are not limited thereto. .
본 명세서에서 '유효성분'은 단독으로 목적하는 활성을 나타내거나 또는 그 자체 활성이 없는 담체와 함께 활성을 나타낼 수 있는 성분을 의미하는 것이다.As used herein, the term 'active ingredient' refers to a component that can exhibit activity alone or with a carrier that does not exhibit the desired activity.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 족제비싸리 추출물은 족제비싸리-C1~C6 알코올 추출물을 포함할 수 있고, 구체적으로 족제비싸리-메탄올 추출물 또는 족제비싸리-에탄올 추출물일 수 있다. In the composition for inhibiting PTP1B, which is an aspect of the present invention, the weasel extract may include a weasel xari-C 1 to C 6 alcohol extract, and specifically, may be a weasel xari-methanol extract or a weasel xari-ethanol extract. .
본 명세서에서 상기 '족제비싸리 추출물'은 물, C1-C6 알콜, 및 이들이 조합으로 구성된 그룹에서 선택된 용매의 조추출물일 수 있다. 상기 C1-C6 알콜은 구체적으로 메탄올 또는 에탄올일 수 있다. 족제비싸리를 용매로 추출 시, 족제비싸리의 약 5 내지 15배 정도에 해당하는 용매를 가하여 추출하는 것이 바람직하며, 구체적으로 약 10 배의 용매를 가하여 추출하는 것이 바람직하나, 이에 한정되는 것은 아니다. 상기 추출은 가열 추출, 냉침 추출, 환류냉각 추출, 또는 초음파 추출 등이 이용될 수 있으며, 당업자에게 자명한 추출법이라면 제한이 없다. 상기 추출은 실온에서 수행할 수도 있으나, 보다 효율적인 추출을 위해서는 가온 조건 하에서 수행할 수 있으며, 바람직하게는 약 40 내지 100℃, 더욱 바람직하게는 약 80℃의 온도에서 추출할 수 있으나, 이에 한정되는 것은 아니다. 추출시간은 바람직하게는 약 2 내지 4시간, 더욱 바람직하게는 약 3 시간 동안 수행할 수 있으나 이에 한정되는 것은 아니며, 추출 용매 및 추출 온도 등의 조건에 따라 달라질 수 있다. 상기 추출은 활성성분을 보다 다량 수득하기 위해 1 회 이상 여러 번 추출할 수 있으며, 바람직하게는 1 내지 5회, 더욱 바람직하게는 3회 연속추출하여 합한 추출액을 이용할 수 있다.In the present specification, the 'weasel extract' may be a crude extract of water, C 1 -C 6 alcohol, and a solvent selected from the group consisting of a combination thereof. The C 1 -C 6 alcohol may specifically be methanol or ethanol. When the weasel is extracted with a solvent, it is preferable to extract by adding a solvent corresponding to about 5 to 15 times the weasel, and specifically, it is preferable to extract by adding about 10 times the solvent, but is not limited thereto. The extraction may be a heat extraction, cold extraction, reflux cooling extraction, or ultrasonic extraction, and the like, there is no limitation if the extraction is obvious to those skilled in the art. The extraction may be performed at room temperature, but for more efficient extraction, the extraction may be performed under heating conditions, preferably at about 40 to 100 ° C., more preferably at about 80 ° C., but is not limited thereto. It is not. The extraction time is preferably about 2 to 4 hours, more preferably about 3 hours, but is not limited thereto, and may vary depending on conditions such as extraction solvent and extraction temperature. The extraction may be extracted one or more times several times in order to obtain a larger amount of the active ingredient, preferably one to five times, more preferably three times the continuous extraction can be used combined extract.
본 명세서에서 족제비싸리 추출물은 상기와 같이 족제비싸리의 조추출물을 포함할 수 있고, 상기 조추출물을 극성이 낮은 유기 용매로 더욱 추출하여 얻어진 유기 용매의 가용성 분획물로서 포함할 수도 있다. 상기 유기 용매로는 헥산, 메틸렌클로라이드, 에틸 아세테이트, n-부탄올 등이 이용될 수 있으나, 이에 한정되는 것은 아니다. 상기의 방법으로 추출한 추출물 또는 그 추출물의 가용성 분획물은 그대로 사용할 수도 있으나, 여과 후 농축하여 엑기스 형태로 사용할 수 있으며, 농축 후 동결 건조하여 동결건조물의 형태로서 사용할 수 있다. In this specification, weasel extract may include crude extract of weasel as described above, and may be included as a soluble fraction of the organic solvent obtained by further extracting the crude extract with a low polar organic solvent. Examples of the organic solvent include, but are not limited to, hexane, methylene chloride, ethyl acetate, n-butanol, and the like. The extract or the soluble fraction of the extract may be used as it is, or may be used as an extract form by concentration after filtration, and may be used as a form of a lyophilizate by concentration and freeze-drying.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 족제비싸리 추출물 또는 그의 분획물은 화학식 1 및 화학식 2로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하며, In the composition for inhibiting PTP1B which is an aspect of the present invention, the weasel extract or a fraction thereof includes one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof in the group consisting of Formula 1 and Formula 2,
[화학식 1][Chemical Formula 1]
[화학식 2](2)
상기 화학식들에서, In the above formulas,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 또는 R32은 독립적으로 수소, C1 내지 C18의 알킬기, C1 내지 C18의 알콕시기, C1 내지 C18의 알케닐기 또는 C1 내지 C18의 알키닐기일 수 있다. R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 or R32 are independently hydrogen, an alkyl group of C 1 to C 18 , C 1 To C 18 alkoxy group, C 1 To alkenyl group of C 18 or C 1 To a C 18 alkynyl group.
본 명세서에서 '유도체'는 상기 화합물들의 치환 가능한 위치에서 다른 치환기로 변경되는 모든 화합물을 의미한다. 이러한 치환기의 종류에는 제한이 없으며, 예컨대 각각 독립적으로 히드록실, 페녹시, 티에닐, 푸릴, 피리딜, 시클로헥실, 알킬알콜, 알킬디알콜 또는 임의 치환된 페닐로 치환될 수 있는 C1 -10 비사이클릭 탄화수소기; 히드록실, 히드록시메틸, 메틸 또는 아미노로 치환될 수 있는 C5 -6 사이클릭 탄화수소기; 또는 당 잔기를 포함할 수 있으나, 이에 제한되는 것은 아니다. 본 명세서에서 '당 잔기'라는 용어는 다당류 분자로부터 1개의 수소 원자의 제거시의 기를 의미하며, 따라서 예를 들어 단당류 또는 올리고당으로부터 유래된 잔기를 의미할 수 있다.As used herein, the term "derivative" refers to all compounds that are changed to other substituents at substitutable positions of the compounds. The type of the substituent is not restricted, for example, C 1 -10 which may be substituted each independently hydroxyl, phenoxy, thienyl, furyl, pyridyl, cyclohexyl, alkyl alcohol, alkyl di-alcohol or an optionally substituted phenyl Bicyclic hydrocarbon groups; C -6 5 cyclic hydrocarbon group which may be substituted with hydroxyl, hydroxymethyl, methyl or amino; Or a sugar moiety, but is not limited thereto. As used herein, the term 'sugar residue' refers to a group upon removal of one hydrogen atom from a polysaccharide molecule, and thus may mean a residue derived from, for example, a monosaccharide or an oligosaccharide.
본 명세서에서 '약학적으로 허용 가능'이란 통상의 의약적 복용량(medicinal dosage)으로 이용할 때 상당한 독성 효과를 피함으로써, 동물, 더 구체적으로는 인간에게 사용할 수 있다는 정부 또는 이에 준하는 규제 기구의 승인을 받을 수 있거나 승인 받거나, 또는 약전에 열거되거나 기타 일반적인 약전으로 인지되는 것을 의미한다.As used herein, `` pharmaceutically acceptable '' means the approval of a government or equivalent regulatory body for use in animals, more specifically in humans, by avoiding significant toxic effects when used in conventional medicinal dosages. It can be received or approved, or listed in a pharmacopoeia or recognized as another general pharmacopeia.
본 명세서에서 '약학적으로 허용 가능한 염'은 약학적으로 허용 가능하고 모 화합물(parent compound)의 바람직한 약리 활성을 갖는 본 발명의 일측면에 따른 염을 의미한다. 상기 염은 (1) 염산, 브롬화수소산, 황산, 질산, 인산 등과 같은 무기산으로 형성되거나; 또는 아세트산, 프로파이온산, 헥사노산, 시클로펜테인프로피온산, 글라이콜산, 피루브산, 락트산, 말론산, 숙신산, 말산, 말레산, 푸마르산, 타르타르산, 시트르산, 벤조산, 3-(4-히드록시벤조일) 벤조산, 신남산, 만델산, 메테인설폰산, 에테인설폰산, 1,2-에테인-디설폰산, 2-히드록시에테인설폰산, 벤젠설폰산, 4-클로로벤젠설폰산, 2-나프탈렌설폰산, 4-톨루엔설폰산, 캄퍼설폰산, 4-메틸바이시클로 [2,2,2]-oct-2-엔-1-카르복실산, 글루코헵톤산, 3-페닐프로파이온산, 트리메틸아세트산, tert-부틸아세트산, 라우릴 황산, 글루콘산, 글루탐산, 히드록시나프토산, 살리실산, 스테아르산, 뮤콘산과 같은 유기산으로 형성되는 산 부가염(acid addition salt); 또는 (2) 모 화합물에 존재하는 산성 프로톤이 치환될 때 형성되는 염을 포함할 수 있다. 아울러, 본 명세서에 따른 화합물은 약제학적으로 허용 가능한 염뿐만 아니라, 통상의 방법에 의해 제조될 수 있는 모든 염, 수화물, 용매화물을 모두 포함할 수 있다. As used herein, 'pharmaceutically acceptable salts' refers to salts according to one aspect of the invention that are pharmaceutically acceptable and have the desired pharmacological activity of the parent compound. The salt is formed from (1) an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, or the like; (3-hydroxybenzoyl) benzoic acid, or an acetic acid, propionic acid, hexanoic acid, cyclopentenepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, Benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4- chlorobenzenesulfonic acid, 2- 4-methylbicyclo [2,2,2] -oct-2-en-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert Acid addition salts formed with organic acids such as butylacetic acid, laurylsulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid; Or (2) salts formed when the acidic proton present in the parent compound is substituted. In addition, the compounds according to the present disclosure may include not only pharmaceutically acceptable salts, but also all salts, hydrates, and solvates that may be prepared by conventional methods.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 족제비싸리 추출물 또는 그의 분획물은 아몰파스틸볼 (Amorphastilbol) 및 5,7-디히드록시-6-게라닐 플라바논 (5,7-dihydroxy-6-geranyl-flavanone)으로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함할 수 있다. In a composition for inhibiting PTP1B, which is an aspect of the present invention, the weasel extract or its fraction is amorphous (Amorphastilbol) and 5,7-dihydroxy-6-geranyl flavanone (5,7-dihydroxy- 6-geranyl-flavanone) may include one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof.
[화학식 3] 아몰파스틸볼 (Amorphastilbol) [Formula 3] Amorphastilbol (Amorphastilbol)
[화학식 4] 5,7-디히드록시-6-게라닐 플라바논 (5,7-dihydroxy-6-geranyl-flavanone)5,7-dihydroxy-6-geranyl flavanone (5,7-dihydroxy-6-geranyl-flavanone)
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 조성물은 족제비싸리 추출물 또는 그의 분획물을 조성물 총중량에 대하여 0.001 내지 10중량%로 함유할 수 있다. 족제비싸리 추출물 또는 그의 분획물이 조성물 총중량에 대하여 0.001중량% 미만으로 함유되면, PTP1B의 활성 또는 발현을 저해시키는 효능이 미미하며, 10중량%를 초과하여 함유되면, 약제 상의 다른 구성 성분의 함량을 제한하게 된다. 상기와 같은 관점에 있어서, 족제비싸리 추출물 또는 그의 분획물은 조성물 총중량에 대하여, 0.0011 내지 9중량%, 0.0012 내지 8중량%, 0.0013 내지 7중량%, 0.0014 내지 6중량%, 0.0015 내지 5중량%, 0.0016 내지 4중량%, 0.0017 내지 3중량%, 0.0018 내지 2중량% 또는 0.0019 내지 1중량%으로 함유될 수 있으며, 구체적으로 0.002중량%로 함유될 수 있으나 이에 제한되는 것은 아니다. In the composition for inhibiting PTP1B which is an aspect of the present invention, the composition may contain Weasel fern extract or fractions thereof in an amount of 0.001 to 10% by weight based on the total weight of the composition. When the weasel extract or fractions thereof is contained in an amount of less than 0.001% by weight based on the total weight of the composition, the effect of inhibiting the activity or expression of PTP1B is insignificant, and when contained in excess of 10% by weight, the content of other components on the pharmaceutical is limited. Done. In view of the above, weasel extract or fractions thereof, based on the total weight of the composition, 0.0011 to 9% by weight, 0.0012 to 8% by weight, 0.0013 to 7% by weight, 0.0014 to 6% by weight, 0.0015 to 5% by weight, 0.0016 It may be contained in 4 to 4% by weight, 0.0017 to 3% by weight, 0.0018 to 2% by weight or 0.0019 to 1% by weight, specifically may be contained in 0.002% by weight, but is not limited thereto.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 조성물은 상기 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 조성물 총중량에 대하여 0.000025~0.25중량%로 함유할 수 있다. 화학식 1의 유도체 또는 약학적으로 허용가능한 그들의 염이 0.000025중량% 미만으로 함유되면 PTP1B의 활성 또는 발현을 저해시키기에 충분하지 못하고, 0.25중량%를 초과하여 함유되면 다른 성분의 함량 및 제형화에 있어서 적절하지 못하다. 상기와 같은 관점에서, 본 발명의 일 관점인 PTP1B 저해용 조성물은 상기 화합물, 그의 유도체 또는 약학적으로 허용가능한 그들의 염을 조성물 총중량에 대하여 0.00005~0.2중량, 0.000075~0.15중량, 0.0001~0.1중량 또는 0.000125~0.05중량의 농도로 포함할 수 있다. In the composition for inhibiting PTP1B which is an aspect of the present invention, the composition may contain 0.000025 to 0.25% by weight of the compound, its derivatives or pharmaceutically acceptable salts thereof based on the total weight of the composition. Containing less than 0.000025% by weight of derivatives of the formula or pharmaceutically acceptable salts thereof is not sufficient to inhibit the activity or expression of PTP1B, content of more than 0.25% by weight in the content and formulation of other ingredients Not appropriate In view of the above, the composition for inhibiting PTP1B which is one aspect of the present invention is 0.00005 to 0.2, 0.000075 to 0.15, 0.0001 to 0.1 or the like based on the total weight of the composition, its derivatives or pharmaceutically acceptable salts thereof. It may be included in a concentration of 0.000125 ~ 0.05 weight.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 조성물은 혈당을 감소시킬 수 있다. 본 발명의 조성물은 혈당을 감소시켜서 비만 또는 당뇨와 관련된 질환의 치료 또는 예방에 유용하게 사용될 수 있다. In the composition for inhibiting PTP1B which is an aspect of the present invention, the composition may reduce blood sugar. The composition of the present invention can be usefully used for the treatment or prevention of diseases associated with obesity or diabetes by reducing blood sugar.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 조성물은 콜레스테롤을 감소시킬 수 있다. 본 발명의 조성물은 콜레스테롤을 감소시켜서 비만 또는 당뇨와 관련된 질환의 치료 또는 예방에 유용하게 사용될 수 있다. In the composition for inhibiting PTP1B which is an aspect of the present invention, the composition may reduce cholesterol. The composition of the present invention can be usefully used in the treatment or prevention of diseases associated with obesity or diabetes by reducing cholesterol.
본 발명의 일 관점인 PTP1B 저해용 조성물에 있어서, 상기 조성물은 비만, 당뇨, 고지질혈증, 고인슐린혈증, 고요산혈증, 저 HLD-콜레스테롤증, 고 LDL-콜레스테롤증, 고트리글리세라이드혈증 및 고중성지방혈증으로 구성된 군에서 선택되는 하나 이상의 질환의 치료 또는 예방용을 포함한다. In the composition for inhibiting PTP1B which is an aspect of the present invention, the composition is obesity, diabetes, hyperlipidemia, hyperinsulinemia, hyperuricemia, low HLD-cholesterolemia, high LDL-cholesterolemia, hypertriglyceridemia and high neutrality For the treatment or prevention of one or more diseases selected from the group consisting of lipemia.
본 발명은 다른 관점에서, 족제비싸리 (Amorpha fruticosa) 추출물 또는 그의 분획물을 유효성분으로 포함하는 PPARα 활성화용 조성물에 관한 것이다.In another aspect, the present invention, weasel ( Amorpha fruticosa ) relates to a composition for activating PPARα comprising an extract or a fraction thereof as an active ingredient.
본 명세서에서 상기 'PPARα'는 퍼옥시좀 증식체 활성화 수용체(peroxisome proliferator-activated receptors, PPARs)의 일종으로, 상기 PPARα는 주로 혈관벽, 간, 심장, 근육, 신장, 갈색지방조직에서 발견된다.In the present specification, 'PPARα' is a kind of peroxisome proliferator-activated receptors (PPARs), and the PPARα is mainly found in blood vessel walls, liver, heart, muscle, kidney, and brown adipose tissue.
본 명세서에서 상기 'PPARα를 활성화'한다는 것은 PPARα 유전자의 활성을 증진시켜 상기 유전자의 발현을 촉진하거나 또는 PPARα에서 수용체의 활성을 촉진하는 모든 기작을 포함하는 것이나, 이에 제한되는 것은 아니다. In the present specification, 'activating the PPARα' includes all mechanisms that promote the expression of the gene by promoting the activity of the PPARα gene or promote the activity of the receptor in the PPARα, but are not limited thereto.
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 족제비싸리 추출물 또는 그의 분획물은 화학식 1 및 화학식 2로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하며, In the PPARα activating composition which is an aspect of the present invention, the weasel extract or fractions thereof includes one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof in the group consisting of
[화학식 1][Chemical Formula 1]
[화학식 2](2)
상기 화학식들에서, In the above formulas,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 또는 R32은 독립적으로 수소, C1 내지 C18의 알킬기, C1 내지 C18의 알콕시기, C1 내지 C18의 알케닐기 또는 C1 내지 C18의 알키닐기일 수 있다. R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 or R32 are independently hydrogen, an alkyl group of C 1 to C 18 , C 1 To C 18 alkoxy group, C 1 To alkenyl group of C 18 or C 1 To a C 18 alkynyl group.
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 족제비싸리 추출물 또는 그의 분획물은 아몰파스틸볼 및 5,7-디히드록시-6-게라닐 플라바논 (5,7-dihydroxy-6-geranyl-flavanone)으로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함할 수 있다. In the PPARα activating composition, which is an aspect of the present invention, the weasel extract or its fraction is amorphastyl ball and 5,7-dihydroxy-6-geranyl flavanone (5,7-dihydroxy-6-geranyl -flavanone) may include one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof.
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 조성물은 족제비싸리 추출물 또는 그의 분획물을 조성물 총중량에 대하여 0.001 내지 10중량%로 함유할 수 있다. 족제비싸리 추출물 또는 그의 분획물이 조성물 총중량에 대하여 0.001중량% 미만으로 함유되면, PPARα를 충분히 활성화시킬 수 없고, 10중량%를 초과하여 함유되면, 약제 상의 다른 구성 성분의 함량을 제한하게 된다. 상기와 같은 관점에 있어서, 족제비싸리 추출물 또는 그의 분획물은 조성물 총중량에 대하여, 0.0011 내지 9중량%, 0.0012 내지 8중량%, 0.0013 내지 7중량%, 0.0014 내지 6중량%, 0.0015 내지 5중량%, 0.0016 내지 4중량%, 0.0017 내지 3중량%, 0.0018 내지 2중량% 또는 0.0019 내지 1중량%으로 함유될 수 있으며, 구체적으로 0.002중량%로 함유될 수 있으나 이에 제한되는 것은 아니다. In the PPARα activating composition of one aspect of the present invention, the composition may contain a weasel extract or a fraction thereof in an amount of 0.001 to 10% by weight based on the total weight of the composition. If the weasel extract or fractions thereof is contained in an amount less than 0.001% by weight based on the total weight of the composition, the PPARα cannot be sufficiently activated, and when contained in excess of 10% by weight, the content of the other components of the drug is limited. In view of the above, weasel extract or fractions thereof, based on the total weight of the composition, 0.0011 to 9% by weight, 0.0012 to 8% by weight, 0.0013 to 7% by weight, 0.0014 to 6% by weight, 0.0015 to 5% by weight, 0.0016 It may be contained in 4 to 4% by weight, 0.0017 to 3% by weight, 0.0018 to 2% by weight or 0.0019 to 1% by weight, specifically may be contained in 0.002% by weight, but is not limited thereto.
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 조성물은 상기 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 조성물 총중량에 대하여 0.000025~0.25중량%로 함유할 수 있다. 화학식 1, 그의 유도체 또는 약학적으로 허용가능한 그들의 염이 0.000025중량% 미만으로 함유되면 PPARα을 충분히 활성화시킬 수 없고, 0.25중량%를 초과하여 함유되면 다른 성분의 함량 및 제형화에 있어서 적절하지 못하다. 상기와 같은 관점에서, 본 발명의 일 관점인 PPARα 활성화용 조성물은 상기 화합물, 그의 유도체 또는 약학적으로 허용가능한 그들의 염을 조성물 총중량에 대하여 0.00005~0.2중량, 0.000075~0.15중량, 0.0001~0.1중량 또는 0.000125~0.05중량의 농도로 포함할 수 있다. In the composition for activating PPARα which is an aspect of the present invention, the composition may contain 0.000025 to 0.25% by weight of the compound, its derivatives or pharmaceutically acceptable salts thereof based on the total weight of the composition. Containing less than 0.000025% by weight of
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 조성물은 PPARα를 활성화시켜서 혈당을 감소시키거나 또는 콜레스테롤을 감소시킬 수 있다. In the PPARα activating composition of one aspect of the present invention, the composition may reduce blood sugar or cholesterol by activating PPARα.
본 발명의 일 관점인 PPARα 활성화용 조성물에 있어서, 상기 조성물은 CPT1α, ACO2 및 GAPDH으로 구성된 군에서 선택되는 하나 이상의 유전자의 발현을 촉진할 수 있다. 상기 조성물은 CPT1α, ACO2 및 GAPDH으로 구성된 군에서 선택되는 하나 이상의 유전자의 발현을 촉진하거나 또는 상기 단백질의 활성을 증진시킬 수 있다. In the PPARα activation composition of one aspect of the present invention, the composition may promote the expression of one or more genes selected from the group consisting of CPT1α, ACO2 and GAPDH. The composition may promote the expression of one or more genes selected from the group consisting of CPT1α, ACO2 and GAPDH or enhance the activity of the protein.
본 발명의 일 관점인 조성물에 있어서, 상기 조성물은 건강식품 조성물을 포함한다. In one aspect of the invention, the composition comprises a health food composition.
상기 조성물은 이를 포함하는 드링크제, 발효유, 치즈, 요구르트, 주스, 생균제제 및 건강보조식품 등으로 가공될 수 있으며, 그 외 다양한 식품 첨가제의 형태로 사용될 수 있다. The composition may be processed into a drink, fermented milk, cheese, yogurt, juice, probiotic agent, and health supplement food or the like, and may be used in various other food additives.
일실시예에서 상기 조성물은, 본 발명이 목적으로 하는 주 효과를 손상시키지 않는 범위 내에서 주 효과에 상승 효과를 줄 수 있는 다른 성분 등을 함유할 수 있다. 예를 들어, 물성 개선을 위하여 향료, 색소, 살균제, 산화방지제, 방부제, 보습제, 점증제, 무기염류, 유화제 및 합성 고분자 물질 등의 첨가제를 더 포함할 수 있다. 그 외에도, 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당 및 해초 엑기스 등의 보조 성분을 더 포함할 수도 있다. 상기 성분들은 제형 또는 사용 목적에 따라서 당업자가 어려움 없이 적의 선정하여 배합할 수 있으며, 그 첨가량은 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 선택될 수 있다. In one embodiment, the composition may contain other ingredients and the like that can give a synergistic effect to the main effect within a range that does not impair the main effect of the present invention. For example, additives such as perfume, coloring agent, bactericide, antioxidant, preservative, moisturizing agent, thickening agent, inorganic salt, emulsifier and synthetic polymer substance may be further added for improvement of physical properties. In addition, supplementary ingredients such as water soluble vitamins, oil soluble vitamins, polymer peptides, polymer polysaccharides and seaweed extract may be further included. The above components may be mixed and selected without difficulty by those skilled in the art depending on the purpose of formulation or use, and the amount thereof may be selected within a range that does not impair the objects and effects of the present invention.
본 발명에 따른 조성물의 제형은 용액, 유화물, 점성형 혼합물, 타블렛, 분말 등의 다양한 형태일 수 있으며, 이는 단순 음용, 주사 투여, 스프레이 방식 또는 스퀴즈 방식 등의 다양한 방법으로 투여될 수 있다. The composition according to the present invention may be in various forms such as a solution, an emulsion, a viscous mixture, a tablet, a powder, etc., and may be administered by various methods such as simple drinking, injection administration, spraying or squeezing.
본 발명의 일 관점인 조성물에 있어서, 상기 조성물은 약학 조성물일 수 있다.In a composition which is an aspect of the present invention, the composition may be a pharmaceutical composition.
본 발명에 따른 조성물을 의약품에 적용할 경우에는, 상기 조성물을 유효성분으로 하여 상용되는 무기 또는 유기의 담체를 가하여 고체, 반고체 또는 액상의 형태로 경구 투여제 혹은 비경구 투여제로 제제화 할 수 있다.When the composition according to the present invention is applied to medicines, it may be formulated into an oral or parenteral dosage form in the form of solid, semi-solid or liquid by adding an inorganic or organic carrier to the composition as an active ingredient.
상기 경구 투여를 위한 제재로서는 정제, 환제, 과립제, 캡슐제, 산제, 세립제, 분제, 유탁제, 시럽제, 펠렛제 등을 들 수 있다. 또한, 상기 비경구 투여를 위한 제재로는 주사제, 점적제, 연고, 로션, 스프레이, 현탁제, 유제, 좌제 등을 들 수 있다. 본 발명의 유효성분을 제제화하기 위해서는 상법에 따라서 실시하면 용이하게 제제화할 수 있으며 계면활성제, 부형제, 착색료, 향신료, 보존료, 안정제, 완충제, 현탁제, 기타 상용하는 보조제를 적당히 사용할 수 있다.Examples of the agent for oral administration include tablets, pills, granules, capsules, powders, fine granules, powders, emulsions, syrups and pellets. Examples of the parenteral administration agent include injections, drops, ointments, lotions, sprays, suspensions, emulsions, suppositories, and the like. In order to formulate the active ingredient of the present invention, it can be easily formulated according to the conventional method. Surfactants, excipients, coloring agents, spices, preservatives, stabilizers, buffering agents, suspending agents and other adjuvants can be suitably used.
본 발명에 따른 상기 약학 조성물은 경구, 비경구, 직장, 국소, 경피, 정맥 내, 근육 내, 복강 내, 피하 등으로 투여될 수 있다. The pharmaceutical composition according to the present invention may be administered orally, parenterally, rectally, topically, transdermally, intravenously, intramuscularly, intraperitoneally, subcutaneously and the like.
또한, 상기 유효 성분의 투여량은 치료 받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있다. 일반적인 투여량은 0.001 ㎍/kg/일 내지 2000 ㎍/kg/일, 보다 구체적으로는 0.5 ㎍/kg/일 내지 1500 ㎍/kg/일이다.In addition, the dosage of the active ingredient will vary depending on the age, sex and weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determinations based on these factors are within the level of those skilled in the art. Typical dosages are from 0.001 [mu] g / kg / day to 2000 [mu] g / kg / day, more specifically from 0.5 [mu] g / kg / day to 1500 [mu] g / kg / day.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.
본 발명에서 사용된 족제비싸리나무는 대관령 고랭지에서 자생하고 있는 것을 사용하였다.Weasel tree used in the present invention used those native to Daegwallyeong highland.
[[ 실시예Example 1] 족제비싸리 지상부 추출물의 제조 1] Preparation of Weasel Leaf Extract
[[ 실시예Example 1-1] 족제비싸리 지상부의 메탄올 추출물의 제조 1-1] Preparation of Methanol Extracts from Weasel Ground
잎과 잔가지, 줄기를 포함한 족제비싸리나무 지상부 100 g을 100 % 메탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 12.5 g을 얻었다.100 g of weasel tree roots including leaves, twigs and stems were immersed in 1 L of 100% methanol and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.5 g of concentrate.
[[ 실시예Example 1-2] 족제비싸리 지상부의 물 추출물의 제조 1-2] Preparation of Water Extract from Weasel Ground
잎과 잔가지, 줄기를 포함한 족제비싸리나무 지상부 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 9.5 g을 얻었다.100 g of weasel tree ground including leaves, twigs, and stems were immersed in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.5 g of concentrate.
[[ 실시예Example 1-3] 족제비싸리 지상부의 에탄올 추출물의 제조 1-3] Preparation of Ethanol Extracts from Weasel Leaf
상기 족제비싸리나무 지상부 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 10.5 g을 얻었다.
100 g of the weasel ground part was soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.5 g of concentrate.
[[ 실시예Example 2] 족제비싸리 뿌리 추출물의 제조 2] Preparation of Weasel Root Extract
[[ 실시예Example 2-1] 족제비싸리 뿌리의 메탄올 추출물의 제조 2-1] Preparation of Methanol Extract of Weasel Root
족제비싸리나무 뿌리 100 g을 100 % 메탄올 1 L에 담그고 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 11.2 g을 얻었다.100 g of Weasel root were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 11.2 g of concentrate.
[[ 실시예Example 2-2]족제비싸리 뿌리의 물 추출물의 제조 2-2] Preparation of Water Extract of Weasel Root
족제비싸리나무 뿌리 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 9.3 g을 얻었다.100 g of weasel roots were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 9.3 g of concentrate.
[[ 실시예Example 2-3] 족제비싸리 뿌리의 에탄올 추출물의 제조 2-3] Preparation of Ethanol Extract of Weasel Root
족제비싸리나무 뿌리 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 10.0 g을 얻었다.
100 g of weasel roots were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.0 g of concentrate.
[[ 실시예Example 3] 족제비싸리 종자 추출물의 제조 3] Preparation of Weasel Seed Extract
[[ 실시예Example 3-1] 족제비싸리 종자의 메탄올 추출물의 제조 3-1] Methanol Extract of Weasel Seed
잘 익은 족제비싸리나무 종자 100 g을 100 % 메탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 14.7 g을 얻었다.100 g of ripe weasel seeds were soaked in 1 L of 100% methanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 14.7 g of concentrate.
[[ 실시예Example 3-2] 족제비싸리 종자의 물 추출물의 제조 3-2] Preparation of Water Extract of Weasel Seed
잘 익은 족제비싸리나무 종자 100 g을 물 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 10.7 g을 얻었다.100 g of ripe weasel seeds were soaked in 1 L of water and refluxed for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 10.7 g of concentrate.
[[ 실시예Example 3-3] 족제비싸리 종자의 에탄올 추출물의 제조 3-3] Preparation of Ethanol Extract of Weasel Fructus Seeds
잘 익은 족제비싸리나무 종자 100 g을 100 % 에탄올 1 L에 담구어 3 시간 동안 환류 추출하였다. 이를 3회 반복하여 얻은 추출액을 감압 건조하고 농축하여 농축물 12.7 g을 얻었다.
100 g of ripe weasel seeds were soaked in 1 L of 100% ethanol and extracted under reflux for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 12.7 g of concentrate.
[[ 실시예Example 4] 족제비싸리 추출물로부터 4] from weasel extract 분획물의Fraction 제조 Produce
상기 [실시예 3-1]에서 제조한 족제비싸리 종자의 메탄올 추출물을 일반적인 극성에 따른 용매분획법의 단계를 따라 분획하였다. 메탄올추출물 10 g을 물 500 ml에 현탁한 후 메틸렌클로라이드로 진탕추출하고, 정치하여 메틸렌클로라이드층을 분리하였다. 2회 더 분획한 후 메틸렌클로라이드층을 모두 합하여 감압건조하여 메틸렌클로라이드분획(<4M>)을 얻었다. 이어서 남은 물층에 헥산(<4H>), 에틸아세테이트(<4E>), 부탄올(<4B>)로 차례차례 분획하고 남은 층을 물(<4W>)분획으로 하였다. 위 분획을 감압농축하여, 메틸렌클로라이드분획 0.8 g, 헥산분획 1.1 g, 에틸아세테이트분획 2.1 g, 부탄올분획 2.5 g, 물분획 3.5 g을 수득하였다.
The methanol extract of the weasel seed, prepared in [Example 3-1], was fractionated according to the steps of solvent fractionation according to general polarity. 10 g of methanol extract was suspended in 500 ml of water, shaken with methylene chloride, and left to stand to separate the methylene chloride layer. After further distillation, the methylene chloride layers were combined and dried under reduced pressure to obtain a methylene chloride fraction (<4M>). Subsequently, the remaining water layer was partitioned sequentially with hexane (<4H>), ethyl acetate (<4E>), butanol (<4B>), and the remaining layer was partitioned with water (<4W>). The above fraction was concentrated under reduced pressure to obtain 0.8 g of methylene chloride fraction, 1.1 g of hexane fraction, 2.1 g of ethyl acetate fraction, 2.5 g of butanol fraction, and 3.5 g of water fraction.
[[ 실시예Example 5] 5] 아몰파스틸볼의Amorphous steel ball 분리 detach
상기 [실시예 3-1]에서 제조한 족제비싸리 종자의 메탄올 추출물을 500ml 물에 현탁한 후 500 ml 에틸아세테이트로 3회 분획하여 분획한 액을 감압농축하여 에틸아세테이트 분획을 15 g 제조하였다. 이 분획을 n-헥산-에틸아세테이트 그레디언트 시스템 (10:1 - 100% 메탄올)을 사용한 실리카겔 크로마토그래피에 적용하여 14개의 소분획으로 나누었다(4E1-4E14). 이중 4번째 분획을 클로로포름-메탄올 (100:1) 용매시스템으로 다시 실리카겔 크로마토그래피에 의해 3개의 소분획으로 다시 나누었고, 이중 2번째 소분획에서 preparative HPLC (Waters DeltaPrep 150 mL System, SunFire Silica 150 x 10 mm Column; mobile phase n-hexaneethylacetate(95:5);flowrate5ml/min,UVdetectionat254nm)를 사용하여 아몰파스틸볼을 분리(3 mg)하였다. 상기 아몰파스틸볼의 구조는 NMR 및 MS를 사용하여 규명하였다.
The methanol extract of the weasel fly seed prepared in [Example 3-1] was suspended in 500 ml of water, and then fractionated three times with 500 ml of ethyl acetate. The fractions were concentrated under reduced pressure to prepare 15 g of an ethyl acetate fraction. This fraction was subjected to silica gel chromatography using n-hexane-ethylacetate gradient system (10: 1-100% methanol) and divided into 14 small fractions (4E1-4E14). The fourth fraction was subdivided back into three subfractions by silica gel chromatography with chloroform-methanol (100: 1) solvent system, and preparative HPLC (
ESI-MS m/z 347 [M-H]+;ESI-MS m / z 347 [M−H] + ;
1H NMR (500 MHz, CDCl3) δ 7.48 (2H, d, J = 7.5 Hz), 7.35 (2H, t, J = 7.5 Hz), 7.25 (1H, br t, J = 7.5 Hz), 7.01 (1H, d, J = 16.5 Hz), 6.94 (1H, d, J = 16.5 Hz), 6.59 (2H, s), 5.22 (1H, m), 5.18 (1H, s), 5.06 (1H, m), 3.44 (2H, d, J = 7.0 Hz), 2.10 (4H, m), 1.83 (3H, s), 1.69 (3H, s), 1.60 (3H, s).
1 H NMR (500 MHz, CDCl 3 ) δ 7.48 (2H, d, J = 7.5 Hz), 7.35 (2H, t, J = 7.5 Hz), 7.25 (1H, brt, J = 7.5 Hz), 7.01 ( 1H, d, J = 16.5 Hz), 6.94 (1H, d, J = 16.5 Hz), 6.59 (2H, s), 5.22 (1H, m), 5.18 (1H, s), 5.06 (1H, m), 3.44 (2H, d, J = 7.0 Hz), 2.10 (4H, m), 1.83 (3H, s), 1.69 (3H, s), 1.60 (3H, s).
[[ 실시예Example 6] 5,7-디히드록시-6- 6] 5,7-dihydroxy-6- 게라닐Geranil 플라바논의Flavanese 분리 detach
상기 [실시예 3-1]에서 제조한 족제비싸리 종자의 메탄올 추출물을 500ml 물에 현탁한 후 500 ml 에틸아세테이트로 3회 분획하여 분획한 액을 감압농축하여 에틸아세테이트 분획을 15 g 제조하였다. 이 분획을 n-헥산-에틸아세테이트 그레디언트 시스템 (10:1 - 100% 메탄올)을 사용한 실리카겔 크로마토그래피에 적용하여 14개의 소분획으로 나누었다(E1-E14). 이중 4번째 분획을 클로로포름-메탄올 (100:1)용매시스템으로 다시 실리카겔 크로마토그래피에 의해 3개의 소분획으로 다시 나누었고, 이중 1번째 소분획에서 preparative HPLC (Waters DeltaPrep 150 mL System, SunFire Silica 150 x 10 mm Column; mobile phase n-hexaneethylacetate(95:5);flowrate5ml/min,UVdetectionat254nm)를 사용하여 5,7-디히드록시-6-게라닐 플라바논을 분리(3 mg)하였다. 상기 5,7-디히드록시-6-게라닐 플라바논의 구조는 NMR 및 MS를 사용하여 규명하였다.
The methanol extract of the weasel fly seed prepared in [Example 3-1] was suspended in 500 ml of water, and then fractionated three times with 500 ml of ethyl acetate. The fractions were concentrated under reduced pressure to prepare 15 g of an ethyl acetate fraction. This fraction was subjected to silica gel chromatography using n-hexane-ethylacetate gradient system (10: 1-100% methanol) and divided into 14 small fractions (E1-E14). The fourth fraction was subdivided back into three subfractions by silica gel chromatography with a chloroform-methanol (100: 1) solvent system, and preparative HPLC (
ESI-MS m/z 391 [M-H]+;ESI-MS m / z 391 [M−H] + ;
1H NMR (500 MHz, CD3CN) δ 12.40 (1H, s), 7.46-7.40 (5H, m), 6.34 (1H, s), 6.02 (1H, s), 5.40 (1H, dd, J = 3.0, 13.0 Hz), 5.26 (1H, dt, J = 1.0, 7.0 Hz), 5.05 (1H, t, J = 7.0 Hz), 3.37 (2H, d, J = 7.0 Hz), 3.08 (1H, dd, J = 13.0, 17.0 Hz), 2.82 (1H, dd, J = 3.0, 17.0 Hz), 2.12-2.05 (4H, m), 1.81 (3H, s), 1.67 (3H, s), 1.59 (3H, s). 1 H NMR (500 MHz, CD 3 CN) δ 12.40 (1H, s), 7.46-7.40 (5H, m), 6.34 (1H, s), 6.02 (1H, s), 5.40 (1H, dd, J = 3.0, 13.0 Hz), 5.26 (1H, dt, J = 1.0, 7.0 Hz), 5.05 (1H, t, J = 7.0 Hz), 3.37 (2H, d, J = 7.0 Hz), 3.08 (1H, dd, J = 13.0, 17.0 Hz), 2.82 (1H, dd, J = 3.0, 17.0 Hz), 2.12-2.05 (4H, m), 1.81 (3H, s), 1.67 (3H, s), 1.59 (3H, s ).
[[ 실험예Experimental Example 1] One] PTP1BPTP1B ( ( ProteinProtein TyrosineTyrosine PhosphatasePhosphatase 1B) 활성억제 실험 1B) Activity Inhibition Experiment
PTP1B 효소 활성은 기질인 p-NPP (para-nitrophenyl phosphate)을 사용하여 측정하였다. 50 mM citrate buffer (pH 6.0), 0.1 M NaCl, 1 mM EDTA 및 1 mM DTT이 포함되어진 완충용액에 20 mM p-NPP, PTP1B (0.05 μg) 및 상기 실시예 각각의 추출물과 분획물 및 분리된 화합물을 넣고 37℃에서 30분간 반응시킨 후, 10 N NaOH 10 μl를 첨가하여 반응을 종결하였다. p-나이트로페놀 (p-nitrophenol)은 405 nm에서 흡광도를 측정하였다. 효소 저해율(%)은 완충용액에 효소와 기질만 넣고 반응시켜 측정한 값을 100% 로 하고 효소만 넣어 측정한 값을 0%로 하여 계산한 후 이에 대한 비율로 나타내었다. 각 추출물, 분획 또는 화합물에 대하여 각각 50% 저해농도 (IC50)를 구하여 아래 표 1에 나타내었다. PTP1B enzyme activity was measured using p-NPP (para-nitrophenyl phosphate) as a substrate. 20 mM p-NPP, PTP1B (0.05 μg) and extracts, fractions, and isolated compounds in a buffer containing 50 mM citrate buffer (pH 6.0), 0.1 M NaCl, 1 mM EDTA, and 1 mM DTT After the reaction was carried out for 30 minutes at 37 ℃, 10 μl of 10 N NaOH was added to terminate the reaction. p-nitrophenol was measured for absorbance at 405 nm. Enzyme inhibition rate (%) was calculated by adding only the enzyme and the substrate to the buffer and reacting the measured value to 100%, and calculating the value measured only by adding the enzyme as 0%. 50% inhibition concentration (IC 50 ) for each extract, fraction or compound was obtained in Table 1 below.
그 결과 (표 1), 족제비싸리 추출물 및 그의 분획물은 뛰어난 PTP1B 저해 효능을 가지는 것으로 확인되었다. 뿐만 아니라, 상기 족제비싸리 추출물에서 분리한 아몰파스틸볼 및 5,7-디하이드록시게라닐플라바논 화합물 역시 우수한 PTP1B 저해 효능을 가지는 것으로 관찰되었다.
As a result (Table 1), weasel extract and fractions thereof were found to have excellent PTP1B inhibitory efficacy. In addition, it was observed that amorphastilball and 5,7-dihydroxygeranyl flavanone compounds isolated from the weasel extract also have excellent PTP1B inhibitory effect.
[[ 실험예Experimental Example 2] 2] 근육세포에서In muscle cells 인슐린 신호전달 및 Insulin signaling and PTP1BPTP1B 발현에 미치는 영향 Effect on expression
족제비싸리추출물 및 이로부터 분리한 화합물들이 실제로 인슐린 감수성을 증가시키는지를 확인하기 위하여 근육세포인 심장세포 C2C12를 사용하여 인슐린 신호전달에 미치는 영향 및 PTP1B 발현에 미치는 영향을 웨스턴블랏을 사용하여 측정하였다. In order to confirm that weasel extract and the compounds isolated therefrom actually increase insulin sensitivity, the effect on cardiac cell C2C12 and insulin signaling and the expression of PTP1B were measured using Western blot.
C2C12 (ATCC사 (American Type Cultuur Collection) (Manassas, VA, USA)). 심장세포를 10% 우태아혈청(FBS)과 1% 항생제(penicillin/streptomycin)가 함유된 DMEM (Dulbecco’s modified Eagle’s medium)배지에서 배양하였다. 이후 세포를 2% 말혈청이 함유된 DMEM배지로 갈아주어 4일동안 분화시켰다. 정상조건을 주기위해 2% BSA (Bovine Serum Albumin)와 10% FBS가 함유된 DMEM에서 16시간동안 배양하였으며, 인슐린 내성 조건을 주기 위해 정상조건과 동일한 배지 조건에 팔미틴산 0.75mM을 더한 조건으로 16시간 동안 배양하였다. 이후 인슐린 100 nM을 10분 처리한 후 세포를 수확하여 웨스턴 블랏을 수행하였다. 항체는 Akt, phosphor-Ser473 Akt, IRβ, phosphor-Tyr1135/1136 IGF-1 Rβ /Tyr1150/1151 IRβ, phosphor-Ser9 Gsk3β, Gsk3β, GAPDH (Cell Signaling, Beverly, MA, USA)를 사용하였다. C2C12 (ATCC (American Type Cultuur Collection) (Manassas, VA, USA)). Cardiac cells were cultured in DMEM (Dulbecco's modified Eagle's medium) medium containing 10% fetal bovine serum (FBS) and 1% antibiotic (penicillin / streptomycin). Cells were then transferred to DMEM medium containing 2% horse serum and differentiated for 4 days. Incubated for 16 hours in DMEM containing 2% BSA (Bovine Serum Albumin) and 10% FBS to give normal conditions. Incubated for Thereafter, 100 nM of insulin was treated for 10 minutes, and then cells were harvested to perform western blot. Antibodies were Akt, phosphor-Ser473 Akt, IRβ, phosphor-Tyr1135 / 1136 IGF-1 Rβ / Tyr1150 / 1151 IRβ, phosphor-Ser9 Gsk3β, Gsk3β, GAPDH (Cell Signaling, Beverly, MA, USA).
그 결과 (도 1), 족제비싸리추출물 및 이로부터 분리된 화합물들은 정상 및 인슐린 내성조건에서 인슐린 신호전달 증가의 마커가 되는 Akt 473번 serine 잔기의 인산화를 증가시켰으며 GSK3β의 9번 serine 잔기의 인산화 또한 증가시켰다. 그러므로 인슐린 내성 조건에서 족제비싸리추출물 및 이로부터 분리된 화합물은 PTP1B의 활성과 발현 모두를 저해시킴에 따라 인슐린에 대한 감수성을 증가시켜 혈당을 강하시키는 효능을 가짐을 확인하였다.
As a result (FIG. 1), weasel extract and compounds isolated therefrom increased the phosphorylation of
[[ 실험예Experimental Example 3] 포도당 3] glucose uptakeuptake 에 대한 효능Efficacy on
족제비싸리추출물 및 이로부터 분리한 화합물들이 실제로 인슐린 감수성을 증가시켜 세포내로 당이동을 증가시키는지 확인하기 위하여 근육세포인 심장세포 C2C12를 사용하여 직접 포도당 uptake 양을 측정하였다. To determine whether weasel extract and compounds isolated therefrom actually increase insulin sensitivity and increase glucose transport into cells, glucose uptake was directly measured using cardiac C2C12, a muscle cell.
C2C12 (ATCC, CRL-1772) 심장세포를 10% 우태아혈청(FBS)과 1% 항생제(penicillin/streptomycin)가 함유된 DMEM (Dulbecco’s modified Eagle’s medium)배지에서 배양하였다. 96웰 검은 플레이트에 심은 후 2% 말혈청이 함유된 DMEM배지로 갈아주어 4일동안 분화시켰다. 정상조건을 주기위해 2% BSA (Bovine Serum Albumin)와 10% FBS가 함유된 DMEM에서 16시간 동안 배양하였으며, 인슐린 내성조건을 주기 위해 정상조건과 동일한 배지 조건에 팔미틴산 0.75mM을 더한 조건으로 16시간 동안 배양하였다. 이후 인슐린 100 nM을 1 시간 처리하였으며, 마지막 15분 동안 형광을 띤 포도당 유도체인 2-NBDG (Invitrogen, Carlsbad, CA) 50uM을 처리한 후 세포내로 이동된 형광의 정도를 Infinite M1000 microplate reader (TECKAN)를 사용하여 excitation 485nm, emission at 535nm에서 측정하여 포도당 uptake를 측정하였다. C2C12 (ATCC, CRL-1772) heart cells were cultured in DMEM (Dulbecco's modified Eagle's medium) medium containing 10% fetal bovine serum (FBS) and 1% antibiotic (penicillin / streptomycin). The cells were planted in 96-well black plates and transferred to DMEM medium containing 2% horse serum to differentiate for 4 days. Incubated for 16 hours in DMEM containing 2% BSA (Bovine Serum Albumin) and 10% FBS to give normal conditions, and 16 hours with palmitic acid 0.75 mM added to the same medium conditions to give insulin resistance. Incubated for 2 hours. Afterwards, 100 nM of insulin was treated for 1 hour, and 50 μM of 2-NBDG (Invitrogen, Carlsbad, Calif.), A fluorescent glucose derivative, was treated in the last 15 minutes. Glucose uptake was measured using excitation at 485 nm and emission at 535 nm.
그 결과 (도 2), 정상조건과 인술린 내성 조건 모두에서 족제비싸리 추출물 및 이로부터 분리된 화합물들은 근육세포내 포도당 uptake에 대해 매우 우수한 활성을 보임을 확인하였다.
As a result (FIG. 2), it was confirmed that weasel extract and the compounds isolated therefrom showed very good activity against glucose uptake in muscle cells under both normal and insulin resistance conditions.
[[ 실험예Experimental Example 4] 대사질환 조절효과 4] metabolic disease
[[ 실험예Experimental Example 4-1] 몸무게, 먹이 섭취량 및 4-1] weight, food intake and 식이효율의Dietary efficiency 측정 Measure
웅성 7주령 C57BL/6 마우스 (Shizuoka Laboratory Animal Center, Japan) 를 구입하여 실험실에서 1주간 적응시킨 후 실험에 사용하였다. 정상 식이군을 대조군으로 하고 고지방식이군 및 고지방식이에 더하여 각 족제비싸리추출물 (200 mg/Kg) 및 5개의 분획 (각 40 mg/Kg)을 주5회 8주간 투여하였다. 족제비싸리추출물 (200 mg/Kg) 및 5개의 분획 (각 40 mg/Kg)을 8주간 투여하면서 매일 몸무게, 먹이, 음료섭취량을 측정하였다. 식이효율은 8주간의 몸무게 증가를 8주간의 음식섭취량으로 나눈 것으로서, 다음 식으로 계산하였다. Male 7-week-old C57BL / 6 mice (Shizuoka Laboratory Animal Center, Japan) were purchased and adapted for 1 week in the laboratory and used for the experiment. The normal diet group was the control group, and in addition to the high-fat diet and the high-fat diet, each weasel extract (200 mg / Kg) and five fractions (40 mg / Kg each) were administered five times a week for 8 weeks. Weasel extract (200 mg / Kg) and five fractions (40 mg / Kg each) were administered for 8 weeks, and the weight, food and drink intake were measured daily. Dietary efficiency was calculated by dividing the weight gain by 8 weeks by the food intake by 8 weeks.
feed efficiency = [weight gain (g/8wk) / food intake (g/8wk)]feed efficiency = [weight gain (g / 8wk) / food intake (g / 8wk)]
그 결과 (표 2), 족제비싸리 추출물 및 분획물은 몸무게 증가를 저해하는 것을 확인하였다. 특히, 족제비싸리 추출물은 고지방식이 대조군보다 몸무게 증가를 43%나 저해하는 것으로 관찰되었다.
As a result (Table 2), weasel extract and fractions were confirmed to inhibit the increase in weight. In particular, weasel extract was observed that high fat diet inhibited the weight gain by 43% than the control group.
[[ 실험예Experimental Example 4-2] 공복혈당, 총콜레스테롤, 4-2] fasting blood sugar, total cholesterol, LDLLDL 콜레스테롤 측정 Cholesterol measurement
웅성 7주령 C57BL/6 마우스 (Shizuoka Laboratory Animal Center, Japan)를 구입하여 실험실에서 1주간 적응시킨 후 실험에 사용하였다. 정상 식이군을 대조군으로 하고 고지방식이군 및 고지방식이에 더하여 각 족제비싸리추출물 (200 mg/Kg) 및 5개의 분획 (각 40 mg/Kg)을 주5회 8주간 투여하였다. Male 7-week-old C57BL / 6 mice (Shizuoka Laboratory Animal Center, Japan) were purchased and used in the laboratory after being adapted for 1 week. The normal diet group was the control group, and in addition to the high-fat diet and the high-fat diet, each weasel extract (200 mg / Kg) and five fractions (40 mg / Kg each) were administered five times a week for 8 weeks.
상기 투여가 끝나고 12시간 절식 후 각각의 실험군의 공복혈당을 측정하였다. 혈당은 마우스의 꼬리 정맥으로부터 혈액을 채취하여 Accu-Chek(Roche, 독일)으로 측정하였다 (도 3). Fasting blood glucose of each experimental group was measured after 12 hours of fasting after the administration. Blood glucose was measured by Accu-Chek (Roche, Germany) by collecting blood from the tail vein of the mouse (Fig. 3).
이어서, 마우스를 절개하여 혈액을 채취하고 간 무게를 측정하였다. 간무게는 저울에서 직접 적출한 장기무게를 측정하여 마우스의 몸무게로 나누어 비교하였다. 그 결과 (도 4), 본 추출물 및 분획을 투여한 실험군에서는 고지방식이에서 발견되는 간비대 (약 40% 정도 간무게 증가 및 지방간 소견 보임) 현상이 나타나지 않아서 간독성이 나타나지 않는 것으로 확인되었다. Subsequently, mice were dissected to collect blood and weigh the liver. Liver weight was measured by measuring the organ weight directly extracted from the balance divided by the weight of the mouse. As a result (Fig. 4), the experimental group administered the present extract and fraction did not show hepatomegaly (approximately 40% increase in liver weight and fatty liver finding) found in the high fat diet, and did not show hepatotoxicity.
혈액 중의 총콜레스테롤은 SICDIA L T-CHO reagents (Eiken Chemical, Tokyo, Japan)를 사용한 효소적 방법으로 측정하였고, LDL-콜레스테롤은 L-Type LDL-C (Wako Pure Chemical, Osaka, Japan)를 사용한 효소적 방법으로 측정하였다 (도 3).Total cholesterol in blood was measured by enzymatic method using SICDIA L T-CHO reagents (Eiken Chemical, Tokyo, Japan), and LDL-cholesterol was enzyme using L-Type LDL-C (Wako Pure Chemical, Osaka, Japan) It was measured by the enemy method (Fig. 3).
그 결과 (도 3), 본 추출물 및 분획을 투여한 실험군은 공복혈당 및 총콜레스테롤, LDL-콜레스테롤을 저하시키는 것을 확인하였다. 이에 따라, 본 발명의 조성물은 혈당을 저하시키고, 혈액중의 지질을 개선할 수 있음을 확인하였다.
As a result (Fig. 3), the experimental group administered the present extract and fraction Fasting blood glucose, total cholesterol, and LDL-cholesterol were found to be lowered. Accordingly, it was confirmed that the composition of the present invention can lower blood sugar and improve lipids in blood.
[[ 실험예Experimental Example 5] 5] PPARPPAR α활성화 시험α activation test
플라스미드(Plasmid)는 일반적인 배양 조건에서도 발현되는 유니버셜 프로모터(universal promoter) 뒤에 PPARα 유전자를 지닌 것, 리간드 결합형의 PPARα가 결합하여 활성화되는 PPRE(PPARs Response Element)를 프로모터로 가지고 뒤에 리포터로서 역할을 하는 반디불 루시퍼라아제(firefly luciferase) 유전자를 지닌 것 그리고 레퍼런스(reference)로 사용될 유니버셜 프로모터에 레닐라 루시퍼라아제(Renilla luciferase) 유전자가 결합된 플라스미드(pRL-SV40, Promega, USA)가 사용되었다(KLIEWER SA., Proc . Nadl . Acad . Sci . USA, 91: 7355-7359, 1994).Plasmids have a PPARα gene after a universal promoter, which is expressed even in normal culture conditions, and a PPRE (PPARs Response Element) that is activated by the binding of a ligand-binding PPARα as a promoter. A plasmid (pRL-SV40, Promega, USA) with a firefly luciferase gene and a Renilla luciferase gene bound to a universal promoter to be used as a reference was used (KLIEWER). SA., Proc . Nadl . Acad . Sci . USA, 91: 7355-7359, 1994).
CV-1 세포를 5x104의 농도로 24-웰(well)형 플레이트에 깐 후 24시간 배양 후 상기 세 종류의 플라즈미드 유전자를 일시적 주입(transient transfection) 하였다. 이후 24시간 배양 후 1 x 인산완충식염수(Phosphate Buffered Saline, PBS)로 세척한 후, 본 발명의 물질들을 농도별로 처리 24시간 배양 후 1xPBS로 세척 후 1xPLB로 세포를 깬 후 듀얼-루시퍼라아제 수용체 분석 시스템 키트(Dual-Luciferase Reporter Assay System kit, Promega, USA)를 사용하여 사용자 지시서에 따라 샘플과 레퍼런스(reference)의 루시퍼라아제 활성(luciferase activity)을 측정하였다. 본 실험에서 양성대조군은 PPARα의 리간드 중 가장 강력한 것으로 알려진 Wy-14,643(Sigma, USA)을 사용하였고 음성대조군은 무처리군으로 하였다.CV-1 cells were placed on 24-well plates at a concentration of 5 × 10 4 , and then cultured for 24 hours, followed by transient transfection of the three kinds of plasmid genes. After 24 hours of incubation, 1 x phosphate buffered saline (Phosphate Buffered Saline, PBS), washed with the material of the present invention for 24 hours after incubation with 1xPBS after washing for 24 hours after breaking the cells with 1xPLB dual-luciferase receptor Assay System Kit (Dual-Luciferase Luciferase activity of samples and references was measured using a Reporter Assay System kit (Promega, USA). In this experiment, the positive control group used Wy-14,643 (Sigma, USA), which is known to be the strongest of PPARα ligands, and the negative control group was untreated.
그 결과 (표 3 및 도 5)에 나타나는 바와 같이 족제비싸리 추출물, 이의 분획물, 또는 상기 분획물에서 분리한 화합물인 아몰파스틸볼 또는 5,7-디하이드록시-6-게라닐플라바논은 상기 물질들을 처리하지 않은 대조군에 비해 처리하였을 때 PPARα의 활성화 정도가 더욱 높은 수치를 나타내었으며, 처리량이 높을수록 수치가 더 높아졌음을 확인하였다.
As a result (Table 3 and FIG. 5), weasel extract, fractions thereof, or the compound isolated from the fractions, amorphastilbol or 5,7-dihydroxy-6-geranylflavanone, are substances When compared to the control group did not have a treatment, the activation degree of PPARα showed a higher value, the higher the throughput was confirmed that the higher the value.
[[ 실험예Experimental Example 6] 6] PPARPPAR α 및 지방산 산화에 관련된 유전자들의 발현Expression of genes involved in α and fatty acid oxidation
사람의 간암세포주인 HepG2 세포(HB-8065, ATCC, USA)를 60 파이 디쉬(dish)에 1 X 106개의 농도로 깔고, 24시간 후 최종농도가 10 uM이 되게 양성대조군인 Wy-14,643, 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 각각 처리하였다. 24시간 후에 트리졸(trizol)을 이용하여 전체 RNA를 추출하고, RT-PCR을 통해 지방산 산화 관련 유전자들의 발현 정도를 확인하였다. 상기 RT-PCR에서 역전사(reverse transcription)는 시중에 판매되는 키트(reverse transcription system, Promega)를 사용하여 수행하였으며, PCR은 변성(denaturation)은 94℃, 1분, 풀림(annealing)은 54℃, 1분, 연장(extension)은 72℃, 1분씩 총 30사이클(cycle)로 수행하였다. PCR에 사용된 프라이머(primer)들은 아래와 같다.
HepG2 cells (HB-8065, ATCC, USA), a human hepatocellular carcinoma cell line, were placed in 60 pie dishes at a concentration of 1
PPARα PPARα
포워드(forward) 5' acggaaagcccactctgccccctctc 3'(서열번호 1) Forward 5 'acggaaagcccactctgccccctctc 3' (SEQ ID NO: 1)
리버스(reverse) 5' cttgtccccgcagattctacattcg 3'(서열번호 2) Reverse 5 'cttgtccccgcagattctacattcg 3' (SEQ ID NO: 2)
CPT1α CPT1α
포워드(forward) 5' agacggtggaacagaggctgaag 3'(서열번호 3) Forward 5 'agacggtggaacagaggctgaag 3' (SEQ ID NO: 3)
리버스(reverse) 5' tgagaccaaacaaagtgatgatgtcag 3'(서열번호 4) Reverse 5 'tgagaccaaacaaagtgatgatgtcag 3' (SEQ ID NO: 4)
ACO2 ACO2
포워드(forward) 5' gcggacatggctactcaaagc 3'(서열번호 5) Forward 5 'gcggacatggctactcaaagc 3' (SEQ ID NO: 5)
리버스(reverse) 5' gcagtgcaccttagcagcctg 3'(서열번호 6) Reverse 5 'gcagtgcaccttagcagcctg 3' (SEQ ID NO: 6)
GAPDH GAPDH
포워드(forward) 5' accacagtccatgccatcac 3'(서열번호 7) Forward 5 'accacagtccatgccatcac 3' (SEQ ID NO: 7)
리버스(reverse) 5' tccaccaccctgttgctgta 3'(서열번호 8)
Reverse 5 'tccaccaccctgttgctgta 3' (SEQ ID NO: 8)
그 결과 도 6에서 나타나는 바와 같이 PPARα 및 이와 관련된 유전자인 CPT1α(Carnitine Palmitoyl Transferase I alpha), ACO2(Acyl-CoA Oxidase 2)는 아몰파스틸볼과 5,7-디하이드록시-6-게라닐플라바논을 처리한 각 군은 양성대조군으로 사용한 Wy-14643을 처리한 군만큼 증가함을 확인함으로써, 지방산 산화에 관여함을 알 수 있었다.
As a result, as shown in Figure 6 PPARα and its related genes CPT1α (Carnitine Palmitoyl Transferase I alpha), ACO2 (Acyl-CoA Oxidase 2) is amorphastyl ball and 5,7-dihydroxy-6-geranyl fla Each group treated with banone increased as much as the group treated with Wy-14643 used as a positive control group, indicating that it was involved in fatty acid oxidation.
[[ 실험예Experimental Example 7] 족제비싸리 추출물, 이의 7] Weasel extract, its 분획물Fraction 및 상기 And 분획물에서In the fraction 분리한 화합물의 독성실험 Toxicity Test of Isolated Compound
족제비싸리 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물의 급성 독성을 알아보기 위하여, 하기와 같은 실험을 수행하였다. In order to determine the acute toxicity of weasel extract, fractions thereof and compounds isolated from the fractions, the following experiments were carried out.
6주령의 특정병원부재(SPF) SD계 랫트 (중앙실험동물, 한국)를 사용하여 급성 독성실험을 실시하였다. 족제비싸리의 추출물, 이의 분획물 및 상기 분획물에서 분리한 화합물을 각각 0.5% 메틸셀룰로오스 용액에 현탁하여 5 g/kg/15 ㎖의 용량으로 단회 경구 투여하였다. 실험물질 투여 후 동물의 폐사 여부, 임상 증상, 체중 변화를 관찰하여 혈액학적 검사와 혈액 생화학적 검사를 실시하였으며, 부검하여 육안으로 복강장기와 흉강장기의 이상 여부를 관찰하였다.Acute toxicity test was performed using 6-week-old SPF SD rats (Central Laboratory Animal, Korea). The extract of weasel, its fractions and the compounds isolated from the fractions were each suspended orally administered in a 0.5% methylcellulose solution at a dose of 5 g / kg / 15 ml. Hematology and blood biochemical tests were performed by observing the mortality, clinical symptoms, and weight changes of the animals after the administration of the test substance.
실험 결과, 실험물질을 투여한 모든 동물에서 특기할 만한 임상증상이나 폐사된 동물은 없었으며, 체중변화, 혈액검사, 혈액생화학검사, 부검소견 등에서도 독성 변화는 관찰되지 않았다.As a result, no significant clinical symptoms or dead animals were noted in all animals treated with the test substance, and no toxic changes were observed in body weight changes, blood tests, blood biochemical tests, and autopsy findings.
그 결과, 랫트에서 5 g/kg까지 독성 변화를 나타내지 않으며, 경구 투여 최소 치사량 (LD50)은 5 g/kg 이상인 안전한 물질로 판명되었다.
As a result, the rats showed no toxicity change up to 5 g / kg, and the minimum lethal dose (LD 50 ) for oral administration was found to be a safe substance of 5 g / kg or more.
아래 상기 조성물의 제형예를 설명하나, 이는 본 발명을 한정하는 것이 아니라 단지 구체적으로 설명하고자 함이다.Examples of the formulation of the composition will be described below, but are not intended to limit the present invention but merely to be described in detail.
[제형예 1] 연질 캡슐Formulation Example 1 Soft Capsule
족제비싸리 추출물 80mg, 비타민 E 9mg, 비타민 C 9mg, 팜유 2mg, 식물성 경화유 8mg, 황납 4mg 및 레시틴 9mg을 혼합하고, 통상의 방법에 따라 혼합하여 연질 캡슐 충진액을 제조한다. 1 캡슐당 400㎎씩 충진하여 연질 캡슐을 제조한다. 그리고, 상기와 별도로 젤라틴 66 중량부, 글리세린 24 중량부 및 솔비톨액 10 중량부의 비율로 연질 캡슐 시트를 제조하고 상기 충진액을 충진시켜 본 발명에 따른 조성물 400mg이 함유된 연질 캡슐을 제조한다.80 mg, weasel extract, vitamin E 9 mg, vitamin C 9 mg, palm oil 2 mg, vegetable hardened oil 8 mg, lead 4 mg and lecithin 9 mg are mixed and mixed according to a conventional method to prepare a soft capsule fill solution. 400 mg per capsule is filled to prepare a soft capsule. In addition, a soft capsule sheet is prepared at a ratio of 66 parts by weight of gelatin, 24 parts by weight of glycerine, and 10 parts by weight of sorbitol solution and filled with the filler to prepare a soft capsule containing 400 mg of the composition according to the present invention.
[제형예 2] 정제 [Formulation Example 2] Tablets
족제비싸리 추출물 80mg, 비타민 E 9mg, 비타민 C 9mg, 갈락토올리고당 200㎎, 유당 60㎎ 및 맥아당 140㎎을 혼합하고 유동층 건조기를 이용하여 과립한 후 당 에스테르(sugar ester) 6㎎을 첨가한다. 이들 조성물 500mg을 통상의 방법으로 타정하여 정제를 제조한다.80 mg of weasel extract, 9 mg of vitamin E, 9 mg of vitamin C, 200 mg of galactooligosaccharide, 60 mg of lactose and 140 mg of maltose are mixed and granulated using a fluidized bed dryer, and then 6 mg of sugar ester is added. Tablets are prepared by tableting 500 mg of these compositions in a conventional manner.
[제형예 3] 드링크제 [Formulation Example 3] Drinks
족제비싸리 추출물 80mg, 비타민 E 9mg, 비타민 C 9mg, 포도당 10g, 구연산 0.6g, 및 액상 올리고당 25g을 혼합한 후, 정제수 300㎖를 가하여 각 병에 200㎖씩 되도록 충진한다. 병에 충진한 후 130℃에서 4～5초간 살균하여 드링크제를 제조한다.80 mg of weasel extract, 9 mg of vitamin E, 9 mg of vitamin C, 10 g of glucose, 0.6 g of citric acid, and 25 g of liquid oligosaccharides are mixed, and 300 ml of purified water is added to each bottle to make 200 ml. After filling the bottle sterilized for 4-5 seconds at 130 ℃ to prepare a drink.
[제형예 4] 과립제[Formulation Example 4]
족제비싸리 추출물 80mg, 비타민 E 9mg, 비타민 C 9mg, 무수결정 포도당 250㎎ 및 전분 550㎎을 혼합하고, 유동층 과립기를 사용하여 과립으로 성형한 후 포에 충진하여 과립제를 제조한다.80 mg of weasel extract, 9 mg of vitamin E, 9 mg of vitamin C, 250 mg of anhydrous glucose, and 550 mg of starch were mixed, molded into granules using a fluidized bed granulator, and filled into sachets to prepare granules.
[제형예 5] 주사제 Formulation Example 5 Injection
족제비싸리 추출물..................................20 mg Weasel extract ...... 20 mg
주사용 멸균 증류수...........................적량 Sterile Distilled Water for Injection ...
pH 조절제....................................적량 pH adjuster ...
통상의 주사제의 제조 방법에 따라 1 앰플당(2㎖) 상기의 함량으로 주사제를 제조한다. Injections are prepared in the above amounts per ampoule (2 ml) according to the conventional method for preparing injections.
본 발명이 속한 분야에서 통상의 지식을 가진 자라면 상기 내용을 바탕으로 본 발명의 범주 내에서 다양한 응용 및 변형을 행하는 것이 가능할 것이다.Those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims.
[제제예 6] 건강 음료의 제조 Preparation Example 6 Preparation of Healthy Drinks
족제비싸리 추출물................................... 1000 ㎎ Weasel extract .................................... 1000 mg
구연산..................................................... 1000 ㎎ Citric acid ................................................. ... 1000 mg
올리고당..................................................... 100 g oligosaccharide................................................. .... 100 g
매실농축액..................................................... 2 g Plum concentrate ................................................ ..... 2 g
타우린............................................................ 1 g Taurine ................................................. ........... 1 g
정제수를 가하여 전체......................... 900 ㎖Purified water was added to the mixture to complete 900 ml
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2ℓ용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강음료 조성물 제조에 사용한다.The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated at 85 DEG C for about 1 hour with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, ≪ / RTI >
상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만 수요계층이나, 수요국가, 사용 용도 등 지역적, 민족적 기호도에 따라서 그 배합비율을 임의로 변형 실시하여도 무방하다. 본 발명이 속한 기술 분야에서 통상의 지식을 가진 자라면 상기 내용을 바탕으로 본 발명의 범주 내에서 다양한 응용 및 변형을 행하는 것이 가능할 것이다.Although the composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and use purpose. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시태양일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.
<110> Korea Institute of Science and Technology
<120> COMPOSITION CONTAINING EXTRACT OF AMORPHA FRUTICOSA
<130> 12P0511IND
<160> 8
<170> KopatentIn 1.71
<210> 1
<211> 26
<212> DNA
<213> PPAR alpha forward primer
<400> 1
acggaaagcc cactctgccc cctctc 26
<210> 2
<211> 25
<212> DNA
<213> PPAR alpha reverse primer
<400> 2
cttgtccccg cagattctac attcg 25
<210> 3
<211> 23
<212> DNA
<213> CPT1 alpha forward primer
<400> 3
agacggtgga acagaggctg aag 23
<210> 4
<211> 27
<212> DNA
<213> CPT1 alpha reverse primer
<400> 4
tgagaccaaa caaagtgatg atgtcag 27
<210> 5
<211> 21
<212> DNA
<213> ACO2 forward primer
<400> 5
gcggacatgg ctactcaaag c 21
<210> 6
<211> 21
<212> DNA
<213> ACO2 reverse primer
<400> 6
gcagtgcacc ttagcagcct g 21
<210> 7
<211> 20
<212> DNA
<213> GAPDH forward primer
<400> 7
accacagtcc atgccatcac 20
<210> 8
<211> 20
<212> DNA
<213> GAPDH reverse primer
<400> 8
tccaccaccc tgttgctgta 20
<110> Korea Institute of Science and Technology
<120> COMPOSITION CONTAINING EXTRACT OF AMORPHA FRUTICOSA
<130> 12P0511IND
<160> 8
<170> Kopatentin 1.71
<210> 1
<211> 26
<212> DNA
<213> PPAR alpha forward primer
<400> 1
acggaaagcc cactctgccc cctctc 26
<210> 2
<211> 25
<212> DNA
<213> PPAR alpha reverse primer
<400> 2
cttgtccccg cagattctac attcg 25
<210> 3
<211> 23
<212> DNA
<213> CPT1 alpha forward primer
<400> 3
agacggtgga acagaggctg aag 23
<210> 4
<211> 27
<212> DNA
<213> CPT1 alpha reverse primer
<400> 4
tgagaccaaa caaagtgatg atgtcag 27
<210> 5
<211> 21
<212> DNA
<213> ACO2 forward primer
<400> 5
gcggacatgg ctactcaaag c 21
<210> 6
<211> 21
<212> DNA
<213> ACO2 reverse primer
<400> 6
gcagtgcacc ttagcagcct g 21
<210> 7
<211> 20
<212> DNA
<213> GAPDH forward primer
<400> 7
accacagtcc atgccatcac 20
<210> 8
<211> 20
<212> DNA
<213> GAPDH reverse primer
<400> 8
Claims (19)
상기 족제비싸리 추출물 또는 그의 분획물은 화학식 1 및 화학식 2로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하며,
[화학식 1]
[화학식 2]
상기 화학식들에서,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 또는 R32은 독립적으로 수소, C1 내지 C18의 알킬기, C1 내지 C18의 알콕시기, C1 내지 C18의 알케닐기 또는 C1 내지 C18의 알키닐기인, PTP1B 저해용 조성물.The method of claim 1,
The weasel extract or fractions thereof includes one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof in the group consisting of Formula 1 and Formula 2,
[Chemical Formula 1]
(2)
In the above formulas,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 or R32 are independently hydrogen, an alkyl group of C 1 to C 18 , C 1 To C 18 alkoxy group, C 1 To alkenyl group of C 18 or C 1 To C 18 alkynyl group, PTP1B inhibition composition.
상기 족제비싸리 추출물 또는 그의 분획물은 아몰파스틸볼 (Amorphastilbol) 및 5,7-디히드록시-6-게라닐 플라바논 (5,7-dihydroxy-6-geranyl-flavanone)으로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하는, PTP1B 저해용 조성물.The method of claim 1,
The weasel extract or fractions thereof is at least one compound in the group consisting of Amorphastilbol and 5,7-dihydroxy-6-geranyl flavanone (5,7-dihydroxy-6-geranyl-flavanone) , Derivatives thereof or pharmaceutically acceptable salts thereof, comprising a composition for inhibiting PTP1B.
상기 족제비싸리 추출물 또는 그의 분획물은 화학식 1 및 화학식 2로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하며,
[화학식 1]
[화학식 2]
상기 화학식들에서,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 또는 R32은 독립적으로 수소, C1 내지 C18의 알킬기, C1 내지 C18의 알콕시기, C1 내지 C18의 알케닐기 또는 C1 내지 C18의 알키닐기인, PPARα 활성화용 조성물.10. The method of claim 9,
The weasel extract or fractions thereof includes one or more compounds, derivatives thereof or pharmaceutically acceptable salts thereof in the group consisting of Formula 1 and Formula 2,
[Chemical Formula 1]
(2)
In the above formulas,
R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, R22, R23, R24, R25, R26, R27, R28, R29, R30, R31 or R32 are independently hydrogen, an alkyl group of C 1 to C 18 , C 1 To C 18 alkoxy group, C 1 To alkenyl group of C 18 or C 1 To C 18 alkynyl group, PPARα activation composition.
상기 족제비싸리 추출물 또는 그의 분획물은 아몰파스틸볼 및 5,7-디히드록시-6-게라닐 플라바논 (5,7-dihydroxy-6-geranyl-flavanone)으로 구성된 군에서 하나 이상의 화합물, 그의 유도체 또는 약학적으로 허용가능한 그의 염을 포함하는, PPARα 활성화용 조성물.10. The method of claim 9,
Said weasel extract or fractions thereof is at least one compound, derivative thereof, in the group consisting of amorphastylball and 5,7-dihydroxy-6-geranyl flavanone (5,7-dihydroxy-6-geranyl-flavanone) Or a pharmaceutically acceptable salt thereof, the composition for activating PPARα.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020120097228A KR20140030721A (en) | 2012-09-03 | 2012-09-03 | Composition containing extract of amorpha fruticosa |
| PCT/KR2013/007890 WO2014035214A1 (en) | 2012-09-03 | 2013-09-02 | Composition comprising amorpha fruticosa extracts |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020120097228A KR20140030721A (en) | 2012-09-03 | 2012-09-03 | Composition containing extract of amorpha fruticosa |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20140030721A true KR20140030721A (en) | 2014-03-12 |
Family
ID=50183936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020120097228A KR20140030721A (en) | 2012-09-03 | 2012-09-03 | Composition containing extract of amorpha fruticosa |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20140030721A (en) |
| WO (1) | WO2014035214A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101749123B1 (en) | 2015-08-03 | 2017-06-21 | (주)에코팜 | Natural composition and method for manufacturing the composition avoiding and/or controling the Hemiptera |
| KR101692851B1 (en) * | 2015-10-16 | 2017-01-05 | 경상대학교산학협력단 | Composition for skin whitening comprising amorphigeni as effective component |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100902338B1 (en) * | 2007-07-26 | 2009-06-12 | 한국과학기술연구원 | A composition that is comprising extracts, fractions or isolated single compounds of Robinia pseudo?acacia var. umbraculifera |
-
2012
- 2012-09-03 KR KR1020120097228A patent/KR20140030721A/en not_active Application Discontinuation
-
2013
- 2013-09-02 WO PCT/KR2013/007890 patent/WO2014035214A1/en active Application Filing
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014035214A1 (en) | 2014-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20170132705A (en) | Composition for prevention, improvement or treatment of muscular disorder or improvement of muscular functions | |
| US20110038959A1 (en) | Plant-origin drug for preventing or improving hyperuricemia | |
| KR20160139072A (en) | Pharmaceutical composition comprising Ptentilla Chinensis extract or isolated polyphenolic compounds for prevention or treatment of metabolic disease | |
| US20130102554A1 (en) | Composition for treatment of obesity using wheat bran extract or active ingredient isolated therefrom | |
| KR20170088314A (en) | Composition comprising Chrisanthemum indicum extract or fraction for treating, improving or preventing obesity or obesity-related disease | |
| KR20210066370A (en) | Method of Cultivating Sprout Peanuts for Increasing Anti-Obesity Useful Ingredients | |
| JP6157041B2 (en) | PPARγ activator, anti-obesity agent and anti-diabetic agent | |
| US20070110833A1 (en) | Composition comprising the alcohol compound isolated from the extract of cucurbitaceae family plant having anti-adipogenic and anti-obesity activity | |
| KR101497109B1 (en) | Composition for preventing, improving, or treating a disease controlled by PPAR action | |
| KR20130047458A (en) | Composition for preventing, improving, or treating a disease controlled by ppar action | |
| KR20140030721A (en) | Composition containing extract of amorpha fruticosa | |
| US20080188549A1 (en) | Composition for Preventing and/or Treating Metabolic Syndrome and Insulin Resistance Syndrome | |
| KR20220110445A (en) | Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Artemisia iwayomogi extract, or Euphorbiae Lathyridis Semen extract, or active component separated therefrom as an active ingredient | |
| KR20170008936A (en) | Composition for anti-inflammation comprising eupatorium makinoi extract | |
| KR102020564B1 (en) | Anti-Inflammatory and Anti-Diabetic Composition Comprising Novel Compound, Oscarella stillans Extract Containing the Same, or a Fraction Thereof | |
| JP2017052750A (en) | Novel ellagitannins and agents for oral applications | |
| US20070110834A1 (en) | Composition comprising the alcohol compound isolated from the extract of cucurbitaceae family plant having anti-adipogenic and anti-obesity activity | |
| US7884129B2 (en) | Composition comprising the alcohol compound isolated from the extract of cucurbitaceae family plant having anti-adipogenic and anti-obesity activity | |
| JP7126731B1 (en) | AMPK activator, motor function improver, muscle endurance improver and muscle atrophy inhibitor | |
| KR20140046565A (en) | Composition for preventing or treating renal disease containing extract of amorpha fruticosa | |
| JP7239135B2 (en) | α-Glucosidase activity inhibitor and blood sugar elevation inhibitor | |
| KR102113563B1 (en) | Composition for prevention and treatment of muscle disease, improvement of muscle function or enhancement of exercise performance comprising hydrangenol | |
| KR101059308B1 (en) | Composition for the prevention and treatment of inflammatory or allergic diseases containing starfish extract fraction as an active ingredient | |
| KR101024399B1 (en) | Inhibitor of histone acetyltransferase comprising extract of Rubus coreanus fruit as an active ingradient | |
| KR101818320B1 (en) | composition for improving, treating or preventing alcoholic steatohepatitis comprising extract from Neolentinus lepideus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E601 | Decision to refuse application |