KR20220110445A - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Artemisia iwayomogi extract, or Euphorbiae Lathyridis Semen extract, or active component separated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle diseases or improving muscle functions, comprising an Artemisia iwayomogi extract, a Euphorbiae Lathyridis Semen extract, or an active component separated therefrom as an active ingredient. The Artemisia iwayomogi extract, the Euphorbiae Lathyridis Semen extract, (Z)-5-hydroxyjasmone 5-O-beta-D-glucopyranoside or Euphorbia Factor L1 according to the present invention improves mitochondrial functions, promotes differentiation of myoblasts, alleviates the atrophy of myotube cells, and promotes the formation of myotube cells, thereby preventing or treating muscle diseases or improving muscle functions to be used as a material for medicine and food.

Description

A composition for preventing or treating or improving muscle function, comprising an extract of heat keeper, or Soksuja, or a substance isolated therefrom, as an active ingredient {Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Artemisia iwayomogi extract, or Euphorbiae Lathyridis Semen extract, or active component separated therefrom as an active ingredient}

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising, as an active ingredient, an extract of a heat reliever or Soksuja or a substance isolated therefrom.

Muscle is an important component of the human body and is a tissue expressed in stem cells of the mesoderm. Muscles are responsible for about 40% of our body, are supported by bones and tendons, and are made up of bundles of muscle fibers to move with each other and change the size of cells to cause contraction. Muscles are divided into skeletal muscles, cardiac muscles, and visceral muscles, which generate force at each position and induce movement, and also play a role in protecting body organs such as bones, joints, and internal organs. In addition, the muscle has the ability to regenerate, and when the muscle is damaged, it can be regenerated into a muscle having the original contractility and relaxation ability after being denatured by the satellite cells and the surrounding environment.

Muscle diseases are caused by congenital genetic or environmental causes, and diseases related to muscle loss are increasing with the recent aging society and the flow of life extension. Human muscle decreases by more than 1% every year after the age of 40, and 50% of the maximum muscle mass decreases at the age of 80, so muscle loss in old age is recognized as the most important cause of lowering overall physical function. These muscle diseases are on the increase worldwide compared to the past.

However, since the causes of muscle diseases are more diverse than other diseases, accurate diagnosis is not easy, symptoms and disease intensity vary depending on the type, and the exact mechanism is often unknown in the form of rare diseases. In addition, the symptoms of muscle disease progress rapidly, and as the disease progresses, patients with muscle disease suffer to the extent that it is difficult for them to live their daily lives alone. there is no situation.

On the other hand, "Hotgigi ( Artemisia iwayomogi Kitamura)" is a plant belonging to the Asteraceae family, and has been used since ancient times above-ground parts including stems and leaves, and is known to be particularly effective for jaundice and dysentery. " Euphorbiae Lathyridis Semen" is a plant belonging to the family Opera family, and has been used since ancient times by extracting oil from the seeds, and is known to be particularly effective in removing sputum and warts.

However, (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside ((Z)-5-Hydroxyjasmone 5-O-β-D-glucopyranoside) Or, for the Euphorbia Factor L1 (Euphorbia Factor L1), the prevention or treatment effect of muscle-related diseases, or improvement of muscle function, was not previously known at all.

Under this background, the present inventors made diligent efforts to develop a composition effective for the prevention or treatment of muscle-related diseases or improvement of muscle function from a substance derived from natural materials, and as a result, an active substance isolated therefrom )-5-hydroxyjasmon 5-o-beta-di-glucopyranoside or euphobia factor L1 was confirmed to be effective by confirming that the present invention was completed.

Republic of Korea Patent Registration No. 10-1747775

It is an object of the present invention to prevent or treat muscle disease comprising a heat wave extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient It is to provide a composition for improving or improving muscle function.

Another object of the present invention is to prevent muscle disease or to include a heat-reducing extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient. To provide a pharmaceutical composition for treatment or improvement of muscle function.

Another object of the present invention is to prevent muscle disease or to include a heat-reducing extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient. To provide a quasi-drug composition for treatment or improvement of muscle function.

Another object of the present invention is to prevent muscle disease or to include a heat-reducing extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient. To provide a food composition for treatment or improvement of muscle function.

Another object of the present invention is to prevent muscle disease or to include a heat-reducing extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient. It is to provide a health functional food for treatment or improvement of muscle function.

Another object of the present invention is to prevent muscle disease or to include a heat-reducing extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient. To provide a feed composition for treatment or improvement of muscle function.

Another object of the present invention is to obtain an extract from the heat exchanger; Or to provide a method for preparing a composition for improving muscle function for the prevention or treatment of muscle disease, comprising the step of obtaining an extract of soksuja from soksuja.

Another object of the present invention is to isolate (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside from the extract from the heat wave; Or to provide a method for preparing a composition for preventing or treating or improving muscle function, comprising the step of isolating the euphobia factor L1 from the Soksuja extract.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

As an aspect for achieving the above object, the present invention provides an active ingredient including a heat wave extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1. It provides a pharmaceutical composition for preventing or treating or improving muscle function comprising a.

In the present invention, the term "extract" refers to a liquid component obtained by immersing the desired substance, such as the heat exchanger or the soksuja in various solvents, and then extracting it at room temperature or in a warm state for a certain period of time. Obtained by removing the solvent from the liquid component. It means the result of one solid content, etc. In addition, it can be comprehensively interpreted as including all of the dilutions of the above results, their concentrates, their preparations, and their purified products.

In addition, there is no limitation on the site of the scorching season according to the present invention, and for example, it may be an extract obtained from leaves, roots, stems, seeds, etc. It may be an extract.

The extract may be obtained by extraction with water or various organic solvents, and the like, but is not particularly limited thereto, and preferably may be extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. In addition, the method for obtaining the extract is also not particularly limited thereto, but preferably a cold extraction method in which a dried or processed product thereof is immersed in the solvent and extracted at room temperature of 10 to 25 ° C., by heating to 40 to 100 ° C. Methods such as a heating extraction method for extraction, an ultrasonic extraction method for extraction by adding ultrasonic waves, and a reflux extraction method using a reflux condenser can be used.

The extraction solvent is preferably added by 1 to 20 times the weight of the extraction solvent, and more preferably 10 times by weight. The extraction temperature is preferably 10 ~ 45 ℃, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, most preferably 3 days, but is not limited thereto. Drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.

In the present invention, the term "fraction" refers to a result obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. In the present invention, the fraction can be interpreted as a fraction obtained by applying the extract of the heat wave or soksuja to various fractionation methods. The fractionation method is not particularly limited thereto, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing through an ultrafiltration membrane having a constant molecular weight cut-off value, or a chromatographic fractionation method. In addition, as the solvent used in the solvent fractionation method, a polar solvent or a non-polar solvent may be used without particular limitation.

In the present invention, '(Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside' may be represented by Formula 1 below.

[Formula 1]

The (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside is an organic compound having a chemical formula of C ₁₇ H ₂₆ O ₇ .

(Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside according to the present invention can be isolated from a site including leaves, stems, roots, etc. of the heat season, and in one embodiment, It may be one isolated from an extract of a branch outpost (above).

In addition, if the substance of (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside according to the present invention is identical, chemical synthesis known in the art, or obtained from other sources; Without limitation to the manufacturing process, it is included within the scope of the present invention. In addition, the (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside may be obtained by extraction with a single or a mixed solvent of the extract of the heat wave extract, and any known solvent may be used. can

The heat-relieving extract according to the present invention may be an extract containing (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside.

In the present invention, the 'euphobia factor L1' may be represented by the following formula (2).

[Formula 2]

The euphobia factor L1 is an organic compound having a chemical formula of C ₃₂ H ₄₀ O ₈ .

The euphobia factor L1 according to the present invention may be isolated from a site including leaves, stems, roots, seeds, etc. of Sookija, and in one embodiment, it may be isolated from a seed extract of Sookija.

In addition, as long as the materials of the euphobia factor L1 according to the present invention are the same, they are included in the scope of the present invention without limitation of chemical synthesis, or obtaining from other sources, or manufacturing processes known in the art.

In addition, the euphobia factor L1 may be obtained by extracting the Soksuja extract alone or with a mixed solvent, and any known solvent may be used.

The Soksuja extract according to the present invention may be an extract containing Euphobia factor L1.

In the present invention, 'muscle' refers to tendons, muscles, and tendons inclusively. 'Muscle strength' refers to the ability to exert force by contraction of the muscle, and the strength is proportional to the muscle mass. 'Improvement of muscle strength' refers to the differentiation of myocytes into muscle cells to increase muscle mass, improve physical performance, improve maximum endurance, strengthen muscle recovery, reduce muscle fatigue, and improve energy balance. In addition, this strength is related to the 'mobility' or 'exercise performance' of the body. 'Exercise performance ability' refers to the ability to quickly, strongly, for a long time, and skillfully perform physical movements performed in daily life or sports. do. In addition, 'muscle weakness' refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to any one muscle, one side of the body, upper or lower extremities, or the like, or may appear throughout the body. In addition, subjective muscle weakness symptoms, including muscle fatigue and muscle pain, can be quantified objectively through physical examination.

In addition, as used herein, the term 'muscle disease' refers to a disease or condition reported in the art as a muscle disease caused by a decrease in muscle function, muscle wasting, or muscle degeneration. The muscle wasting or degeneration occurs due to genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles. Examples of related diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy and sarcopenia ( sarcopenia) and the like. The composition of the present invention has the effect of increasing muscle mass, and the type of muscle is not limited.

The composition of the present invention has, for example, prevention, improvement, and therapeutic efficacy of the above-mentioned diseases or conditions, such as sarcopenia, muscular atrophy, by promoting differentiation of myoblasts.

The composition of the present invention is not limited thereto, but can be implemented in the form of various compositions for external use, such as pharmaceutical compositions, food (including food additives) compositions, quasi-drugs compositions, feed (feed additive) compositions, cosmetic compositions, etc. have.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

Carriers for parenteral administration may also include water, suitable oils, saline, aqueous glucose and glycols, and the like. In addition, it may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention may be administered to mammals including humans by any method. For example, it can be administered orally or parenterally, and parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal. , intranasal, enteral, topical, sublingual or rectal administration.

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above. When formulated, one or more buffers (e.g., saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions or capsules, and such solid preparations include the pharmaceutical composition of the present invention and at least one excipient, such as For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol , cellulose, methyl cellulose, sodium carboxymethyl cellulose, and hydroxypropylmethyl-cellulose or gelatin may be mixed and prepared. For example, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, grinding it, adding suitable adjuvants, and processing it into a granular mixture.

In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, or syrups. In addition to water or liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances or preservatives may be included. have. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, and an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier and a preservative may be further included. .

For parenteral administration, the pharmaceutical composition of the present invention may be formulated according to methods known in the art in the form of injections, transdermal administrations and nasal inhalants together with suitable parenteral carriers. In the case of the injection, it must be sterilized and protected from contamination of microorganisms such as bacteria and fungi. For injection, examples of suitable carriers include, but are not limited to, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and/or a solvent or dispersion medium containing vegetable oil. can More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol and 5% dextrose. . In order to protect the injection from microbial contamination, it may further include various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In addition, in most cases, the injection may further contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointment, cream, lotion, gel, external solution, pasta, liniment, and air are included. Here, 'transdermal administration' means that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.

For administration by inhalation, the compositions used according to the invention may be formulated in pressurized packs or with the use of a suitable propellant, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a recipe generally known to all pharmaceutical chemistry.

The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

As another aspect for achieving the above object, the present invention provides an effective method of extract of heat wave, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1. It provides a quasi-drug composition for preventing or treating muscle disease or improving muscle function, including as a component.

The term "quasi-drug" as used in the present invention refers to articles that are not instruments, machines, or devices used for the purpose of diagnosing, treating, alleviating, treating or preventing diseases of humans or animals, and pharmacologically affecting the structure and function of humans or animals. It refers to articles other than instruments, machines, or devices among articles used for the purpose of influencing, and may include, but is not limited to, preparations for internal use in one embodiment, formulation methods, doses, and methods of use of quasi-drugs , components and the like may be appropriately selected from conventional techniques known in the art.

The quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent if necessary in addition to the above components. The pharmaceutically acceptable carrier, excipient or diluent is not limited as long as it does not impair the effects of the present invention, for example, a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, a lubricant, a sweetener, a fragrance, a preservative, etc. may include

As another aspect for achieving the above object, the present invention provides an effective method of extract of heat wave, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1. It provides a food composition for preventing or treating muscle disease or improving muscle function, including as a component.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives and feed, and includes animals including humans or livestock. target for eating. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and their processed foods (canned fruit, bottled, jam, marmalade, etc.), fish, meat and their processed foods (ham, sausage corned beef, etc.) , Breads and noodles (udon, soba, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (butter, cheese, etc.), edible vegetable oils and fats, margarine, vegetable protein, retort food, frozen food , various seasonings (soybean paste, soy sauce, sauce, etc.) can be prepared by adding the active ingredient.

In addition, as a nutritional supplement, it can be prepared by adding the above active ingredients to capsules, tablets, pills, and the like. In addition, the health functional food is not limited thereto, but it can be ingested by liquefying, granulating, encapsulating, and powdering it so that it can be prepared in the form of tea, juice, and drink and consumed as a health drink, for example. In addition, in order to use the heat keeper or the soksuja in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it can be prepared in the form of a composition by mixing with a known active ingredient known to be effective in improving muscle strength.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, It may contain glycerin, alcohol or a carbonation agent and the like.

As another aspect for achieving the above object, the present invention provides an effective method of extract of heat wave, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1. It provides a feed composition for preventing or treating muscle disease or improving muscle function, including as a component.

In the present invention, the feed composition may be formulated in a conventional feed form, and may include known feed ingredients together. In addition, it can be used as a feed additive, which is added in the form of an additive to the feed used. The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act, and is a mineral preparation such as sodium bicarbonate (bicarbonate), bentonite, magnesium oxide, complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, kerotene, vitamin E, vitamins A, D, E, nicotinic acid, vitamins such as vitamin B complex, protective amino acids such as methionine and lyic acid, protective fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermented products, yeast agents, and the like may be further included.

The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry and fish.

As another aspect for achieving the above object, the present invention provides a method comprising the steps of: obtaining an extract from a heath plant; Or it provides a method for preparing a composition for preventing or treating muscle disease or for improving muscle function, comprising the step of obtaining an extract of soksuja from soksuja.

In the present invention, the extract from the heat wave contains (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside as an active ingredient.

In the present invention, the Soksuja extract contains Euphobia factor L1 as an active ingredient.

As another aspect for achieving the above object, the present invention provides a method comprising the steps of isolating (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside from an extract from the heat exchanger; Or it provides a method for preparing a composition for preventing muscle disease or improving muscle function, comprising the step of isolating the euphobia factor L1 from the soksuja extract.

The heat-relief or Soksuja extract of the present invention or a substance separated therefrom has an effect for preventing or treating muscle disease or improving muscle function, and thus can be used as a material for pharmaceuticals, food, and the like.

1 shows the structure (FIG. 1A) and isolation of (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside ((Z)-5-hydroxyjasmone 5-O-β-D-glucopyranoside) A schematic diagram (FIG. 1B) is shown.
2 shows the structure (FIG. 2A) and the separation schematic diagram (FIG. 2B) of the euphorbia factor L1 (euphorbia factor L1).
Figure 3 shows the nuclear magnetic resonance (NMR) measurement results for confirming the structure of (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside (Figure 3A: ¹ H NMR, Figure 3B: ¹³ C NMR).
4 shows the results of nuclear magnetic resonance (NMR) measurement for confirming the structure of the euphobia factor L1 (FIG. 4A: ¹ H NMR, FIG. 4B: ¹³ C NMR).
5 is EGFP fluorescence confirming the effect on mitochondrial damage caused by muscle atrophy according to (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside treatment in a zebrafish model of anticancer drug-induced muscle atrophy. Expression images (FIG. 5A) and quantitative analysis results (FIG. 5B) are shown.
6 is an EGFP fluorescence image (FIG. 6A) and quantitative analysis results (FIG. 6B) confirming the effect on mitochondrial damage caused by muscle atrophy according to Euphobia factor L1 treatment in the anticancer drug-induced muscle atrophy zebrafish model.
7 shows the results of RT-qPCR measurement of MyoD gene expression according to (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside treatment.
8 is a result of RT-qPCR measurement of gene expression of MyoD ( FIG. 8A ) and myogenin ( FIG. 8B ) according to Euphobia factor L1 treatment.
9 shows (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside treatment Myh1 (FIG. 9A), Myh2 (FIG. 9B), Myh4 (FIG. 9C), Myh7 (FIG. 9D) shows the results of measuring gene expression by RT-qPCR.
10 is a result of RT-qPCR measurement of gene expression of Myh1 (FIG. 10A), Myh2 (FIG. 10B), Myh4 (FIG. 10C), and Myh7 (FIG. 10D) according to Euphobia factor L1 treatment.
11 is a result of RT-qPCR measurement of gene expression of MuRF1 (FIG. 11A) and MAFbx (FIG. 11B) according to (Z)-5-hydroxyjasmone 5-o-beta-D-glucopyranoside treatment. .
12 is a result of RT-qPCR measurement of gene expression of MuRF1 according to Euphobia factor L1 treatment.
13 is an image of MHC-positive myotube cells ( FIG. 13A ) and distribution of multinucleated MHC-positive myotube cells ( FIG. 13B ) according to (Z)-5-hydroxyjasmone 5-o-beta-d-glucopyranoside treatment. shows the results confirmed by immunofluorescence staining.
14 is a result of confirming the MHC-positive myotube cell image ( FIG. 14A ) and the multinuclear MHC-positive myotube cell distribution ( FIG. 14B ) by immunofluorescence staining according to the euphobia factor L1 treatment.
15 shows the results of RT-qPCR measurement of SIRT3 gene expression following (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside treatment.
16 is a result of RT-qPCR measurement of the gene expression of ATPase6 according to Euphobia factor L1 treatment.

Hereinafter, the present invention will be described in more detail through the following examples. However, these Examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited only to these Examples.

Example 1: Preparation of heat wave extract and (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside ((Z)-5-Hydroxyjasmone 5-O-β-D-glucopyranoside)

3.0 kg of the heat exchanger was extracted with 99.9% methanol at 120° C. for 10 hours three times using a reflux cooling device. Using a vacuum rotary vacuum concentrator under reduced pressure, 1.5 L of distilled water was added to the concentrated methanol extract and suspended. Solvent fractionation was performed using the same amount of chloroform and ethyl acetate using a separatory funnel. Column chromatography was performed on 300 g of the remaining water phase fraction. Diaion HP-20 was performed as a filler for 300 g of the water layer fraction, and the developing solvent was water: methanol = 1: 0 to 0: 1 was used to increase the polarity to obtain a total of 5 small fractions (hereinafter named 'DW1 ~ DW5').

For 53 g of the obtained DW3, silica gel 230-400 mesh was used as a filler, and the developing solvent was chloroform: methanol: water = 7: 1: 0.1 to 1: 1: 0.1 using 7 small fractions. obtained (hereinafter referred to as 'DW3-1 ~ DW3-7'). Among the small fractions, 420.1 mg of DW3-2 was performed with C18, a reverse phase filler, and the developing solvent was acetone: water = 1: 5 to 1:1 to obtain three small fractions (hereinafter, 'DW3-2-1 ~ DW3-2-3'). A white powdery substance was obtained from 75 mg of DW3-2-2 in the small fraction, and as a result, the (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside was obtained ( 1 and 3).

white amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 342.17 [M]+; Molecular formula C ₁₇ H ₂₆ O ₇ ; ¹ H-NMR (500 MHz, CD ₃ OD) δ 2.10 (3H, s, H-11), 2.34 (2H, m, H-5), 2.48 (2H, m, H-4), 2.54 (2H, m, H-9), 2.95 (2H, d, J = 7.32 Hz, H-6), 3.13 - 3.35 (4H, m, H-2', 3', 4', 5'), 3.55 (1H, m, H-10a), 3.64 (1H, dd, J = 11.96, 4.64 Hz, H-6'a), 3.86 (1H, m, H-6'b), 3.87 (1H, m, H-10b) , 4.26 (1H, d, J = 7.80 Hz, H-1'), 5.32 (1H, m, H-7), 5.42 (1H, m, H-8); ¹³ C-NMR (250 MHz, CD ₃ OD) δ 212.42 (C-1), 174.98 (C-3), 140.06 (C-2), 128.90 (C-7), 127.75 (C-8), 104.53 ( C-1'), 78.25 (C-5'), 78.11 (C-3'), 75.26 (C-2'), 71.79 (C-4'), 70.36 (C-10), 62.93 (C-6) '), 35.33 (C-5), 32.73 (C-4), 29.09 (C-9), 22.21 (C-6), 17.59 (C-11).

Example 2: Preparation of Sookija Extract and Euphorbia Factor L1

5.4 kg of Soksuja was immersed and extracted with 99.9% methanol three times for 48 hours at room temperature of 25°C. 0.8 L of distilled water was added to the concentrated methanol extract using a vacuum rotary vacuum concentrator under reduced pressure and suspended. Solvent fractionation was performed using equal amounts of n-hexane, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 296.15 g of the n-hexane fraction. 296.15 g of the normal hexane fraction was adsorbed on silica gel 70-230 mesh to solidify it and then loaded onto a column, and the developing solvent is normal hexane: ethyl acetate = 50: 1 to 1: 1 to increase polarity. A total of 13 small fractions were obtained by proceeding with the ratio (hereinafter referred to as 'H1 ~ H13').

With respect to 14 g of the obtained H2, it was performed with silica gel 230-400 mesh filler, and 18 small fractions were obtained using normal hexane: acetone = 50: 1 to 1:1 as a developing solvent (hereinafter 'H2'). -1 to H2-18'). A white crystalline material was obtained from 1.99 g of H2-12 in the small fraction, and as a result, the euphobia factor L1 was obtained ( FIGS. 2 and 4 ).

white amorphous crystals; electron ionization mass spectrometer (EI-MS) m/z 552.70 [M]+; Molecular formula C ₃₂ H ₄₀ O ₈ ; ¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.24-7.33 (m, OPhAc-3), 6.60 (1H, d, J = 1.2 Hz, H-12), 6.24 (1H, d, J = 9.2 Hz, H-5), 5.49 (1H, t, J = 3.2 Hz, H-3), 3.58 (2H, dd, J = 15.2, 17.2 Hz, OPhAc-3), 3.32 (1H, dd, J = 8, 14.4) Hz, H-1), 2.49 (1H, d, J = 3.6 Hz, H-17), 2.31 (1H, dd, J = 2, 3.2 Hz, H-17), 2.13 (3H, s, OAc-15) ), 2.12 (1H, m, H-7), 2.08 (1H, m, H-8), 2.06 (1H, m, H-2), 2.02 (3H, s, OAc-5), 1.87 (1H, dd, J = 3.2, 9.2 Hz, H-4), 1.85 (3H, d, J = 1.2 Hz, H-20), 1.73 (1H, m, H-8), 1.48 (1H, dd, J = 8) , 11.2 Hz, H-11), 1.36 (1H, dd, J = 12.4, 14.4 Hz, H-1), 1.22 (3H, s, H-19), 1.21 (3H, s, H-18), 1.09 (1H, m, H-9), 0.93 (1H, m, H-7), 0.67 (3H, d, J = 6.4 Hz, H-16); ¹³ C-NMR (250 MHz, CDCl ₃ ) δ 196.9 (C-14), 170.9 (OPhAc-3), 170.8 (OAc-5), 169.6 (OAc-15), 143.7 (C-12), 136.0 (C -13), 133.8 (OPhAc-3), 129.4 (OPhAc-3), 128.5 (OPhAc-3), 127.3 (OPhAc-3), 91.8 (C-15), 80.7 (C-3), 65.2 (C- 5), 59.0 (C-6), 55.5 (C-17), 50.0 (C-4), 47.9 (C-1), 41.6 (OPhAc-3), 37.8 (C-2), 34.8 (C-9) ), 33.6 (C-7), 29.0 (C-11), 29.0 (C-18), 25.6 (C-10), 22.0 (OAc-15), 21.1 (OAc-5), 20.1 (C-8) , 16.8 (C-19), 13.5 (C-16), 12.4 (C-20).

Experimental Example 1: (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside anticancer drug-induced muscle atrophy in the zebrafish model confirmed the mitochondrial damage mitigation effect due to muscle atrophy

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University, 2 days a day. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossing of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect by muscle atrophy of (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside through the muscular atrophy zebrafish model, embryos 1 day after fertilization Treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a zebrafish model of muscle atrophy, and (Z)-5-hydroxyjasmon 5-o-beta-d- Glucopyranoside 0.1, 1, and 10 ng/ml were treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, in the muscle cells of zebrafish embryos treated with the anticancer drug FOLFIRI, the brightness of EGFP expressed in mitochondria was significantly decreased compared to the control group due to mitochondrial damage, but (Z)-5-hydroxyjasmon 5-o-beta- As the di-glucopyranoside was treated at concentrations of 0.1, 1, and 10 ng/ml, the expression level increased, and it was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated at all concentrations (FIG. 5). Therefore, through these results, it was confirmed that (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug treatment. .

Experimental Example 2: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in anticancer drug-induced muscle atrophy zebrafish model of euphobia factor L1

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University, 2 days a day. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossing of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect due to muscle atrophy of euphobia factor L1 through the zebrafish model of muscle atrophy, the embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) for muscle atrophy. (muscle atrophy) A zebrafish model was created, and 0.1, 1, and 10 ng/ml of Euphobia factor L1 isolated from Soksuja extract were treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, the brightness of EGFP expressed in mitochondria was significantly reduced by mitochondrial damage in the muscle cells of FOLFIRI-treated zebrafish embryos compared to the control group, but the euphobia factor L1 was treated with concentrations of 0.1, 1, and 10 ng/ml. It was confirmed that the level of mitochondrial damage caused by FOLFIRI was significantly alleviated, particularly in the 1 and 10 ng/ml treatment groups, as the expression level gradually increased as the gradual increase (FIG. 6). Therefore, through these results, it was confirmed that the euphobia factor L1 can inhibit the occurrence of muscle atrophy by restoring the mitochondrial damage of muscle cells caused by the anticancer drug (FOLFIRI) treatment.

Experimental Example 3: (Z)-5-hydroxyjasmone 5-o-beta-D-glucopyranoside induction of myoblast differentiation, alleviation of myotube cell atrophy and confirmation of myotube cell formation promoting effect

Based on the results of Experimental Example 1, (Z)-5-hydroxyjasmon 5-o-beta-D-glucopyranoside confirmed the effect on myoblast differentiation and myotube formation The following cell experiments were performed using C2C12 myoblasts. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside in DM at concentrations of 0.1, 1, and 10 ng/ml, and the control group was treated with DMSO, a vehicle, in DM. and cultured under the same conditions.

3-1: (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside myoblast differentiation promoting effect

(Z)-5-hydroxyjasmone In order to determine the effect of 5-o-beta-di-glucopyranoside on myoblast differentiation, first, The mRNA expression of myogenic markers related to the induction of differentiation of C2C12 myoblasts into myotubes was measured by RT-qPCR. To this end, C2C12 was treated with (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside in the same manner as described above to induce differentiation, followed by lysing the cells by adding Trizol solution and culturing. centrifuged. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene description Primers Sequences (5' →3') SEQ ID NO: GAPDH F CGTGCCGCCTGGAGAAAC One R TGGGAGTTGCTGTTGAAGTCG 2 MAFbx F AGTGAGGACCGGCTACTGTG 3 R GATCAAACGCTTGCGAATCT 4 Myh1 F GAGGGACAGTTCATCGATAGCAA 5 R GGGCCAACTTGTCATCTCTCAT 6 Myh2 F CCGCAATGCAGAAGAGAAA 7 R TTCACGGTCTGCTCCATGT 8 Myh4 F CAGGACTTGGTGGACAAACTACA 9 R TTTAGTGTGAACCTCTCGGCTC 10 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 11 R GGAGCGCAAGTTTGTCATAAGT 12 MuRF1 F TGACATCTACAAGCAGGAGTGC 13 R TCGTCTTCGTGTTCCTTGC 14 MyoD F AAACCCCAATGCGATTTATCAGG 15 R TAAGCTTCATCTTTTGGGCGTGA 16 SIRT3 F CGTTGTGAAACCCGACATTG 17 R TCCCCTAGCTGGACCACATC 18

As a result, the gene expression level of MyoD, an indicator of the initial stage of myoblast differentiation, was 0.1, 1, and 10 ng/ml of (Z)-5-hydroxyjasmon 5-o-beta-D-glucopyranoside compared to the control group. All of them significantly increased in the treated group (FIG. 7).

As a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and related to muscle contraction speed and function, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) compared to the control group (Z)-5-hyd It was increased in the group treated with roxijasmon 5-o-beta-di-glucopyranoside. The expression of Myh1, Myh2 and Myh7 significantly increased at all concentrations compared to the control group, showing the highest expression level in the 10 ng/ml treatment group, and the Myh4 gene increased expression in a concentration-dependent manner at concentrations of 1 and 10 ng/ml. was significantly higher than that of the control group (FIG. 9). The above results show that (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside has a differentiation promoting effect of C2C12 myoblasts.

3-2: Effect of (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside for alleviating myotube cell atrophy

Next, in order to confirm the effect of (Z)-5-hydroxyjasmon 5-o-beta-D-glucopyranoside on myotube atrophy, the muscle-specific degradation process as representative muscle atrophy indicators mRNA expression of MuRF1 and MAFbx involved in RT-qPCR was measured. The primer sequences used are shown in Table 1. As a result, it was confirmed that MuRF1 significantly decreased the expression level of the corresponding gene compared to the control group at concentrations treated with (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside at 0.1 and 1 ng/ml. The gene expression level of MAFbx was significantly decreased in a concentration-dependent manner in all groups treated with (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside ( FIG. 11 ). The above results show that (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside has an atrophy alleviating effect on myotube cells.

3-3: (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside promotes myotube cell formation

The degree of MHC-positive myotube cell formation by (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside was to be confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS and permeabilized with 0.1% Triton X-100 for 30 minutes, followed by washing with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cells.

As a result, images of MHC-positive myotube cells expressed in red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 13A and 13B, respectively. (Z)-5-hydroxyjasmon It was confirmed that MHC-positive myotube cell formation was promoted by treatment with 5-o-beta-D-glucopyranoside compared to the control group ( FIG. 13A ). In addition, in the experimental group treated with (Z)-5-hydroxyjasmon 5-o-beta-D-glucopyranoside at 0.1, 1, and 10 ng/ml, mononuclear MHC-positive myotube cells were significantly reduced compared to the control group, whereas , the formation of multinucleated MHC-positive myotubes was increased. In particular, the number of MHC-positive myotube cells having 6 or more nuclei was significantly increased compared to the control group at all concentrations treated with (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside (FIG. 13B) ). Through the above results, it was demonstrated that (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside promotes C2C12 myoblast differentiation and alleviates myotube cell atrophy, thereby promoting the formation of multinucleated myotube cells. .

3-4: (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside mitochondrial function-related gene expression regulation confirmed

In order to determine whether the effects of (Z)-5-hydroxyjasmon 5-o-beta-d-glucopyranoside on myoblast differentiation and myotube cell atrophy and formation as described above are related to mitochondrial function, mitochondria The mRNA expression of SIRT3, which is present in the substrate and plays an important role in mitochondrial biosynthesis and energy metabolism activation, was measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, as (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside was treated at concentrations of 0.1, 1, and 10 ng/ml, SIRT3 expression gradually increased to 1, 10 ng/ml. It was confirmed that the expression level was significantly increased in the ml-treated group compared to the control group (FIG. 15). These results show that (Z)-5-hydroxyjasmon 5-o-beta-d-glucopyranoside treatment promotes myoblast differentiation, alleviates myotube cell atrophy, and promotes the formation of multinucleated myotube cells in mitochondrial biosynthesis and energy It shows that it is related to the improvement of mitochondrial function through metabolic activation.

Experimental Example 4: Euphobia factor L1 myoblast differentiation induction, myotube cell atrophy alleviation and myotube cell formation promotion effect confirmed

Based on the results of Experimental Example 2, the following cell experiments were performed using C2C12 myoblasts to confirm the effect of the euphobia factor L1 on myoblast differentiation and myotube formation. did. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with Euphobia factor L1 in DM at concentrations of 0.1, 1, and 10 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

4-1: Effect of Euphobia factor L1 to promote myoblast differentiation

To determine the effect of euphobia factor L1 on myoblast differentiation, first, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are myogenic markers related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, C2C12 was treated with euphobia factor L1 in the same manner as described above, and differentiation was induced by culturing, and then cells were lysed by adding Trizol solution and centrifuged. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene description Primers Sequences (5' →3') SEQ ID NO: ATPase6 F ACACACCAAAAGGACGAACA 19 R GAAGGAAGTGGGCAAGTGAG 20 GAPDH F CGTGCCGCCTGGAGAAAC 21 R TGGGAGTTGCTGTTGAAGTCG 22 MAFbx F AGTGAGGACCGGCTACTGTG 23 R GATCAAACGCTTGCGAATCT 24 Myh1 F GAGGGACAGTTCATCGATAGCAA 25 R GGGCCAACTTGTCATCTCTCAT 26 Myh2 F CCGCAATGCAGAAGAGAAA 27 R TTCACGGTCTGCTCCATGT 28 Myh4 F CAGGACTTGGTGGACAAACTACA 29 R TTTAGTGTGAACCTCTCGGCTC 30 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 31 R GGAGCGCAAGTTTGTCATAAGT 32 MuRF1 F TGACATCTACAAGCAGGAGTGC 33 R TCGTCTTCGTGTTCCTTGC 34 MyoD F AAACCCCAATGCGATTTATCAGG 35 R TAAGCTTCATCTTTTGGGCGTGA 36 Myogenin F ACAGCATCACGGTGGAGGATATGT 37 R CCCTGCTACAGAAGTGATGGCTTT 38

As a result, the expression levels of myoD, an early stage indicator of myoblast differentiation, and myogenin, an early stage indicator, increased gradually as the euphobia factor L1 was treated with concentrations of 0.1, 1, and 10 ng/ml, and significantly increased compared to the control group at all concentrations. was confirmed (FIG. 8).

As a result of measuring the expression level of MHC isoforms, which is a marker at the end of myoblast differentiation and related to the speed and function of muscle contraction, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) compared to the control group were treated with euphobia factor L1. It increased in a concentration-dependent manner in the group. In particular, Myh2 and Myh4 were significantly increased in expression levels compared to the control group at all concentrations treated with the euphobia factor L1, and Myh1 and Myh7 were significantly increased in the 1, 10 ng/ml and 10 ng/ml treated groups compared to the control group, respectively. It was confirmed that the increase (FIG. 10). The above results show that the euphobia factor L1 has a differentiation promoting effect of C2C12 myoblasts.

4-2: Effect of Euphobia Factor L1 to Alleviate Myotube Cell Atrophy

Next, in order to confirm the effect of the euphobia factor L1 on myotube atrophy, the mRNA expression of MuRF1, which is involved in muscle-specific degradation as an indicator of muscle atrophy, was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, it was confirmed that the gene expression level was significantly decreased in the group treated with the euphobia factor L1 at concentrations of 0.1 and 10 ng/ml compared to the control group (FIG. 12). These results show that the euphobia factor L1 has an effect of alleviating the atrophy of myotube cells.

4-3: Effect of Euphobia factor L1 to promote myotube cell formation

The degree of MHC-positive myotube cell formation by the euphobia factor L1 was confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS and permeabilized with 0.1% Triton X-100 for 30 minutes, followed by washing with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 14A and 14B, respectively. It was confirmed that MHC-positive myotube cell formation was promoted compared to the control group by treatment with the euphobia factor L1 ( FIG. 14A ). In addition, in the experimental group treated with the euphobia factor L1 at 0.1, 1, and 10 ng/ml, mononuclear MHC-positive myotubes decreased significantly compared to the control group, while the formation of multinucleated MHC-positive myotubes increased. In particular, the number of MHC-positive myotube cells having 3 to 5 and 6 or more nuclei was significantly increased compared to the control group at all concentrations treated with euphobia factor L1 ( FIG. 14B ). Through the above results, it was demonstrated that the euphobia factor L1 promotes the differentiation of C2C12 myoblast cells and alleviates myotube cell atrophy, thereby promoting the formation of multinucleated myotubes.

4-4: Confirmation of regulation of mitochondrial function-related gene expression of euphobia factor L1

In order to check whether the effect of euphobia factor L1 on myoblast differentiation and myotubular cell atrophy and formation as described above is related to mitochondrial function, the electron transport system complex involved in the final process of oxidative phosphorylation for mitochondrial ATP generation The mRNA expression of ATPase6, a V marker, was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, it was confirmed that the expression of ATPase6 increased in a concentration-dependent manner as the Euphobia factor L1 was treated with concentrations of 0.1, 1, and 10 ng/ml, and thus the gene expression level in all treatment groups was significantly increased compared to the control group ( Fig. 16). These results show that the effect of promoting myoblast differentiation, alleviating myotube cell atrophy, and promoting the formation of multinucleated myotube cells according to Euphobia factor L1 treatment is related to the improvement of mitochondrial function through the activation of mitochondrial energy metabolism.

The experimental examples described in this specification and the accompanying drawings show the effect of the active substance of (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside or euphobia factor L1, It is obvious to those of ordinary skill in the art to which the isolated extract also produces the effect.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> Sookmyung Women's university industry-academic cooperation foundation National Institute for Korean Medicine Development <120> Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Artemisia iwayomogi extract, or Euphorbiae Lathyridis Semen extract, or active component separated therefrom as an active ingredient <130> KPA2022-007 <150> KR 10-2021-0013319 <151> 2021-01-29 <160> 38 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 1 cgtgccgcct ggagaaac 18 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 2 tgggagttgc tgttgaagtc g 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 3 agtgaggacc ggctactgtg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 4 gatcaaacgc ttgcgaatct 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 5 gagggacagt tcatcgatag caa 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 6 gggccaactt gtcatctctc at 22 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 7 ccgcaatgca gaagagaaa 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 8 ttcacggtct gctccatgt 19 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 9 caggacttgg tggacaaact aca 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 10 tttagtgtga acctctcggc tc 22 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 11 ctcaagctgc tcagcaatct attt 24 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 12 ggagcgcaag tttgtcataa gt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 13 tgacatctac aagcaggagt gc 22 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 14 tcgtcttcgt gttccttgc 19 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 15 aaaccccaat gcgatttatc agg 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 16 taagcttcat cttttgggcg tga 23 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 17 cgttgtgaaa cccgacattg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 18 tcccctagct ggaccacatc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 19 acacaccaaa aggacgaaca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 20 gaaggaagtg ggcaagtgag 20 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 21 cgtgccgcct ggagaaac 18 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 22 tgggagttgc tgttgaagtc g 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 23 agtgaggacc ggctactgtg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 24 gatcaaacgc ttgcgaatct 20 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 25 gagggacagt tcatcgatag caa 23 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 26 gggccaactt gtcatctctc at 22 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 27 ccgcaatgca gaagagaaa 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 28 ttcacggtct gctccatgt 19 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 29 caggacttgg tggacaaact aca 23 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 30 tttagtgtga acctctcggc tc 22 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 31 ctcaagctgc tcagcaatct attt 24 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 32 ggagcgcaag tttgtcataa gt 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 33 tgacatctac aagcaggagt gc 22 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 34 tcgtcttcgt gttccttgc 19 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 35 aaaccccaat gcgatttatc agg 23 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 36 taagcttcat cttttgggcg tga 23 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 37 acagcatcac ggtggaggat atgt 24 <210> 38 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 38 ccctgctaca gaagtgatgg cttt 24

Claims (14)

For the prevention or treatment of muscle diseases or for improving muscle function containing heat-relief extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient pharmaceutical composition. For the prevention or treatment of muscle diseases or for improving muscle function containing heat-relief extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient Quasi-drug composition. For the prevention or treatment of muscle diseases or for improving muscle function containing heat-relief extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient food composition. For the prevention or treatment of muscle diseases or for improving muscle function containing heat-relief extract, soksuja extract, (Z)-5-hydroxyjasmon 5-o-beta-di-glucopyranoside, or euphobia factor L1 as an active ingredient feed composition. 5. The method according to any one of claims 1 to 4,
The composition of claim 1, wherein the heat wave extract or soksuja extract is extracted with water, an organic solvent having 1 to 4 carbon atoms, or a mixed solvent thereof. 6. The method of claim 5,
The composition of claim 1, wherein the heat wave extract or soksuja extract is extracted by at least one method selected from the group consisting of cold-chilling, heating, ultrasonication, and reflux extraction. 5. The method according to any one of claims 1 to 4,
The muscle disease is a muscle disease induced by a decrease in muscle function, muscle wasting or muscle degeneration, the composition. 5. The method according to any one of claims 1 to 4,
The muscle disease is muscle loss, muscle loss, dystonia (atony), muscular atrophy (muscular atrophy), muscular dystrophy (muscular dystrophy), muscle degeneration, myasthenia gravis, cachexia (cachexia), cardiac atrophy (cardiotrophy) and sarcopenia (sarcopenia) At least one selected from the group consisting of, the composition. 5. The method according to any one of claims 1 to 4,
The heat wave extract, Soksuja extract, (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside, or euphobia factor L1 relieves mitochondrial damage, induces myoblast differentiation, alleviates myotube cell atrophy, or A composition that has myotube cell formation promoting activity. 5. The method according to any one of claims 1 to 4,
The heat wave extract or (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside is expressed by at least one selected from the group consisting of MyoD, Myh1, Myh2, Myh4, Myh7, MuRF1, MAFbx and SIRT3. To increase the composition. 5. The method according to any one of claims 1 to 4,
The composition of claim 1, wherein the Sookija extract or euphobia factor L1 increases the expression of one or more selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, MuRF1 and ATPase6. A health functional food for preventing or treating muscle disease or improving muscle function, comprising the food composition according to any one of claims 3 and 5 to 11. obtaining an extract from the sweltering hot season; Or a method for preparing a composition for preventing or treating muscle disease or for improving muscle function, comprising the step of obtaining an extract from Soksuja. isolating (Z)-5-hydroxyjasmone 5-o-beta-di-glucopyranoside from the heat wave extract; Or a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of isolating the euphobia factor L1 from the Soksuja extract.

Images