KR101618116B1 - Composition of extracts of Arctium lappa or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease - Google Patents

Abstract

The present invention relates to an obesity or obesity-related disease comprising at least one member selected from the group consisting of fermented burdock extract, arctin, arctigenin and pharmaceutically or pharmacologically acceptable salts thereof as an active ingredient Prevention, amelioration or treatment. The fermented burdock root extract, arctin, arctigenin, etc. according to the present invention can be used as a pharmaceutical material constituting a pharmaceutical composition or a functional food composition. In particular, the arctin and arctigenin according to the present invention activates AMP-activated protein kinase (AMPK) and down-regulates the expression of the lipogenesis-related gene, And the effect of suppressing the accumulation of neutrino quality is excellent.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing, ameliorating or treating obesity or obesity-related diseases, which comprises a compound isolated from fermented burdock root extract or burdock,

The present invention relates to a novel use of a compound isolated from a fermented burdock extract or burdock, and more particularly to a composition for preventing, ameliorating or treating obesity or an obesity related disease comprising a compound isolated from fermented burdock extract or burdock will be.

Obesity has become one of the most serious diseases as mankind has developed into a rich society, and the World Health Organization (WHO) has declared that obesity is the object of diseases to be treated. Obesity is a metabolic disorder caused by an imbalance in the intake and consumption of calories, and is caused by hypertrophy or hyperplasia of the body fat cells morphologically. Obesity is not only the most common malnutrition disorder in western society, but also in Korea, the importance of the treatment and prevention of the obesity is rapidly increasing due to the rapid increase in the frequency of obesity due to the improvement of diet and westernization of lifestyle. have. Obesity is not only psychologically disturbing individuals, but also an important factor in increasing the risk of various adult diseases. Obesity is known to be directly related to the increased prevalence of various adult diseases such as type 2 diabetes, hypertension, hyperlipidemia, and cardiovascular disease (Cell 87: 377, 1999) and is associated with metabolic syndrome or insulin resistance (Insulin resistance syndrome), which is known as a cause of arteriosclerosis and cardiovascular disease. It can be inferred from the fact that obesity increases the incidence of various metabolic diseases and that actual weight loss significantly reduces the incidence of such diseases, fat-rich adipocytes mediate this phenomenon.

In the past, adipose tissue was thought to be an energy storage organ that stores and releases excessive energy in the form of triacylglycerol, but recently, adiponectin, leptin, and resistin It is accepted as an important endocrine organ that regulates energy homeostasis by secreting various adipokines (Trends Endocrinol Metab 13:18, 2002). Therefore, understanding of the proliferation of adipocytes and the substances secreted by adipocytes and their in vivo mechanisms of regulation are considered to serve as a basis for understanding obesity and various diseases caused by it and for developing an effective therapeutic agent. Studies on the regulation of adipocyte differentiation have been actively conducted and it is considered to be the main mechanism that differentiation from preadipocytes in the body is related to the increase of adipocytes in obese patients. The differentiation process of precursor adipocytes into adipocytes has been studied using cells such as 3T3-L1, and several transcription factors, particularly transcription factors known to be involved in localization, C / EBPs (CAAT enhancer binding proteins, PPARs (Peroxisome Proliferator Activated Receptor), and ADD / SREBPs (Adipocyte determination and differentiation dependent element binding proteins), are known to regulate the process and to control the process (Bart A Jessen et al., Gene, 299, pp 95-100, 2002; Darlington et al., J. Biol. Chem., 273, pp30057-30060, 1998; Brun RP et al., Curr Opin. , pp 826-832, 1996). Given the stimulation of hormones such as MDI (isobutylmethylxanthin, dexamethasone and insulin), C / EBP [beta] and [delta] are first transiently expressed and initiate differentiation into adipocytes (Reusch J. E et al., Mol Cell. Biol., 20, pp 1008-1020, 2000). Which in turn leads to increased expression of C / EBP alpha and PPARy (James M. N. et al., J. Nutr., 130, pp3122S-3126S, 2000). PPARγ is known to be an important transcription factor especially for adipocyte differentiation. It forms a retinoic acid X receptor protein (RXR) and a dimer, and is present in various promoters of adipocyte genes (Tontonoz PE et al., Genes Dev., 8, pp1224-1234, 1994; Hwang, C. S et al., Cell Dev. Biol., 13, pp 873-877) . The interaction of PPARγ and C / EBP α is crucial for the differentiation into mature adipocytes. These transcription factors and adipocyte regulators promote adipocyte differentiation and promote adipocyte fatty acid-binding protein 2 (aP2) And fatty acid synthase (Fas) are increased. In addition, ADD1 / SREBPs play an important role in lipid metabolism, but are also involved in the differentiation process. Expression of ADD1 / SREBP1c in immature adipocytes is believed to contribute to the activation of PPARγ (Rosen ED et al., Annu. Rev. Cell Dev. Biol., 16, pp 145-171, 2000; Osborn TF, J. Biol Chem., 275, pp 32379-32382, 2000). Only the fat cells that have undergone the differentiation process synthesize fatty acids and store triglycerides. Therefore, current research trends are focused on the search for substances that can inhibit the metabolic process of adipocyte differentiation as a method for preventing or treating obesity and lipid-related metabolic diseases. In other words, attempts have been made to treat obesity through the regulation of fat cells based on the mechanism of obesity, and it has been attempted to inhibit fat synthesis, to reduce fat amount by promoting lipolysis and oxidation, The goal is to reduce the number of cells, and transcription factors, proteins and adipokines, which are known to mediate or regulate these processes, are the targets of the development of new anti-obesity drugs. Indeed, the PPAR (Peroxisome proliferator-activated receptor) family of adipocyte differentiation transcription factors, leptin and adiponectin, which are adipocyte-secreting substances, have been the targets of many new drug development.

Currently known herbal remedies include Xenical (Roche Pharmaceuticals, Switzerland), Reductil (Evothe, USA) and Exolise (Atopama, France), which are widely used as appetite suppressants, And most obesity drugs are appetite suppressants that suppress appetite by controlling the neurotransmitters associated with the hypothalamus. However, conventional therapeutic agents have side effects such as heart diseases, respiratory diseases, nervous system diseases and the like, and the persistence of their effects is also low, so that it is necessary to develop a more improved therapeutic agent for obesity. Also, currently developed products have satisfactory therapeutic effects There is little cure for cervical cancer, and development of a new treatment for obesity is required.

On the other hand, burdock (Arctium lappa ) is a two-year-old herbaceous plant belonging to the Asteraceae family, and the adult seed of the burdock, a stranger, is used as a diuretic in one room. Regarding the physiological activity of burdock, a stranger, or a compound isolated therefrom, Korean Patent Registration No. 10-0855457 discloses a cosmetic composition for skin whitening comprising actin, actigenein or a mixture thereof as an active ingredient, Japanese Patent Application Laid-Open No. 10-0968716 discloses a cosmetic composition for preventing skin aging which contains actigenein or an actigenein derivative as an active ingredient, and Korean Patent Registration No. 10-0570118 discloses an antioxidant cosmetic composition containing an extract Korean Patent Publication No. 10-0901661 discloses a composition for improving skin wrinkles containing actinidin as an active ingredient and Korean Patent Publication No. 10-1198914 discloses a composition comprising a fermented product of burdock, Lt; / RTI > Korean Patent Registration No. 10-1298568 discloses an antiobesity food composition containing burdock extract. However, it is unclear whether the antiobesity effect is an effect of burdock extract, and whether it is an effect of garnichia cambogia bark extract. Therefore, the anti-obesity effect has not been directly disclosed due to the functionality of the burdock extract-based material.

The present invention has been made under the background of the prior art, and one object of the present invention is to provide a new use of the fermented burdock root extract, and more particularly to a fermented burdock root extract useful for prevention, improvement or treatment of obesity or obesity- .

Another object of the present invention is to provide a novel use of a compound separated from burdock and specifically to provide a use for preventing, ameliorating or treating obesity or obesity-related diseases of a compound isolated from burdock.

The inventors of the present invention conducted studies to develop extracts having a preventive or therapeutic activity against obesity in various medicinal plant extracts or compounds isolated therefrom, which are more safe than synthetic chemicals. As a result, we found that arctin, which is isolated from fermented burdock extract or burdock, has excellent prophylactic or therapeutic effect on obesity-inducing model animals, thus completing the present invention.

In order to accomplish one object of the present invention, the present invention provides a fermented burdock extract as an active ingredient, wherein the fermented burdock root extract is a product obtained by fermenting burdock with a lactic acid bacterium, Or preventing obesity or an obesity-related disease caused by an obesity or an obesity-related disease. The composition for preventing, ameliorating or treating the obesity or obesity-related diseases is preferably a pharmaceutical composition or a food composition.

In order to accomplish still another object of the present invention, the present invention provides a pharmaceutical composition comprising at least one compound selected from the group consisting of arctin, arctigenin and pharmaceutically acceptable salts thereof, A composition for preventing or treating obesity or obesity-related diseases. The composition for preventing, ameliorating or treating the obesity or obesity-related diseases is preferably a pharmaceutical composition or a food composition.

The fermented burdock root extract, arctin, arctigenin, etc. according to the present invention can be used as a pharmaceutical material constituting a pharmaceutical composition or a functional food composition. In particular, the arctin and arctigenin according to the present invention activates AMP-activated protein kinase (AMPK) and down-regulates the expression of the lipogenesis-related gene, And the effect of suppressing the accumulation of neutrino quality is excellent. Therefore, the fermented burdock extract according to the present invention, arctiin, arctigenin and the like can prevent or improve diseases such as obesity, fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular diseases, arteriosclerosis and lipid-related metabolic syndrome Or < / RTI >

Figure 1 shows the chemical structure of actin.
Figure 2 shows the chemical structure of arctigenin.
FIG. 3 is a schematic diagram showing a process of separating actin from a right-handed person.
FIG. 4 shows the results of measuring the expression level of p-AMPK protein in liver tissues by Western blot analysis to examine the effects of actin on obesity-induced model animals in a high fat diet, Lt; RTI ID = 0.0 > protein. ≪ / RTI > FIG. 5 is a graph showing the effect of actin on obesity-induced model animals in high-fat diets by Western blot analysis of the levels of p-ACC protein expression in liver tissues, Lt; RTI ID = 0.0 > protein. ≪ / RTI >
FIG. 6 shows the results of Western blot analysis of the expression level of PPARγ protein in epididymal adipose tissue to examine the effects of actin on obesity-induced model animals in high-fat diets. In order to investigate the effect of actin on obesity-induced model animals, the level of C / EBPα protein expression in epididymal adipose tissue was measured by Western blot analysis. FIG. 8 shows the results of measurement of obesity In order to investigate the effect of actin on the induced model animals, the expression level of FAS protein in epididymal adipose tissue was measured by Western blot analysis.
FIG. 9 is an oil red O staining image showing the effect of differentiation pattern of actin upon induction of differentiation of 3T3-L1 preadipocytes into adipocytes, and FIG. 10 is a graph quantitatively showing the oil red O staining result of FIG. 9 .
FIG. 11 is a graph showing the effect of actin on the triglyceride content in differentiated adipocytes upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes.
FIG. 12 is a graph showing quantitative results of Western blot analysis of the effect of actin treatment on PPARγ protein level in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. FIG. 13 is a graph showing quantitative results of Western blot analysis of the effect of actin treatment on the level of C / EBPα protein in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. 14 is a graph showing quantitative results of measurement of the effect of actin treatment on the level of FAS protein in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes by Western blot analysis.
FIG. 15 is a graph showing the effect of actin treatment on the mRNA level of PPARγ in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. 16 is a graph showing the effect of 3T3-L1 precursor adipocytes on adipocyte differentiation 17 is a graph showing the effect of actin treatment on the mRNA level of FAS when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes, FIG. 18 is a graph showing the effect of 3T3- FIG. 19 is a graph showing the effect of actin treatment on the mRNA level of SREBP-1c in inducing the differentiation of L1 precursor adipocytes into adipocytes. FIG. 19 is a graph showing the effect of actin treatment on the mRNA level of FABP4 FIG. 20 is a graph showing the effect of actin treatment on the level of Leptin mRNA in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes.

Hereinafter, terms used in the present invention will be described.

As used herein, the terms "pharmaceutically acceptable" and "pharmaceutically acceptable" are intended to mean not significantly irritating the organism and not interfering with the biological activity and properties of the administered active substance.

As used herein, the term "prophylactic " means any act that inhibits the symptoms of, or delays the progression of, a particular disease (e.g., colitis) upon administration of the composition of the present invention.

As used herein, the term "treatment" refers to any act that improves or alleviates the symptoms of a particular disease (e.g., colitis) upon administration of the composition of the present invention.

The term "improvement" as used in the present invention means all actions that at least reduce the degree of symptom associated with the condition being treated.

The term "administering" as used herein is meant to provide any desired composition of the invention to an individual by any suitable method. The term " individual " means any animal such as a human, a monkey, a dog, a goat, a pig, or a mouse having a disease in which symptoms of a specific disease can be improved by administering the composition of the present invention.

The term " pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease at a reasonable benefit or risk rate applicable to medical treatment, including the type of disease, severity, activity of the drug, The time of administration, the route and rate of excretion of the drug, the duration of the treatment, factors including drugs used simultaneously and other factors well known in the medical arts.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention relates to a novel use of fermented burdock root extract. The present invention provides a composition for preventing, ameliorating or treating an obesity or obesity related disease comprising fermented burdock root extract as an active ingredient.

The fermented burdock root extract of the present invention can be prepared by various methods. For example, there is a method in which an extract is obtained from a product obtained by fermenting burdock with a lactic acid bacterium, or a method in which a burdock extract is fermented with a lactic acid bacterium. At this time, the type of lactic acid bacteria that can be used is not limited so far as it enhances the anti-obesity activity of burdock, for example, Leuconostoc mesenteroides , Lactobacillus < RTI ID = 0.0 > mesenteroides , Lactobacillus < RTI ID = 0.0 > rhamnosus , Lactobacillus brevis , Lactobacillus < RTI ID = 0.0 > acidophilus , Lactobacillus < RTI ID = 0.0 > lactis , Lactobacillus bulgaricus , Lactobacillus < RTI ID = 0.0 > casei), Lactobacillus del Brewer ekki (Lactobacillus delbrueckii , Lactobacillus plantarum , Lactobacillus < RTI ID = 0.0 > sakei ), Bifidobacterium longum), Bifidobacterium Annie Marlies (Bifidobacterium animalis), Bifidobacterium Bifidobacterium bonus (Bifidobacterium bifidum), Lactococcus lactis diacetyl (Lactococcus diacetylactis), Lactococcus lactis Cocos (Lactococcus lactis , and the like, among which Lactobacillus plantarum is preferred. In order to obtain the fermented burdock root extract of the present invention, various organs or parts of burdock such as leaves, flowers, roots, stems, rootstocks, fruits, seeds and the like can be used as raw materials. A seed of burdock or a fruit of burdock) is preferably used. Meanwhile, in order to obtain the fermented burdock root extract from burdock, an extraction process is required. As the extraction method, a conventional extraction method known in the art can be used, for example, a solvent extraction method. The extraction solvent that can be used in preparing the fermented burdock root extract by the solvent extraction method includes water, a lower alcohol having 1 to 4 carbon atoms (for example, methanol, ethanol, propanol and butanol) or a mixture thereof, Propylene glycol, 1,3-butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane and mixtures thereof, Is preferred. When water is used as the extraction solvent, the water is preferably hot water. When an alcohol is used as an extraction solvent, the alcohol is preferably a lower alcohol having 1 to 4 carbon atoms, and the lower alcohol is more preferably selected from methanol or ethanol. In addition, when the functional alcohol is used as the extraction solvent, the alcohol content is preferably 50 to 90%. It is obvious to those skilled in the art that fermented burdock root extracts can be obtained not only by using the above-mentioned extraction solvent but also by using other extraction solvents, which exhibit substantially the same effect. For example, decompression by carbon dioxide, extraction by supercritical extraction with high temperature, extraction by extraction using ultrasound, separation by ultrafiltration membrane with constant molecular weight cutoff value, various chromatography (size, charge, hydrophobic or affinity The active fraction obtained through various purification and extraction methods, such as separation using the above-described method for separation according to sex, is also included in the extract of the present invention. The supercritical fluid extraction refers to supercritical fluid extraction. Generally, the supercritical fluid is extracted from the liquid and the liquid when the gas reaches the critical point at high temperature and high pressure. (J. Chromatogr. A. 1998; 479: 200-205). In addition, it has been reported that the supercritical fluid has a polarity similar to that of a nonpolar solvent. Carbon dioxide is a supercritical fluid with both liquid and gaseous nature, with the operation of supercritical fluid equipment reaching its critical pressure and temperature, resulting in increased solubility in fat-soluble solutes. When supercritical carbon dioxide passes through an extraction vessel containing a certain amount of sample, the lipophilic substance contained in the sample is extracted into supercritical carbon dioxide. When the supernatant carbon dioxide containing a small amount of cosolvent is passed through the sample remaining in the extraction vessel after extracting the lipid-soluble substance, components that were not extracted by pure supercritical carbon dioxide can be extracted. The supercritical fluid used in the supercritical extraction method of the present invention can effectively extract an active ingredient by using a mixed fluid in which a cosolvent is further mixed with supercritical carbon dioxide or carbon dioxide. These co-solvents may be used alone or in admixture of two or more selected from the group consisting of chloroform, ethanol, methanol, water, ethyl acetate, hexane and diethyl ether. Most of the extracted samples contain carbon dioxide. Since the carbon dioxide is volatilized into air at room temperature, the extract obtained by the above method can be used as a cosmetic composition, and the cosolvent can be removed by a reduced pressure evaporator. In addition, the ultrasonic extraction method is an extraction method using energy generated by ultrasonic vibration. Ultrasonic waves can destroy an insoluble solvent contained in a sample in a water-soluble solvent. Due to the high local temperature, Since the kinetic energy of the reactant particles is increased, sufficient energy required for the reaction is obtained. By inducing the high pressure by the shock effect of the ultrasonic energy, the mixing effect of the substance contained in the sample and the solvent is enhanced, thereby increasing the extraction efficiency. As the extraction solvent which can be used for the ultrasonic extraction method, one or a mixture of two or more selected from the group consisting of chloroform, ethanol, methanol, water, ethyl acetate, hexane and diethyl ether can be used. The extracted sample is recovered by vacuum filtration, and the filtrate is recovered, and the extract is removed by a vacuum evaporator and freeze-dried to obtain an extract.

The fermented Burdock Extract according to the present invention includes a variety of active substances including, for example, arctin or arctigenin. However, the active ingredient of the fermented burdock root extract may have a slight difference in kind or content depending on the extraction method.

The fermented burdock root extract according to the present invention can be used as an active ingredient for preventing, ameliorating or treating obesity or obesity-related diseases. The above-mentioned obesity-related diseases are not limited in their kind if they are caused by obesity or are highly correlated with obesity, for example, in fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, atherosclerosis and lipid-related metabolic syndrome Lt; / RTI > In addition, the lipid-related metabolic syndrome refers to a disease in which various metabolic diseases such as diabetes and obesity occur simultaneously in one person.

The composition comprising the fermented burdock root extract of the present invention as an active ingredient may be formulated into a pharmaceutical composition, a food additive, a food composition (in particular, a functional food composition), a feed additive or the like depending on the purpose or the manner of use, The content of the extract can also be adjusted in various ranges depending on the specific form of the composition, the purpose of use, and the manner of use.

Another aspect of the present invention relates to new uses, such as arctin, wherein the present invention relates to the use of a compound selected from the group consisting of arctin, arctigenin, and pharmaceutically or pharmacologically acceptable salts thereof, A composition for preventing, ameliorating or treating obesity or an obesity-related disease comprising at least one species as an active ingredient.

Actin is a glycoside containing actigenein as an aglycone and has the chemical structure shown in Fig. On the other hand, actigenein has the chemical structure of Fig. 2 and is known to dominate the physiological activity of actin. For this reason, actin and actinine have been reported to have the same functionality as skin whitening, anti-cancer, antimicrobial, antiviral etc. (see Korean Patent Publication No. 10-0855457, Korean Patent Publication No. 10-2012-0026588) . Thus, it will be apparent that those skilled in the art will be able to anticipate the anti-obesity activity of actigene from the anti-obesity activity of actin. Both actin and actinin are ligand compounds, including burdock root, arctii fructus ), safflower ( Carthamus tinctorius , Forsythia suspensa , etc., can be chemically synthesized, and are also commercially available. In view of easiness of separation and yield, it is preferable that the arctin or arctigenin is separated from the recipient. An example of separating actin from a stranger is shown in Fig.

As pharmacologically or pharmaceutically acceptable salts in the present invention, acid addition salts formed by free acids are useful. The acid addition salt is prepared by a conventional method, for example, by dissolving the compound in an excess amount of an acid aqueous solution, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. The same molar amount of the compound and the acid or alcohol (e.g., glycol monomethyl ether) in water may be heated and then the mixture may be evaporated to dryness, or the precipitated salt may be subjected to suction filtration. As the free acid, an organic acid and an inorganic acid can be used. As the inorganic acid, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid and the like can be used. Examples of the organic acid include methanesulfonic acid, p- toluenesulfonic acid, acetic acid, (Meth) acrylic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, lactic acid, glycollic acid, gluconic acid, Glucuronic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid and the like can be used. In addition, pharmaceutically or pharmaceutically acceptable metal salts can be prepared using bases. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. As the metal salt, it is particularly preferable to produce sodium, potassium or calcium salt, and the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The arctin, arctigenin or pharmaceutically or pharmacologically acceptable salt thereof of the present invention can be used for the prophylactic or therapeutic treatment of diseases caused by phosphorylation of AMP-activated protein kinase (AMPK) or phosphorylation of ACC (acetyl-CoA carboxylase) Or lipid metabolism. ≪ / RTI > AMPK (AMP-activated protein kinase) has recently been attracting attention as a new target for the development of anti-obesity substances. AMPK is a protein that is activated by sensing intracellular AMP (Adenosine Mono-Phosphate), which inhibits the signal transduction pathway that consumes ATP, while protecting the cell from external stress by activating the signal transduction pathway that synthesizes ATP. The substances that increase the activity of AMPK have been reported to have the effects of promotion of ATP (Adenosine Tri-Phosphate) synthesis, increase of glucose uptake, promotion of? -Oxidation of fat, inhibition of cholesterol synthesis, Is used as a drug target for the development of a therapeutic agent for metabolic diseases such as diabetes, insulin resistance, hyperlipidemia, and inflammation. AMPK is a phosphorylation enzyme that plays a role in the detection of intracellular ATP concentration. It is an important enzyme for maintaining energy balance in cells. It is mostly increased by intracellular biosynthesis (ATP consumption process) or increased by rapid ATP consumption It is known that ATP: activation by ATP ratio induces ATP production process. Activated AMPK is known to phosphorylate substrates in several sub-stages, thereby blocking ATP-consuming pathways such as lipid synthesis and cholesterol synthesis, and activating the ATP-producing pathway, such as fatty acid oxidation or sugar degradation (DG Hardie et al. , An important regulator of AMPK in association with lipid metabolism, has been shown to be able to catalyze the conversion of acetyl-CoA carboxyl Acetyl-CoA carboxylase (ACC) inhibits the activity of enzymes. ACC is an important enzyme that regulates lipid metabolism in various tissues such as liver and muscle. It acts as a carbonylating agent for acetyl-CoA to malonyl-CoA (BE Kemp, Biochem. Soc. Trans., 31, pp162-168, 2003) Malonyl-CoA acts as an inhibitor of CPT1 (carnitine palmitoyl transferase 1) present in the outer membrane of mitochondria, and this CPT1 activity plays an important role in the? -Oxidation of fat in mitochondria (Lehninger, Principles of Biochemistry, Cohen P., Miyazaki, M., Socci, ND, Hagge-Greenberg, A., Liedtke, W., Soukas, AA, Sharma, R., Hudgins, Worth Publishers, NY, 3rd Ed., 2000 , LC, Ntambi, JM & Friedman, JM, Science 297, 240-243, 2002). When the activation of AMPK promotes phosphorylation of ACC and inhibits the activity of the enzyme, the amount of malonyl-CoA is reduced and activation of AMPK is induced (Vavvas D et al., J. Biol. Chem., 272, pp13255- 13261, 1997). ATP production is increased by the oxidation of fatty acids. In other words, phosphorylation of ACC by activation of AMPK is important for decreasing body fat by mechanism of fatty acid oxidation. Therefore, when ACC enzyme activity is regulated by AMPK at the early stage of fatty acid synthesis, it is possible to inhibit the accumulation of fat in the body more than necessary, and consequently, weight gain can be suppressed. Furthermore, activation of AMPK also inhibits the activity of HMG-CoA reductase (the target molecule of statin, a therapeutic agent for hyperlipidemia), which implies that the synthesis of cholesterol can also be regulated by liver tissue by activating AMPK, And the effect of lowering the concentration of cholesterol can also be obtained. Therefore, when AMPK is activated, the synthesis of fat is reduced and β-oxidation is increased, and oxidation of body fat is increased, thereby reducing weight loss due to body fat reduction as well as blood triglyceride and cholesterol concentrations.

Also, the arctin, arctigenin or pharmaceutically acceptable or pharmacologically acceptable salt thereof of the present invention is useful as a prophylactic or therapeutic agent for PPARγ, C / (FAS), leptin (FABP4), and leptin (Leptin), as well as a number of other proteins, such as leukemia, leukemia, leukemia, The down-regulation of expression may inhibit differentiation or inhibit accumulation of neutrophils. Accordingly, the arctin, arctigenin or pharmaceutically acceptable or pharmacologically acceptable salt thereof of the present invention can be used as an active ingredient for preventing, ameliorating or treating obesity, and further, Related diseases selected from the group consisting of diabetes, hyperlipidemia, cardiovascular disease, atherosclerosis and lipid-related metabolic syndrome. The lipid-related metabolic syndrome refers to a disease in which various metabolic diseases such as diabetes and obesity occur simultaneously in one person.

The composition of the present invention comprising arctin, arctigenin or a pharmaceutically or pharmacologically acceptable salt thereof as an active ingredient can be used as a pharmaceutical composition, a food additive, a food composition Food composition), or feed additive, and the content of the active ingredient in the composition may be adjusted in various ranges depending on the specific form of the composition, the purpose of use, or the manner of use.

The content of the active ingredient in the pharmaceutical composition containing the pharmaceutically acceptable salt of the fermented burdock extract according to the present invention, arctiin, arctigenin, actin or actigenein as an active ingredient is not particularly limited, For example, from 0.01 to 99% by weight, preferably from 0.5 to 50% by weight, more preferably from 1 to 30% by weight, based on the total weight of the composition. In addition, the pharmaceutical composition according to the present invention may contain, in addition to a pharmaceutically acceptable salt of a fermented burdock extract, arctiin, arctigenin, actin or actinogen, an additive such as a pharmaceutically acceptable carrier, excipient or diluent . Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate , Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition for preventing or treating obesity or obesity-related diseases of the present invention is useful as a pharmaceutical composition for preventing or treating obesity or obesity related diseases in addition to a pharmaceutically acceptable salt of fermented burdock extract, arctiin, arctigenin, actin or actigenine Of the present invention may contain one or more known active ingredients having a preventive or therapeutic effect. The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or parenteral administration by a conventional method, and can be formulated into a pharmaceutical composition such as a filler, an extender, a binder, a wetting agent, a disintegrant, Diluents or excipients. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose ), Lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention may be administered orally or parenterally to a mammal including a human according to a desired method. Examples of the parenteral administration method include external dermal application, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravenous injection, Intravenous injection or intra-thoracic injection. The dosage of the pharmaceutical composition of the present invention is not limited as long as it is a pharmacologically effective amount and is not limited as long as it depends on the body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, Varies. The typical daily dose of the pharmaceutical composition of the present invention is not particularly limited, but is preferably selected from a pharmaceutically acceptable salt of fermented Burdock extract, arctiin, arctigenin, actin or actinin, Kg, and more preferably 1 to 1000 mg / kg, and may be administered once or several times a day.

In addition, the food composition comprising the fermented burdock extract of the present invention, arctin, arctigenin, actin or actinine as the active ingredient can be used as a parenteral, powder, granule, Examples of the specific food include meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, drinks , Tea, functional water, a drink, an alcoholic beverage, and a vitamin complex, and includes all health foods in a conventional sense. In the food composition of the present invention, the content of active ingredients such as fermented burdock extract, arctiin, arctigenin, actin or a pharmaceutically acceptable salt of actinine is 0.01 to 50% by weight, By weight, preferably 0.1 to 25% by weight, more preferably 0.5 to 10% by weight. The food composition of the present invention may contain, as an additional ingredient, various flavors or natural carbohydrates in addition to fermented burdock extract, arctin, arctigenin, actin or a pharmaceutically acceptable salt of actinogen. In addition, the food composition of the present invention can be used as a food composition containing various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, , A carbonating agent used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The above-mentioned natural carbohydrates are sugar alcohols such as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and xylitol, sorbitol and erythritol. Natural flavors such as tau Martin and stevia extract, and synthetic flavors such as saccharin and aspartame may be used as the flavor.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Preparation of Burdock Extract, Fermented Burdock Extract and Compounds Isolated from It

Preparation Example 1: Preparation of burdock extract

30 kg of 80% ethanol aqueous solution was added to 3 kg of dried burdock roots pulverized product, and the mixture was extracted by reflux cooling at 90 캜 for about 4 hours, and then filtered with a filter paper to separate the extract and the residue. Then, 30 liters of an aqueous 80% ethanol solution was added to the remaining residue, and extracted with the same method to obtain an extract. The extract was combined with the extract obtained previously and concentrated under reduced pressure to obtain about 990 g of burdock root extract.

Production Example 2: Preparation of Fermented Burdock Extract

Lactobacillus plantarum (Lactobacillus plantarum), which has been distributed from the Korea Microorganism Conservation Center (5th floor, Tryptic Soy Broth) on the liquid TSB medium (Tryptic Soy Broth)Lactobacillus plantarum) KCCM 11322 and incubated for about 24 hours. Thereafter, the Lactobacillus planta (Lactobacillus plantarum) The KCCM 11322 culture was centrifuged to remove the medium and cells were obtained. Thereafter, 500 g of the pulverized dried burdock root was suspended in 5 L of water, and the cells were inoculated thereto, followed by culturing for about 72 hours to produce a burdock fermented product. Then, 5 liters of ethanol was added to the fermented milk burdock product, and the mixture was extracted with reflux cooling at 90 ° C for about 2 hours, and then filtered through a filter paper to separate the fermented burdock extract and residue. Then, 2 liters of 50% ethanol aqueous solution was added to the remaining residue, and the mixture was extracted with a reflux cooling method at 90 ° C for 1 hour to obtain an extract. The extract was combined with the extract obtained previously and concentrated under reduced pressure to obtain about 82.1 g of fermented burdock extract .

Production Example 3: Preparation of arctin from a stranger

Arctii 5.4 kg of fructus was added to 5.4 L of n-hexane, shaken and left to stand, and then n-hexane was removed to be degreased. 50 ℓ of 80% ethanol aqueous solution was added to the defatted stratum corneum and extracted with reflux cooling method at 90 ° C for about 3 hours, and then filtered with a filter paper to separate the extract and the residue. Then, the remaining residue was repeatedly extracted three times in the same manner to obtain an extract. The extract was combined with the extract obtained first, and then concentrated under reduced pressure to obtain about 533 g of the extract of Ganoderma lucidum. Thereafter, the extract of Wisteriae was suspended in 1 L of distilled water, 5 L of ethyl acetate was added thereto, and the mixture was shaken and left to separate into a water-soluble fraction layer and an ethyl acetate soluble fraction layer. Then, the ethyl acetate soluble fraction was taken and concentrated under reduced pressure to obtain about 280.61 g of the ethyl acetate soluble fraction. Then, the ethyl acetate-soluble fraction of the fragrant extract was subjected to silica gel column chromatography (Merck, 7 cm x 40 cm, 70 to 230 mesh) with an elution solvent (chloroform: methanol = 10: 1) to obtain five small fractions . The third small fraction (Fr. III) of the five small fractions was recrystallized from methanol to obtain 9.62 g of Compound 1 (Compound 1; 98% or more in purity) in the form of a white needle crystal. The structure of Compound 1 was analyzed by ¹ H-NMR (Bruker, AVANCE digital 400) and ¹³ C-NMR (Bruker, AVANCE digital 400), and it was confirmed to be arctin with the chemical structure of FIG.

<Actin>

^{1 H-NMR (600 ㎒,} C 27 H 34 O 11) δ: 6.91 d (15.44), 6.73 d (16.50), 6.61 s, 6.58 d (19.37), 6.54 d (4.74), 6.49 d (10.40), 3.81 s , 3.68 s , 2.83 t (33.47, 26.12), 2.83 s , 2.64 dd (10.91, 19.06), 4.81 d (31.84), 4.10 t (9.58, 9.08), 3.56-3.85 m , 3.84 m , 3.81 s , 2.55 m , 2.55 m , 2.45 m

¹³ C-NMR (150 MHz, C ₂₇ H ₃₄ O ₁₁ )?: 178.5, 149.3, 149.1, 147.9, 144.9, 132.9, 122.1, 120.9, 117.1, 113.2, 112.2, 111.7, 101.8, 76.1, , 71.2, 61.4, 55.9, 55.8, 55.8, 46.4, 41.2, 38.1, 34.4

2. Burdock extract Anti-obesity  About efficacy in - vivo  Experiment

(1) Experimental method

Twenty four male C57BL / 6J mice were infected with chow diet (CD; Purina, Korea) for 1 week at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. Then, the experimental animals were divided into two groups, and the normal diets (CON, n = 6) were fed with 10% of the total calories for 7 weeks and the high fat diet group (n = 18) (D12492, Research Diets, New Brunswick, NJ) were fed for 7 weeks to induce obesity. Thereafter, high fat diets induced by obesity were divided into three groups (HF, HF + LAE, and HF + HAE) by 6 animals. The HF group was fed with high fat diets and the distilled water was administered orally for 8 weeks. Group and the HF + HAE group were fed with a high fat diet and the Burdock Extract obtained in Preparation Example 1 was dissolved in distilled water and orally administered in different amounts for 8 weeks. In addition, the normal dietary group was fed a general diet and the distilled water was orally administered for 8 weeks.

(2) Measurement items and measurement results

The body weights of the experimental animals were measured at a constant time every day during the whole experimental period, and the results are shown in Table 1 below.

Experimental group Burdock extract dose
(g / kg BW) Initial weight (g) Final weight (g) Weight gain (g) Weight gain (%) CON 0 26.1 ± 0.5 31.0 ± 0.9 4.9 ± 0.5 18.7 ± 1.7 HF 0 26.9 ± 0.3 38.4 ± 1.2 11.5 ± 1.1 42.7 ± 3.6 HF + LAE One 26.8 ± 0.3 37.0 ± 1.5 10.2 ± 1.5 37.7 ± 5.5 HF + HAE 2.5 26.8 ± 0.4 38.9 ± 0.7 12.1 ± 0.6 45.1 ± 2.5

* CON: general dietary supplement group

* HF: high fat diet group

* HF + LAE: high fat dietary supplement and 1 g / kg body weight dose of burdock extract

* HF + HAE: high fat dietary supplement and 2.5 g / kg body weight burdock extract administered group

As shown in Table 1, the weight of the high fat diet group was significantly increased after 8 weeks of induction of obesity than that of the normal diet group. However, there was no significant difference in the weight gain or body weight gain between the group administered with the high fat diet and the group administered orally with the burdock extract and the group fed only with the high fat diet.

3. Fermented Burdock Extract Anti-obesity  About efficacy in - vivo  Experiment

(1) Experimental method

A total of 18 C57BL / 6J male mice were weighed on a chow diet (CD; Purina, Korea) for 20 days at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. After dividing the experimental animals into three groups (HF, HF + 1 AE, and HF + 5 AE) by 6 animals, the HF group was fed a high fat diet (D12492, Research Diets, New Brunswick, NJ ), And the fermented Burdock extract obtained in Production Example 2 was fed with different amounts for 3 weeks together with the high fat diet in the HF + 1 AE and HF + 5 AE groups.

(2) Measurement items and measurement results

The body weight of the experimental animals was measured at a constant time every day for the whole experimental period, and the results are shown in Table 2 below.

Experimental group Initial weight (g) Final weight (g) Weight gain (g) Weight gain (%) HF 23.7 ± 0.4 28.5 ± 0.4 4.8 ± 0.4 20.3 ± 1.6 HF + 1 AE 24.2 ± 0.3 27.2 ± 0.4 3.0 ± 0.6 12.7 ± 0.6 HF + 5 AE 23.8 ± 0.3 26.9 ± 0.2 3.1 ± 0.5 13.2 ± 2.1

* HF: high fat diet group

* HF + 1 AE: High fat dietary supplement containing 1% fermented burdock extract

* HF + 5 AE: High fat dietary supplement containing 5% fermented burdock extract

As shown in Table 2, the group fed with fermented burdock extract together with the high fat diet showed lower weight gain and weight gain than the group fed only high fat diet, and fermented burdock extract had anti-obesity effect Able to know.

4. Of arctin Anti-obesity  About efficacy in - vivo  Experiment

(1) Experimental method

A total of 18 C57BL / 6J male mice were weighed on a chow diet (CD; Purina, Korea) for 20 days at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. Then, the experimental animals were divided into two groups and the general diet (10% of the total calories) was fed for 11 weeks in the normal diet group (CON, n = 6) and in the high fat diet group (D12492, Research Diets, New Brunswick, NJ) were fed for 11 weeks to induce obesity. Thereafter, high fat diets induced by obesity were divided into two groups (HF, HF + AC) by 6 animals, and then high fat diets were fed to the HF group and distilled water was orally administered for 3 weeks. In the HF + AC group, And the actin obtained in Production Example 3 was dissolved in distilled water and orally administered for 3 weeks. In the normal diet group, the normal diet was fed and the distilled water was orally administered for 3 weeks.

(2) Methods and measurement results of body weight, dietary intake and diet efficiency

Body weights and dietary intakes of the animals were measured at a constant time every day throughout the experiment. The feed efficiency ratio (FER) was calculated by dividing the weight gain during the same period by the dietary intake over the same period. Table 3 shows the results of measurement of body weight, dietary intake and dietary efficiency according to the experimental group.

Experimental group CON HF HF + AC Initial weight (g) 19.0 ± 0.8 19.5 ± 0.9 19.0 ± 0.4 Weight after induction of obesity (g) 27.7 ± 1.2 36.1 ± 0.9 35.8 ± 1.1 Final weight (g) 29.6 ± 1.4 40.6 ± 0.9 36.3 ± 1.1 Weight gain (g) 1.9 ± 1.7 4.1 ± 0.5 0.5 ± 1.0 Weight gain (%) 7.2 ± 6.6 11.4 ± 1.5 1.7 ± 2.8 Dietary intake (g) 3.2 ± 0.1 2.4 ± 0.1 2.7 ± 0.3 Dietary efficiency 0.03 0.03 0.05 ± 0.01 0.01 ± 0.01

* CON: general dietary supplement group

* HF: high fat diet group

* HF + AC: high fat diet and arctin (500 mg / kg body weight)

As shown in Table 3, in the group to which arctin was orally administered together with the high fat diet after induction of obesity, there was no significant difference in the dietary intake compared to the group fed only with high fat diet after induction of obesity, Weight gain and diet efficiency were very low. From this, it can be seen that actin has an excellent anti-obesity effect.

(3) Measurement method and measurement result of lipid metabolism related signal change

(AMP-activated protein kinase) and p-ACC (AMP-activated protein kinase) in experimental liver tissues were investigated in order to investigate the effect of high fat dietary supplementation and actin administration on the activation and related signal changes of AMPK (Phosphorylated Acetyl-CoA carboxylase) levels were measured by Western blot analysis. Effects of high fat diet and actin on the activation and related signal changes of PPARγ, C / EBPα, and FAS (fatty acid synthase) (Peroxisome proliferator-activated receptor), C / EBP alpha (CCAAT-enhancer-binding protein alpha) and FAS (fatty acid synthase) levels of the epididymis adipose tissue of the experimental animals were analyzed by Western blot analysis Respectively.

Each tissue was incubated with RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 0.25% Na-NaCl) supplemented with protease inhibitor (Roche, USA), phosphatase inhibitor (Roche) and phenylmethanesulfonylfluoride deoxycholate, 150 mM NaCl, 1 mM EDTA), and centrifuged at 14,000 rpm for 15 minutes to obtain supernatant. Proteins were separated from the supernatant by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The separated protein samples were transferred to a PVDF membrane (Millipore, USA). After the sample was transferred, PVDF membrane was blocked with 5% skim milk (Difco, France) for 1 hour and 30 minutes in TBS-T buffer. The PPARγ (peroxisome proliferator-activated receptor-γ), C / EBPα AMP-activated protein kinase (AMPK), p-ACC (phospho-acetyl-CoA carboxylase), ACC (fatty acid synthase), p-AMPK (primary antibody) or β-actin primary antibody (Santa Cruz biotechnology, USA) to acetyl-CoA carboxylase and shaking The reaction was allowed to proceed overnight. After washing with TBS-T buffer, secondary antibody was diluted at a ratio of 1: 5000 and reacted for 1 hour and 30 minutes. We used goat anti-rabbit IgG (H + L) -HRP conjugate (BIORAD) as a secondary antibody to detect PPARγ, C / EBPα, FAS, p-AMPK, AMPK, p-ACC and ACC. In addition, goat anti-mouse IgG (H + L) -HRP conjugate (BIORAD) was used as a secondary antibody to detect β-actin. After washing with TBS-T buffer and reacting with ECL solution (Clarity western ECL substrate, BIORAD), proteins were detected by chemiluminescence (CLINX science instruments, USA). The density of each band was quantitated, and the level of expression of each protein was normalized to β-actin. The amount of protein expression in the other experimental groups was calculated on the basis of the protein expression level of the normal diet group.

FIG. 4 shows the results of measuring the expression level of p-AMPK protein in liver tissues by Western blot analysis to examine the effects of actin on obesity-induced model animals in a high fat diet, Lt; RTI ID = 0.0 &gt; protein. &Lt; / RTI &gt; FIG. 5 is a graph showing the effect of actin on obesity-induced model animals in high-fat diets by Western blot analysis of the levels of p-ACC protein expression in liver tissues, Lt; RTI ID = 0.0 &gt; protein. &Lt; / RTI &gt;Quot; HF + AC "or" AC "represents a high fat dietary supplement and 500 mg / kg And the body weight of arctin. As shown in FIGS. 4 to 5, actin regenerated phosphorylation of AMPK lowered by the high-fat diet and phosphorylation of its downstream target, ACC, to near normal levels again.

FIG. 6 shows the results of Western blot analysis of the expression level of PPARγ protein in epididymal adipose tissue to examine the effects of actin on obesity-induced model animals in high-fat diets. In order to investigate the effect of actin on obesity-induced model animals, the level of C / EBPα protein expression in epididymal adipose tissue was measured by Western blot analysis. FIG. 8 shows the results of measurement of obesity In order to investigate the effect of actin on the induced model animals, the expression level of FAS protein in epididymal adipose tissue was measured by Western blot analysis. 6 to 8, "CON" represents a group of normal diets supplemented with a general diet, "HF" represents a high fat dietary group, "HF + AC" represents high fat dietary diets and Actin (arctin) group. As shown in FIGS. 6 to 8, PPARγ, C / EBPα and FAS protein levels were lower in the group fed with high fat diets and actin than those fed only with high fat diets.

5. Of arctin Anti-obesity  About efficacy in - vitro  Experiment

(1) Experimental method

3T3-L1 precursor adipocytes were purchased from Korean Cell Line Bank and used for the experiment. 3T3-L1 progenitor adipocytes are widely used to study the metabolic processes of adipocytes. As the differentiation of these cells becomes more active, the accumulation of adipocytes in the adipocytes leads to obesity. Therefore, when a substance expected to have an anti-obesity effect is treated on the cell, the smaller the differentiation of the cell, the greater the anti-obesity effect.

3T3-L1 mouse precursor adipocytes were seeded at a density of 2 × 10 ⁴ / ml in a 12-well plate and cultured at 37 ° C and 5% CO ₂ . In this case, 3T3-L1 complete media [DMEM / high glucose (Thermo scientific, USA), newborn calf serum (Thermo scientific), 1% penicillin-streptomycin solution (Thermo scientific)] was used until 100% Respectively. At the 100% confluency point, they were maintained for another 2 days. After 2 days of incubation with MDI media (DMEM / high glucose, 10% fetal bovine serum, 1% penicillin-streptomycin solution, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethazone, 5 μg / (1% penicillin-streptomycin solution, 5 ㎍ / ㎖ insulin) was added 2 days after the induction of differentiation. Lt; / RTI &gt; After that, the cells were replaced with growth medium (DMEM / high glucose, 10% fetal bovine serum, 1% penicillin-streptomycin solution) every 2 days for 4 days to complete differentiation into adipocytes. On the other hand, actin was treated at the concentration of 6.25, 12.5, 25, 50, and 100 uM for 8 days every 2 days from the day when differentiation of 3T3-L1 precursor adipocytes into adipocytes was induced, And the degree of differentiation into adipocytes was observed. At this time, actin was dissolved in dimethylsulfoxide to prepare 100 mM stock, which was diluted to each concentration.

(2) Oil red O dyeing and analysis

To confirm the accumulation of fat after induction of differentiation into the fat cells of pre - adipocytes, pre - adipocytes and adipocytes obtained by differentiating them for 8 days were subjected to oil red O staining. The degree of differentiation of adipocytes into adipocytes was firstly confirmed by microscopy through Oil Red O staining and the amount of fat accumulation was quantitatively determined by measuring the absorbance at 520 nm using a spectrophotometer.

FIG. 9 is an oil red O staining image showing the effect of differentiation pattern of actin upon induction of differentiation of 3T3-L1 preadipocytes into adipocytes, and FIG. 10 is a graph quantitatively showing the oil red O staining result of FIG. 9 . In Fig. 10, the fat accumulation amount was relatively represented by the fat accumulation amount of fat cells obtained by differentiating the precursor adipocytes without actin treatment. As shown in FIGS. 9 to 10, actin inhibited differentiation and fat accumulation upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes in a concentration-dependent manner. In particular, when the actin concentration was 50 uM or more, Respectively.

(3) Analysis of total neutral lipid content

The amount of total neutrophils contained in precursor adipocytes and adipocytes obtained by differentiating them for 8 days was measured. On the eighth day after the induction of adipocyte differentiation, the precursor adipocyte culture medium was washed three times with PBS to remove the culture medium, and 0.5 ml of PBS-10 mM EDTA (pH 7.4) solution was added to homogenize the differentiated adipocytes. After dilution of the adipocyte homogenate, proteins were quantitated by the BCA method (Thermo scientific). Prepare a test tube treated with prehexane to have a protein concentration of 150 μg per 300 μl, add 2 ml of an isopropanol-hexane-water (80: 20: 2 v / v / v) mixed solvent, And allowed to stand at room temperature for 30 minutes. Thereafter, 500 μl of a mixed solvent of hexane-diethyl ether (1: 1 v / v) was added, stirred vigorously for 30 seconds or more, covered with foil, and allowed to stand at room temperature for 10 minutes. Then, 1 ml of distilled water was added, stirred vigorously, covered with foil, and allowed to stand at room temperature for 20 minutes. Then, about 900 μl of the supernatant was taken and transferred to a test tube which had been previously washed with hexane and dried. Thereafter, the organic solvent was volatilized in the presence of nitrogen gas, and 20 μl of isopropanol was added to the test tube and stirred to sufficiently dissolve the neutral lipid on the wall of the test tube. Then, the neutral lipid (Trigylceride) content was measured using a kit for measuring neutral lipids ((Bio Clinical System, Korea).

FIG. 11 is a graph showing the effect of actin on the triglyceride content in differentiated adipocytes upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes. As shown in FIG. 11, actin inhibited the production of neutrophil in the induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes in a concentration-dependent manner. In particular, the actin inhibitory effect was remarkably increased when the actin concentration was 50 uM or more.

(4) Analysis of lipid metabolism-related protein levels

(PPARγ), C / EBP α (CCAAT-enhancer-binding protein α) in differentiated adipocytes were examined in order to investigate the effect of actin treatment on lipid metabolism-related protein levels during differentiation of preadipocytes. And FAS (fatty acid synthase) levels were measured by Western blot analysis.

The adipocytes obtained by differentiating the adipocytes were cultured in RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP, pH 7.4) supplemented with protease inhibitor (Roche, USA), phosphatase inhibitor (Roche) and phenylmethanesulfonylfluoride -40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA) and centrifuged at 14,000 rpm for 15 minutes to obtain supernatant. Proteins were separated from the supernatant by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The separated protein samples were transferred to a PVDF membrane (Millipore, USA). After the sample was transferred, PVDF membrane was blocked with 5% skim milk (Difco, France) for 2 hours in TBS-T buffer, and then PPARγ (peroxisome proliferator-activated receptor-γ), C / EBPα (1: 500), primary antibody (FCA) or β-actin for primary antibody (Santa Cruz biotechnology, USA) to FAS (fatty acid synthase) And the reaction was allowed to proceed overnight while maintaining the shaking state. After washing with TBS-T buffer, the secondary antibody was diluted at a predetermined ratio and reacted for 2 hours. (H + L) -HRP conjugate (BIORAD) was diluted at a ratio of 1: 5000 as a secondary antibody to detect PPARγ, C / EBPα, and FAS. In addition, goat anti-mouse IgG (H + L) -HRP conjugate (BIORAD) was diluted at a ratio of 1: 1000 as a secondary antibody for detecting β-actin. After washing with TBS-T buffer and reacting with ECL solution (Clarity western ECL substrate, BIORAD), proteins were detected by chemiluminescence (CLINX science instruments, USA). The density of each sensitized band was quantitated by gel analysis V2.02 (CLINX science instruments, USA), and the band density of the adipocytes obtained by differentiating the adipocytes without actin treatment Respectively.

FIG. 12 is a graph showing quantitative results of Western blot analysis of the effect of actin treatment on PPARγ protein level in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. FIG. 13 is a graph showing quantitative results of Western blot analysis of the effect of actin treatment on the level of C / EBPα protein in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. 14 is a graph showing quantitative results of measurement of the effect of actin treatment on the level of FAS protein in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes by Western blot analysis. As shown in FIGS. 12 to 14, when differentiating precursor adipocytes into adipocytes, actin was found to decrease the levels of PPARγ, C / EBPα and FAS proteins, which are major factors controlling lipogenesis, in a concentration-dependent manner.

(5) Analysis of gene expression level related to lipid metabolism

In the differentiation stage of adipocytes from adipocytes, the expression level of C / EBPα and PPARγ increases as adipocyte differentiation progresses, and the expression level of most adipokines increases. After the differentiation of precursor adipocytes for 8 days, lipid metabolism related genes C / EBPα, PPARγ, FAS (fatty acid synthase), SREBP-1c (sterol regulatory element binding protein-1c), FABP4 Leptin mRNA levels were confirmed by real-time PCR. Specifically, 3T3-L1 precursor adipocytes were washed twice with PBS, and cell pellets were collected and RNA was isolated using Trizol. CDNA was synthesized using 1 μg of extracted RNA and PrimeScript ™ RT reagent kit (Takara, Japan). Real-time PCR was performed using SYBR® Premix EX Taq assay ™ and the primers shown in Table 4 below. GAPDH was used as a reference gene.

Target mRNA Primer direction The primer sequence (5 '- &gt; 3') GAPDH Forward CAACAGCAACTCCCACTCTTC Reverse GGTCCAGGGTTTCTTACTCCTT PPARγ
Forward CCAGAGCATGGTGCCTTCGCT Reverse CAGCAACCATTGGGTCAGCTC C / EBPα
Forward GAACAGCAACGAGTACCGGGT Reverse GCCATGGCCTTGACCAAGGAG SREBP-1c Forward CGCTACCGGTCTTCTATCATTG Reverse TTGCTTTTGTGTGCACTTCG FAS Forward GCTTTGCTGCCGTGTCCTTCT Reverse TCTAGCCCTCCCGTACACTCA FABP4 Forward TCACCTGGAAGACAGCTCCT Reverse AATCCCCATTTACGCTGATG Leptin Forward CTATGCCACCTTGGTCACCT Reverse ACCAAACCAAGCATTTTTGC

FIG. 15 is a graph showing the effect of actin treatment on the mRNA level of PPARγ in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. 16 is a graph showing the effect of 3T3-L1 precursor adipocytes on adipocyte differentiation 17 is a graph showing the effect of actin treatment on the mRNA level of FAS when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes, FIG. 18 is a graph showing the effect of 3T3- FIG. 19 is a graph showing the effect of actin treatment on the mRNA level of SREBP-1c in inducing the differentiation of L1 precursor adipocytes into adipocytes. FIG. 19 is a graph showing the effect of actin treatment on the mRNA level of FABP4 FIG. 20 is a graph showing the effect of actin treatment on the level of Leptin mRNA in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. As shown in FIGS. 15 to 20, when differentiating progenitor adipocytes into adipocytes, actin is activated by C / EBPα, PPARγ, FAS (fatty acid synthase), SREBP-1c (sterol regulatory element binding protein-1c), FABP4 acid binding protein 4) and leptin (mRNA level of FABP4 (fatty acid binding protein 4) and leptin (mRNA level of actin) was 6.25 uM , Respectively.

6. Preparation of Pharmaceutical Composition Containing Fermented Burdock Extract and the like

In the preparation of the following pharmaceutical compositions, the fermented burdock extract can be substituted with arctin or arctigenin.

<6-1> Manufacture of powder

20 mg of the fermented burdock product of Preparation Example 2

Lactose 100 mg

10 mg of talc

The above components were mixed and packed in airtight bags to prepare powders.

<6-2> Preparation of tablets

10 mg of the fermented burdock product of Preparation Example 2

Corn starch 100 mg

100 mg of milk

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

&Lt; 6-3 > Preparation of capsules

10 mg of the fermented burdock product of Preparation Example 2

3 mg of crystalline cellulose

15 mg of milk

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

&Lt; 6-4 >

10 mg of the fermented burdock product of Preparation Example 2

Lactose 150 mg

100 mg of glycerin

Xylitol 50 mg

After mixing the above components, they were prepared so as to be 4 g per one ring according to a conventional method.

<6-5> Production of granules

15 mg of the fermented burdock product of Preparation Example 2

Soybean extract 50 mg

200 mg of glucose

600 mg of starch

After mixing the above components, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in a capsule.

<6-6> Preparation of Injection

10 mg of the fermented burdock product of Preparation Example 2

Sodium metabisulphite 3.0 mg

Methyl paraben 0.8 mg

0.1 mg of propylparaben

Sterile sterilized water for injection

After mixing the above ingredients, 2 ml of the mixture was filled in an ampoule and sterilized to prepare an injection.

7. Preparation of Food Composition Containing Fermented Burdock Extract

The fermented burdock extract in the following food composition preparations can be substituted with arctin or arctigenin.

<7-1> Production of flour food

To 100 parts by weight of wheat flour, 0.5 part by weight of the fermented burdock product of Preparation Example 2 was added to wheat flour, and the mixture was used to prepare bread, cake, cookies, crackers and noodles.

<7-2> Manufacture of dairy products

To 100 parts by weight of milk were added 0.5 part by weight of the fermented burdock product of Preparation Example 2 to milk, and various dairy products such as butter and ice cream were prepared using the milk.

<7-3> Manufacturing of Sunshine

Brown rice, barley, glutinous rice, and yulmu were dried by a known method and dried, and the mixture was granulated to a powder having a particle size of 60 mesh.

Black soybeans, black sesame seeds, and perilla seeds were steamed and dried by a known method, and then they were prepared into powders having a particle size of 60 mesh by a grinder.

The grains, seeds, and fermented burdock products of Preparation Example 2 prepared above were blended in the following proportions.

(30 parts by weight of brown rice, 17 parts by weight of yulmu, 20 parts by weight of barley)

Seeds (7 parts by weight of perilla, 8 parts by weight of black beans, 7 parts by weight of black sesame seeds)

Fermented burdock root product (1 part by weight) of Preparation Example 2,

(0.5 part by weight),

(0.5 parts by weight)

<7-4> Production of health drinks

A raw material such as liquid fructose (0.5 g), oligosaccharide (4 g), sugar (2 g), salt (0.5 g) and water (77 g) and 1 g of the fermented burdock product of Preparation Example 2 were homogeneously mixed, Sterilized, and packaged in glass bottles, plastic bottles, and other small containers.

<7-5> Manufacture of vegetable juice

Vegetable juice was prepared by adding 2 g of the fermented burdock root product of Preparation Example 2 to 1,000 ml of tomato or carrot juice.

<7-6> Manufacture of fruit juice

Fruit juice was prepared by adding 1 g of the fermented burdock product of Preparation Example 2 to 1,000 ml of apple or grape juice.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Therefore, the scope of the present invention should be construed as including all embodiments falling within the scope of the appended claims.

Claims (18)

A composition comprising, as an active ingredient, a fermented burdock root extract,
The fermented burdock root extract is a product obtained by fermenting a product of fermentation of burdock with lactic acid bacteria or a burdock extract with lactic acid bacteria,
Wherein the lactic acid bacterium is Lactobacillus plantarum. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;
The pharmaceutical composition according to claim 1, wherein the burdock is selected from burdock roots or friends.
The pharmaceutical composition according to claim 1, wherein the extraction solvent of the fermented burdock root extract is water, alcohol or a mixture thereof.
delete delete A composition comprising, as an active ingredient, a fermented burdock root extract,
The fermented burdock root extract is a product obtained by fermenting a product of fermentation of burdock with lactic acid bacteria or a burdock extract with lactic acid bacteria,
Wherein the lactic acid bacterium is Lactobacillus plantarum .
7. The food composition according to claim 6, wherein the burdock is selected from burdock roots or friends.
The food composition according to claim 6, wherein the extraction solvent of the fermented burdock root extract is water, alcohol or a mixture thereof. delete delete delete delete delete delete delete delete delete delete

Images