KR102650700B1 - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Forsythiae Fructus extract or active component separated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising as an active ingredient an extract of the herbaceous plant or perilla or a substance isolated therefrom.
The white herb extract, perilla extract, digitolutein, or adoxoside acid of the present invention improves the function of mitochondria, promotes differentiation of myogenic cells, alleviates atrophy of myotube cells, and promotes the formation of myotube cells, thereby preventing muscle disease or It has therapeutic or muscle function improvement effects and can be used as a material for medicines, food, etc.

Description

Composition for preventing or treating muscle disease or improvement of muscular functions comprising Forsythiae Fructus extract or active component separated therefrom as an active ingredient}

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising as an active ingredient an extract of the herbaceous plant or perilla or a substance isolated therefrom.

Muscle is an important element of the human body and is a tissue expressed from mesoderm stem cells. Muscles account for about 40% of our body. They are supported by bones and tendons and are made up of bundles of muscle fibers that move with each other and change the size of the cells, causing contraction. Muscles are divided into skeletal muscles, cardiac muscles, and internal muscles. They generate force and cause movement at each location, and also play a role in protecting body organs such as bones, joints, and internal organs. In addition, muscles have the ability to regenerate, so when a muscle is damaged, it can be degenerated by satellite cells and their surrounding environment and then regenerated into a muscle with its original contractile and relaxation abilities.

Muscle diseases are caused by congenital genetic or environmental causes, and diseases related to muscle loss are increasing due to the recent trend of aging society and extension of lifespan. A person's muscles decrease by more than 1% per year after the age of 40, and by the age of 80, 50% of maximum muscle mass is lost, so muscle loss in old age is recognized as the most important cause of decreased overall physical function. These muscle diseases are on the rise worldwide compared to the past.

However, because the causes of muscle diseases are more diverse than those of other diseases, accurate diagnosis is not easy. Symptoms and intensity of the disease also vary depending on the type. In many cases, the exact mechanism has not been revealed as it is a rare disease. In addition, the symptoms of muscle disease progress rapidly, and patients with muscle disease suffer to the extent that it is difficult to live a normal life on their own as the disease progresses. However, there are almost no treatments or effective substances that can prevent the underlying disease. There is no such thing.

Meanwhile, "Hedyotis diffusa Willdenow" is a plant belonging to the madder family. Its leaves have been mainly used since ancient times, and it is known to be effective in anticancer. "Forsythiae Fructus" refers to the dried fruit of Forsythiae viridissima Lindley or Forsythia suspense Vahl, of the ash tree family, and is known to be effective in treating peripheral neuropathy and immune diseases.

However, there was nothing previously known about the preventive or therapeutic effects of muscle-related diseases or the improvement of muscle function regarding doxaphylla, persimmon, or digitolutein or adoxoside acid isolated therefrom.

Against this background, the present inventors have made diligent efforts to develop a composition that is effective in preventing or treating muscle-related diseases or improving muscle function from substances derived from natural materials. As a result, the extract of lilywood or lotus root or digitoluteine, an effective substance isolated therefrom, has been developed. The present invention was completed by confirming that (digitolutein) or adoxosidic acid is effective.

Republic of Korea Patent Publication No. 10-2014-0024582

The purpose of the present invention is to provide a composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxosidic acid.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, which contains as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxoside acid.

Another object of the present invention is to provide a quasi-drug composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a prickly pear extract, a perilla extract, digitolutein, or adoxoside acid.

Another object of the present invention is to provide a food composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxosidic acid.

Another object of the present invention is to provide a health functional food for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxoside acid.

Another object of the present invention is to provide a feed composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily herb extract, a perilla extract, digitolutein, or adoxosidic acid.

Another object of the present invention is to obtain an extract from Baekun grass; Or to provide a method for producing a composition for preventing or treating muscle disease or improving muscle function, comprising the step of obtaining an extract from perilla perilla.

Another object of the present invention is to separate digitolutein from a lilywood extract; Or, to provide a method for producing a composition for preventing or treating muscle disease or improving muscle function, comprising the step of isolating adoxoside acid from the perilla extract.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

In one aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxosidic acid. .

In the present invention, the term "extract" refers to a liquid component obtained by immersing the desired material, such as the above-mentioned Baekun grass or Yeongyo, in various solvents and then extracting it at room temperature or at a heated state for a certain period of time, and a liquid component obtained by removing the solvent from the liquid component. It refers to the result of solid content, etc. In addition, it can be comprehensively interpreted to include all diluted solutions of the above results, concentrated solutions thereof, crude products, purified products, etc.

In addition, there is no limitation to the part of the plant or perilla plant according to the present invention, and for example, it may be an extract obtained from leaves, roots, stems, fruits, etc., and in one embodiment, it may be an extract of the leaf or fruit extract of the plant.

The extract can be obtained by extraction with water or various organic solvents, but is not particularly limited thereto, and is preferably extracted with water, alcohol with 1 to 4 carbon atoms, or a mixed solvent thereof. In addition, the method for obtaining the extract is not particularly limited thereto, but is preferably a cold immersion extraction method in which the dried product or processed product is immersed in the solvent and extracted at room temperature of 10 to 25°C, or heated to 40 to 100°C. Methods such as heating extraction, ultrasonic extraction using ultrasonic waves, and reflux extraction using a reflux condenser can be used.

The extraction solvent is preferably added at 1 to 20 times the weight for extraction, and more preferably at 10 times the weight. The extraction temperature is preferably 10 to 45°C, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, and 3 days is most preferable, but is not limited thereto. Drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, and more preferably freeze drying, but is not limited to these.

In the present invention, the term “fraction” refers to a result obtained by a fractionation method that separates a specific component or specific group from a mixture containing various components. In the present invention, the fraction can be interpreted as a fraction obtained by applying the Baekunwort or Yeongyo extract to various fractionation methods. The fractionation method is not particularly limited, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing the fraction through an ultrafiltration membrane with a certain molecular weight cut-off value, or a chromatography fractionation method. Additionally, the solvent used in the solvent fractionation method may be a polar solvent or a non-polar solvent without any particular limitation.

In the present invention, 'digitolutein' may be represented by the following formula (1).

[Formula 1]

In the present invention, digitolutein is an organic compound with the chemical formula C ₁₆ H ₁₂ O ₄ .

The digitolutein may be isolated from parts including the leaves, stems, roots, etc. of the plant, and in one embodiment, it may be isolated from the leaf extract of the plant. In addition, if the material of digitolutein according to the present invention is the same, it is included within the scope of the present invention without limitation to chemical synthesis known in the art or acquisition from other sources or manufacturing process. In addition, the digitolutein may be obtained by extracting the leaf extract of the herbaceous plant alone or with a mixed solvent, and any known solvent may be used.

The white herb extract according to the present invention may be an extract containing digitolutein.

In the present invention, 'adoxocidic acid' may be represented by the following formula (2).

[Formula 2]

The adoxocidic acid is an organic compound with the chemical formula C ₁₆ H ₂₄ O ₁₀ .

Adoxosidic acid according to the present invention can be separated from the extract obtained without limitation to the part of the perilla fruit. For example, it may be separated from the extract of perilla fruit extract.

In addition, if the substance of adoxosidic acid according to the present invention is the same, it is included within the scope of the present invention, without limitation of chemical synthesis known in the art, or acquisition from other sources, or manufacturing process.

In addition, the adoxocidic acid may be obtained by extracting the extract of the perilla fruit extract alone or with a mixed solvent, and any known solvent may be used.

The persimmon extract according to the present invention may be an extract containing adoxoside acid.

In the present invention, 'muscle' comprehensively refers to tendons, muscles, and tendons. ‘Muscle strength’ refers to the ability to exert force by contracting muscles, and the strength is proportional to muscle mass. 'Improvement of muscle strength' means increasing muscle mass by differentiating myogenic cells into muscle cells, improving physical performance, improving maximum endurance, strengthening muscle recovery, reducing muscle fatigue, and improving energy balance. Additionally, this strength is related to the body's 'mobility' or 'exercise performance ability'. ‘Exercise performance’ refers to the ability to perform physical movements performed in daily life or sports quickly, strongly, for a long time, and skillfully. ‘Improvement in exercise performance’ refers to the effect of improving muscle functions such as strength and muscular endurance. do. Additionally, ‘muscle weakness’ refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to one muscle, one side of the body, upper or lower extremities, etc., or may appear throughout the entire body. Additionally, subjective symptoms of muscle weakness, including muscle fatigue and muscle pain, can be quantified objectively through physical examination.

In addition, in this specification, 'muscle disease' refers to a disease or condition reported in the art as a muscle disease caused by decreased muscle function, muscle wasting, or muscle degeneration. The muscle wasting or degeneration occurs due to genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by gradual loss of muscle mass and weakening and degeneration of muscles, especially skeletal muscles, voluntary muscles, and cardiac muscles. Examples of related diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia ( sarcopenia), etc. The composition of the present invention has the effect of increasing muscle mass, and the type of muscle is not limited.

For example, the composition of the present invention has the effect of preventing, improving, and treating the diseases or conditions mentioned above, such as sarcopenia and muscular dystrophy, by promoting differentiation of myogenic cells.

The composition of the present invention is not limited thereto, but can be implemented in the form of various compositions for external use, such as pharmaceutical compositions, food (including food additive) compositions, quasi-drug compositions, feed (feed additive) compositions, and cosmetic compositions. there is.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

Carriers for parenteral administration may also include water, suitable oils, saline solutions, aqueous glucose and glycols, and the like. Additionally, stabilizers and preservatives may be additionally included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally, and the parenteral administration method is not limited to this, but is intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, and intraperitoneal. , may be administered intranasally, enterally, topically, sublingually, or rectally.

The pharmaceutical composition of the present invention can be formulated into a preparation for oral administration or parenteral administration according to the administration route described above. When formulated, one or more buffers (e.g. saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g. EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g. For example, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, solutions, gels, syrups, slurries, suspensions or capsules, etc. These solid preparations include the pharmaceutical composition of the present invention and at least one excipient, e.g. For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol and maltitol. It can be prepared by mixing cellulose, methyl cellulose, sodium carboxymethyl cellulose, hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or dragees can be obtained by combining the active ingredient with solid excipients, grinding them, adding suitable auxiliaries, and processing them into a granule mixture.

In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, or syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, or preservatives may be included. there is. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included. .

When administered parenterally, the pharmaceutical composition of the present invention can be formulated with a suitable parenteral carrier in the form of injections, transdermal administration, and nasal inhalation according to methods known in the art. The above injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. For injections, examples of suitable carriers include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), mixtures thereof, and/or vegetable oils. You can. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or sterile water for injection, and isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. . In order to protect the injection from microbial contamination, it may additionally contain various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. Additionally, in most cases, the injection may additionally contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointments, creams, lotions, gels, external solutions, paste preparations, linear preparations, and aerol preparations are included. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

For inhalation administration, the compositions used according to the invention may be packaged in pressurized packs or using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. For pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a text generally known in all pharmaceutical chemistry.

The pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using biological response modifiers.

As another aspect for achieving the above object, the present invention provides a quasi-drug composition for preventing or treating muscle disease or improving muscle function, containing as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxosidic acid. .

As used in the present invention, the term "quasi-drug" refers to articles used for the purpose of diagnosing, treating, mitigating, treating, or preventing diseases in humans or animals that are not instruments, machines, or devices, and that have pharmacological effects on the structure and function of humans or animals. Among the products used for the purpose of influencing, it refers to products excluding those that are not instruments, machines, or devices. One specific example may include preparations for internal use, but is not limited thereto, and the formulation method, dosage, and use method of quasi-drugs , components, etc. can be appropriately selected from conventional techniques known in the technical field.

In addition to the above ingredients, the quasi-drug composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.

As another aspect for achieving the above object, the present invention provides a food composition for preventing or treating muscle disease or improving muscle function, comprising as an active ingredient a lily extract, a perilla extract, digitolutein, or adoxosidic acid. .

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives, and feed, and is used for use in humans or animals including livestock. It is intended for consumption. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruit and its processed foods (canned fruit, bottled food, jam, marmalade, etc.), fish, meat, and their processed foods (ham, sausage, corned beef, etc.) , bread and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable protein, retort food, frozen food. , can be manufactured by adding the above active ingredients to various seasonings (soybean paste, soy sauce, sauce, etc.).

Additionally, nutritional supplements can be manufactured by adding the above-mentioned active ingredients to capsules, tablets, pills, etc. In addition, health functional foods are not limited to this, but for example, they can be manufactured in the form of tea, juice, and drinks and consumed by liquefying, granulating, encapsulating, and powdering so that they can be consumed as health drinks. In addition, in order to use the above-mentioned white herb or persimmon in the form of a food additive, it can be prepared and used in the form of powder or concentrate. Additionally, it can be prepared in the form of a composition by mixing it with known active ingredients known to be effective in improving muscle strength.

In addition to the above, the health food of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, It may contain glycerin, alcohol, or carbonating agent.

As another aspect for achieving the above object, the present invention provides a feed composition for preventing or treating muscle disease or improving muscle function, comprising as an active ingredient a lily extract, a lotus root extract, digitolutein, or adoxosidic acid. .

In the present invention, the feed composition may be formulated in the form of a normal feed and may include known feed ingredients. It can also be used as a feed additive, which is added to the feed used in the form of an additive. The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act, and includes mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, vitamin preparations such as kerotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex, protective amino acid preparations such as methionine and lysic acid, protective fatty acid preparations such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermentation products, yeast, etc. may be additionally included.

The feed or feed additive of the present invention can be applied to a number of animal diets, including mammals, poultry, and fish.

In another aspect for achieving the above object, the present invention includes the steps of obtaining an extract from Baekun grass; Alternatively, it provides a method for producing a composition for preventing or treating muscle disease or improving muscle function, comprising the step of obtaining an extract from perilla perilla.

In another aspect for achieving the above object, the present invention includes the steps of separating digitolutein from a lily herb extract; Alternatively, a method for producing a composition for preventing muscle disease or improving muscle function is provided, comprising the step of isolating adoxoside acid from the perilla extract.

The extract of Baekryun plant or perilla of the present invention or substances isolated therefrom have the effect of preventing or treating muscle diseases or improving muscle function, and can be used as materials for medicines, foods, etc.

Figure 1 shows the structure (Figure 1A) and separation schematic diagram (Figure 1B) of digitolutein.
Figure 2 shows the structure (Figure 2A) and separation schematic diagram (Figure 2B) of adoxosidic acid.
Figure 3 shows the results of nuclear magnetic resonance (NMR) measurement to confirm the structure of digitolutein (Figure 3A: ¹ H NMR, Figure 3B: ¹³ C NMR).
Figure 4 shows the results of nuclear magnetic resonance (NMR) measurement to confirm the structure of adoxosidic acid (Figure 4A: ¹ H NMR, Figure 4B: ¹³ C NMR).
Figure 5 shows the EGFP fluorescence expression image (Figure 5A) and quantitative analysis results (Figure 5B) confirming the effect of digitolutein treatment on mitochondrial damage due to muscle atrophy in a zebrafish model of muscle atrophy induced by anticancer drugs.
Figure 6 is an EGFP fluorescence expression image (Figure 6A) and quantitative analysis results (Figure 6B) confirming the effect on mitochondrial damage due to muscle atrophy following adoxocidic acid treatment in a zebrafish model of muscle atrophy induced by anticancer drugs.
Figure 7 shows the results of measuring gene expression of MyoD (Figure 7A) and myogenin (Figure 7B) according to digitolutein treatment by RT-qPCR.
Figure 8 shows the results of measuring gene expression of MyoD (Figure 8A) and myogenin (Figure 8B) according to adoxosidic acid treatment by RT-qPCR.
Figure 9 shows the results of measuring gene expression of Myh1 (Figure 9A), Myh2 (Figure 9B), Myh4 (Figure 9C), and Myh7 (Figure 9D) according to digitolutein treatment by RT-qPCR.
Figure 10 shows the results of measuring gene expression of Myh1 (Figure 10A), Myh2 (Figure 10B), Myh4 (Figure 10C), and Myh7 (Figure 10D) according to adoxoxic acid treatment by RT-qPCR.
Figure 11 shows the results of measuring gene expression of MuRF1 (Figure 11A) and MAFbx (Figure 11B) according to digitolutein treatment by RT-qPCR.
Figure 12 shows the results of measuring gene expression of MuRF1 (Figure 12A) and MAFbx (Figure 12B) according to adoxosidic acid treatment by RT-qPCR.
Figure 13 shows the results of immunofluorescence staining showing the image of MHC-positive myotube cells (Figure 13A) and the distribution of multinucleated MHC-positive myotube cells (Figure 13B) according to digitolutein treatment.
Figure 14 shows the results of immunofluorescence staining of the MHC-positive myotube cell image (Fig. 14A) and the ratio of multinucleated MHC-positive myotube cells (Fig. 14B) according to adooxosidic acid treatment.
Figure 15 shows the results of measuring gene expression of COX2 (Figure 15A) and DRP1 (Figure 15B) according to digitolutein treatment by RT-qPCR.
Figure 16 shows the results of measuring gene expression of SDHA (Figure 16A), COX1 (Figure 16B), and COX2 (Figure 16C) according to adoxosidic acid treatment by RT-qPCR.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1: Preparation of White Cloud extract and Digitolutein

130 kg of Baekun grass leaves were refluxed with 95% ethanol and extracted twice for 3 hours. The ethanol extract concentrated using a reduced-pressure rotary vacuum concentrator was suspended in 3 L of distilled water. Solvent fractionation was performed using equal amounts of methylene chloride, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 111.6 g of the methylene chloride fraction. 111.6 g of the methylene chloride fraction was adsorbed onto silica gel 70-230 mesh and solidified, then loaded into the column, and the developing solvent was hexane: ethyl acetate = 50: 1 to 1: 1, methylene chloride: methanol = 20: A total of 6 small fractions were obtained by proceeding at a ratio of increasing polarity using 1 to 1:1 (hereinafter referred to as 'MC1 to MC5').

A silica gel 230-400 mesh filler was used for 14.52 g of MC3 obtained, and a yellow crystalline material was obtained from 51.6 mg of MC3-2, and as a result, the digitolutein was obtained (Figures 1 and Figure 3).

Yellow amorphous powder; Electron ionization mass spectrometry (EI-MS) m/z 268.26 [M]+; Molecular formula C ₁₆ H ₁₂ O ₄ ; ¹ H-NMR (500 MHz, CDCl ₃ ) δ 8.28~8.23 (2H, m, H-5 and 8), 8.00 (1H, s, H-4), 7.79~7.72 (2H, m, H-6 and 7), 6.76 (1H, s, OH), 4.03 (3H, s, OCH3), 2.41 (3H, s, CH3); ¹³ C-NMR (250 MHz, CDCl ₃ ) δ 182.69 (C-9), 182.58 (C-10), 153.92 (C-3), 146.18 (C-4), 134.65 (C-10a), 133.90 (C -6), 133.80 (C-7), 133.13 (C-8a), 131.49 (C-2), 127.12 (C-5), 126.91 (C-8), 126.82 (C-1), 126.65 (C- 9a), 123.68 (C-4a), 62.30 (OCH3), 16.47 (CH3).

Example 2: Preparation of perilla extract and aodoxosidic acid

10 kg of Yeongyo fruits were soaked in 99.9% methanol at room temperature and extracted three times for 48 hours. The methanol extract concentrated using a reduced-pressure rotary vacuum concentrator was suspended in 5 L of distilled water. Solvent fractionation was performed using equal amounts of ethyl acetate and n-butanol using a separatory funnel. Column chromatography was performed on 549 g of the ethyl acetate fraction. 549 g of the ethyl acetate fraction was adsorbed onto silica gel 70-230 mesh and solidified, then loaded into the column, and the developing solvent was methylene chloride:methanol = 100:0 to 0:100, using a ratio to increase polarity. A total of 10 subfractions were obtained (hereinafter referred to as 'E1 to E10').

21.54 g of the obtained E4 was recrystallized with methanol to obtain a white crystalline material, and as a result, the above-described adoxoside acid was obtained (FIGS. 2 and 4).

White amorphous powder; Electron ionization mass spectrometry (EI-MS) m/z 376 [M]+; molecular formula

C ₁₆ H ₂₄ O ₁₀ ; ¹ H-NMR (500 MHz, CD ₃ OD) δ 7.42 (1H, s, H-3), 5.12 (1H, d, J = 6.5 Hz, H-1), 4.60 (1H, d, J = 7.8 Hz , Glc-H-1), 3.13-3.85 (8H, m, Glc-H-2, 3, 4, 5, 6, H-10), 2.73 (1H, m, H-5), 2.10 (1H, m, H-8), 1.75-1.89 (3H, m, H-6a, 7a, 9), 1.19-1.40 (2H, m, H-6b, 7b); ¹³ C-NMR (250 MHz, CD ₃ OD) δ 170.1 (C-11), 152.5 (C-3), 111.1 (C-4), 99.4 (Glc-1), 97.5 (C-1), 77.2 ( Glc-3), 76.9 (Glc-5), 73.7 (Glc-2), 70.5 (Glc-4), 65.6 (C-10), 61.6 (Glc-6), 43.2 (C-8, 9), 35.4 (C-5), 32.4 (C-6), 27.6 (C-7).

Experimental Example 1: Confirmation of the effect of digitolutein in alleviating mitochondrial damage caused by muscle atrophy in an anticancer drug-induced muscle atrophy zebrafish model

Tg ( They were raised on a raw diet (live brine shrimp (artemia) and Tetramin, 16106, Germany), and the embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

To confirm the effect of digitolutein on alleviating mitochondrial damage caused by muscle atrophy through a muscle atrophy zebrafish model, embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to produce muscle atrophy zebrafish. A fish model was created and treated with 0.01 ng/ml of digitolutein, isolated from the leaf extract of the herbaceous plant in Example 1. Confocal images of mitochondria in muscle cells using Tg ( Observation was made through a microscope (Carl Zeiss, Germany).

As a result, the brightness of EGFP expressed in the mitochondria was significantly reduced compared to the control group due to mitochondrial damage in muscle cells of FOLFIRI-treated zebrafish embryos, but the expression level decreased when treated with digitolutein at a concentration of 0.01 ng/ml. It was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated (Figure 5). Therefore, through the above results, it was confirmed that digitolutein can suppress the occurrence of muscle atrophy by recovering mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 2: Confirmation of the effect of adoxoside acid in alleviating mitochondrial damage caused by muscle atrophy in an anticancer drug-induced muscle atrophy zebrafish model

Tg ( They were raised on a raw diet (live brine shrimp (artemia) and Tetramin, 16106, Germany), and the embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

To confirm the effect of adoxoside acid in alleviating mitochondrial damage caused by muscle atrophy through a muscle atrophy zebrafish model, embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to reduce muscle atrophy. (Muscle atrophy) A zebrafish model was created and treated with 0.1 ng/ml of adoxoside acid isolated from the fruit extract of Yeongyo fruit in Example 2. Confocal images of mitochondria in muscle cells using Tg ( Observation was made through a microscope (Carl Zeiss, Germany).

As a result, the brightness of EGFP expressed in the mitochondria was significantly reduced compared to the control group due to damage to the mitochondria in the muscle cells of zebrafish embryos treated with FOLFIRI, but when treated with adoxosidic acid at a concentration of 0.1 ng/ml, the expression decreased. As the amount increased, it was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated (Figure 6). Therefore, these results confirmed that adoxoside acid can suppress the development of muscle atrophy by recovering mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 3: Confirmation of the effects of digitolutein to induce myocyte differentiation, alleviate myotube cell atrophy, and promote myotube cell formation

Based on the results of Experimental Example 1 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of digitolutein on myoblast differentiation and myotube formation. C2C12 myogenic cells were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). It was seeded in a 6-well plate at a concentration of 2 x 10 ⁵ cells/ml. When the cell confluency reached approximately 90% after 24 hours of culture, the cells were replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group treated DM with digitolutein at a concentration of 0.01 and 0.1 ng/ml, and the control group treated DM with DMSO, a vehicle, and cultured under the same conditions.

3-1: Digitolutein’s effect on promoting myogenic cell differentiation

To confirm the effect of digitolutein on myogenic cell differentiation, first, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are myogenic indicators related to the process of inducing differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. For this purpose, C2C12 was treated with digitolutein and cultured in the same manner as described above to induce differentiation, and Trizol solution was added to lyse the cells and centrifuged. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming its purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene description Primers Sequences (5' →3') sequence number COX2 F ATGGCCTACCCATTCCAACT One R CGGGGTTGTTGATTTCGTC 2 DRP1 F TCTGCAGCTAGTCCACGTTTC 3 R ACCCCATTCTTCTGCTTCCAA 4 GAPDH F CGTGCCGCCTGGAGAAAC 5 R TGGGAGTTGCTGTTGAAGTCG 6 MAFbx F AGTGAGGACCGGCTACTGTG 7 R GATCAAACGCTTTGCGAATCT 8 Myh1 F GAGGGACAGTTCATCGATAGCAA 9 R GGGCCAACTTGTCATCTCTCAT 10 Myh2 F CCGCAATGCAGAAGAGAAA 11 R TTCACGGTCTGCTCCATGT 12 Myh4 F CAGGACTTGGTGGACAAACTACA 13 R TTTAGTGTGAACCTCTCGGCTC 14 Myh7 F CTCAAGCTGCTGAGCAATCTATTT 15 R GGAGCGCAAGTTTGTCATAAGT 16 MuRF1 F TGACATCTACAAGCAGGAGTGC 17 R TCGTCTTCGTGTTCCTTGC 18 MyoD F AACCCCCAATGCGATTTATCAGG 19 R TAAGCTTCATCTTTTGGGGCGTGA 20 Myogenin F ACAGCATCACGGTGGAGGGATATGT 21 R CCCTGCTACAGAAGTGATGGCTTT 22

As a result, the expression levels of MyoD, an indicator of the early stage of myocyte differentiation, and myogenin, an indicator of the intermediate stage, gradually increased as digitolutein was treated at concentrations of 0.01 and 0.1 ng/ml compared to the control group, and the MyoD gene expression level was 0.1 ng/ml. group, and the expression level of myogenin was significantly increased at all concentrations (Figure 7).

As a result of measuring the expression levels of MHC isoforms, which are markers of the terminal stage of myocyte differentiation and are related to muscle contraction speed and function, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) were found in the group treated with digitolutein and the control group. It significantly increased in a concentration-dependent manner (Figure 9). The above results show that digitolutein has the effect of promoting differentiation of C2C12 myogenic cells.

3-2: Effect of digitolutein in alleviating myotube cell atrophy

Next, to confirm the effect of digitolutein on myotube atrophy, the mRNA expression of MuRF1 and MAFbx, which are representative muscle atrophy indicators and are involved in muscle-specific degradation processes, were measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, the expression level of MuRF1 was significantly decreased compared to the control group at all concentrations treated with digitolutein, and the expression level of MAFbx was significantly decreased compared to the control group in the group treated with digitolutein at a concentration of 0.01 ng/ml. This was confirmed (Figure 11). The above results show that digitolutein has the effect of alleviating atrophy of myotube cells.

3-3: Effect of digitolutein on promoting myotube cell formation

We sought to confirm the degree of MHC-positive myotube cell formation by digitolutein through immunofluorescence staining. For this purpose, DM was removed from cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, the cells were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated from randomly selected areas in the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the total number of cells was applied and the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) was expressed as a percentage.

As a result, images of MHC-positive myotube cells expressed in red fluorescence and distribution of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Figures 13A and 13B, respectively. It was confirmed that the formation of MHC-positive myotube cells was promoted by digitolutein treatment compared to the control group (Figure 13A). In addition, in the experimental group treated with digitolutein at 0.01 and 0.1 ng/ml, the number of mononuclear MHC-positive myotube cells tended to decrease compared to the control group, while the formation of multinucleated MHC-positive myotube cells increased. In particular, the number of MHC-positive myotube cells with 6 or more nuclei significantly increased compared to the control group at all concentrations treated with digitolutein (Figure 13B). The above results demonstrated that digitolutein promotes C2C12 myoblast differentiation, alleviates myotube cell atrophy, and promotes the formation of multinucleated myotube cells.

3-4: Confirmation of regulation of gene expression related to mitochondrial function by digitolutein

In order to confirm whether the above effects of digitolutein on myocyte differentiation and myotube cell atrophy and formation are related to mitochondrial function, COX2, which constitutes electron transport chain complex IV present in the mitochondrial inner membrane of myoblasts, and mitochondrial division were examined. The gene expression level of DRP1, which regulates mitochondrial fission, was measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, in all groups treated with digitolutein, the expression level of COX2 was significantly increased compared to the control group, while the expression of the DRP1 gene involved in mitochondrial division was significantly decreased (FIG. 15). These results show that the effects of digitolutein treatment to promote myocyte differentiation, alleviate myotube cell atrophy, and promote multinucleated myotube cell formation are related to the improvement of mitochondrial function through activating mitochondrial energy metabolism and alleviating mitochondrial damage.

Experimental Example 4: Confirmation of the effect of adoxoside acid to induce myocyte differentiation, alleviate myotube cell atrophy, and promote myotube cell formation

Based on the results of Experimental Example 2 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of adoxoside acid on myoblast differentiation and myotube formation. . C2C12 myogenic cells were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). It was seeded in a 6-well plate at a concentration of 2 x 10 ⁵ cells/ml. When the cell confluency reached approximately 90% after 24 hours of culture, the cells were replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group treated DM with adoxosidic acid at concentrations of 0.1, 1, and 10 ng/ml, and the control group treated DM with DMSO, a vehicle, and cultured under the same conditions.

4-1: Effect of adoxoside acid on promoting myogenic cell differentiation

To confirm the effect of adoxoside acid on myogenic cell differentiation, first, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are myogenic markers related to the process of inducing differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. For this purpose, C2C12 was treated with adoxosidic acid and cultured in the same manner as described above to induce differentiation, and Trizol solution was added to lyse the cells and centrifuged. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming its purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene description Primers Sequences (5' →3') sequence number COX1 F TGGAGGGCTTTGGAAACTGAC 23 R TTCATCCTGTTCCTGCTCCT 24 COX2 F ATGGCCTACCCATTCCAACT 25 R CGGGGTTGTTGATTTCGTC 26 GAPDH F CGTGCCGCCTGGAGAAAC 27 R TGGGAGTTGCTGTTGAAGTCG 28 MAFbx F AGTGAGGACCGGCTACTGTG 29 R GATCAAACGCTTTGCGAATCT 30 Myh1 F GAGGGACAGTTCATCGATAGCAA 31 R GGGCCAACTTGTCATCTCTCAT 32 Myh2 F CCGCAATGCAGAAGAGAAA 33 R TTCACGGTCTGCTCCATGT 34 Myh4 F CAGGACTTGGTGGACAAACTACA 35 R TTTAGTGTGAACCTCTCGGCTC 36 Myh7 F CTCAAGCTGCTGAGCAATCTATTT 37 R GGAGCGCAAGTTTGTCATAAGT 38 MuRF1 F TGACATCTACAAGCAGGAGTGC 39 R TCGTCTTCGTGTTCCTTGC 40 MyoD F AACCCCCAATGCGATTTATCAGG 41 R TAAGCTTCATCTTTTGGGGCGTGA 42 Myogenin F ACAGCATCACGGTGGAGGGATATGT 43 R CCCTGCTACAGAAGTGATGGCTTT 44 SDHA F CAGAAGTCGATGCAGAACCA 45 R CGACCCGCACTTTGTAATCT 46

As a result, the expression levels of MyoD, an indicator of the early stage of myocyte differentiation, and myogenin, an indicator of the intermediate stage, gradually increased as compared to the control group when treated with adoxosidic acid at concentrations of 0.1, 1, and 10 ng/ml, and the MyoD gene expression level was 1, It was significantly higher in the 10 ng/ml treatment group, and the expression level of myogenin was significantly increased compared to the control group at all concentrations (Figure 8).

As a result of measuring the expression level of MHC isoforms, which are markers of the terminal stage of myocyte differentiation and are related to muscle contraction speed and function, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) were increased in the group treated with adoxosidic acid compared to the control group. group increased in a concentration-dependent manner. In particular, the expression level of Myh1 was significantly increased in groups treated at all concentrations, and Myh2 and Myh4 were confirmed to be significantly increased in groups treated with 1 and 10 ng/ml adoxoside acid compared to the control group (Figure 10A, FIG. 10B, Figure 10C). Myh7 gene expression level was significantly increased in the group treated with adoxoside acid at a concentration of 10 ng/ml compared to the control group (Figure 10D). The above results show that adoxoside acid has the effect of promoting differentiation of C2C12 myogenic cells.

4-2: Effect of adoxoside acid in alleviating myotube cell atrophy

Next, to confirm the effect of adoxoside acid on myotube atrophy, the mRNA expression of MuRF1 and MAFbx, which are representative muscle atrophy indicators and are involved in the muscle-specific degradation process, were measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, in the case of MuRF1, the expression level of the corresponding gene was significantly decreased in the group treated with adoxosidic acid at concentrations of 1 and 10 ng/ml compared to the control group, and for MAFbx, the expression level of the gene was decreased in the group treated with 0.1 and 1 ng/ml compared to the control group. It was confirmed that this significantly decreased (Figure 12). The above results show that adoxoside acid has the effect of alleviating atrophy of myotube cells.

4-3: Effect of adoxoside acid on promoting myotube cell formation

We sought to confirm the degree of MHC-positive myotube cell formation by adoxoside acid through immunofluorescence staining. For this purpose, DM was removed from cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, the cells were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated from randomly selected areas in the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the total number of cells was applied and the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) was expressed as a percentage.

As a result, the image of MHC-positive myotube cells expressed in red fluorescence and the ratio of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Figure 14. It was confirmed that the formation of MHC-positive myotube cells was promoted by treatment with adoxosidic acid compared to the control group (Figure 14A). In addition, the formation of multinucleated MHC-positive myotube cells increased in the experimental groups treated with adoxacidic acid at 0.1, 1, and 10 ng/ml, and in particular, the proportion of MHC-positive myotube cells with 6 or more nuclei increased with adooxoside. At all concentrations of acid treatment, it increased compared to the control group (Figure 14B). The above results demonstrated that adoxoside acid promotes C2C12 myoblast differentiation, alleviates myotube cell atrophy, and promotes the formation of multinucleated myotube cells.

4-4: Confirmation of regulation of mitochondrial function-related gene expression by adoxoside acid

In order to confirm whether the above effects of adoxoside acid on myoblast differentiation and myotube cell atrophy and formation are related to mitochondrial function, SDHA and electrons, which constitute electron transport chain complex II present in the inner membrane of mitochondria of myoblasts, were examined. The mRNA expression of COX1 and COX2, which constitute transport system IV, was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, SDHA expression gradually increased as suboxosidic acid was treated at concentrations of 0.1, 1, and 10 ng/ml, and the expression level significantly increased in the 10 ng/ml treatment group compared to the control group, and COX1 and COX2 were subtoxic It was confirmed that the expression level of the corresponding gene in all groups treated with seed acid was significantly increased compared to the control group (FIG. 16). These results show that the effects of promoting myocyte differentiation, alleviating myotube cell atrophy, and promoting the formation of multinucleated myotube cells due to adoxosidic acid treatment are related to the improvement of mitochondrial function through activation of mitochondrial energy metabolism.

The experimental examples described in this specification and the attached drawings show the effect of the active substance of digitolutein or adoxosidic acid, and the extract from which the active substance is isolated also produces the effect, as is known in the technical field to which the present invention pertains. It is self-evident to those with knowledge.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Claims (13)

A pharmaceutical composition for preventing or treating muscle disease or improving muscle function containing adoxoside acid as an active ingredient,
The muscle diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. A composition that is one or more selected from the group consisting of. A quasi-drug composition for preventing or treating muscle disease or improving muscle function containing adoxoside acid as an active ingredient,
The muscle diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. A composition that is one or more selected from the group consisting of. A food composition for preventing or improving muscle disease or improving muscle function containing adoxoside acid as an active ingredient,
The muscle diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. A composition that is one or more selected from the group consisting of. A feed composition for preventing or improving muscle disease or improving muscle function containing adoxoside acid as an active ingredient,
The muscle diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. A composition that is one or more selected from the group consisting of. According to any one of claims 1 to 4,
The composition, wherein the adoxoside acid is isolated from the perilla extract. According to clause 5,
The composition, wherein the persimmon extract is extracted by one or more methods selected from the group consisting of cold immersion, heating, ultrasound, and reflux extraction. According to any one of claims 1 to 4,
The composition, wherein the muscle disease is a muscle disease caused by decreased muscle function, muscle wasting, or muscle degeneration. delete According to any one of claims 1 to 4,
The composition wherein the adoxosidic acid has the activity of alleviating mitochondrial damage, inducing myocyte differentiation, alleviating myotube cell atrophy, or promoting myotube cell formation. According to any one of claims 1 to 4,
The composition wherein the adoxosidic acid increases the expression of one or more selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, MuRF1, MAFbx, SDHA, COX1 and COX2. As a health functional food for preventing or improving muscle disease or improving muscle function containing adoxoside acid as an active ingredient,
The muscle diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. A health functional food, which is one or more selected from the group consisting of. delete delete