KR20140039809A - Composition comprising soyasaponin aa for preventing or treating obesity or lipid related metabolic disease - Google Patents

Abstract

The present invention relates to a composition comprising soya saponin Aa as an active ingredient for preventing or treating obesity or lipid related metabolic diseases. The soya saponin Aa according to the present invention has an excellent effect for suppressing differentiation of preadipocytes into adipocytes compared to soya saponin Ab, suppresses lipid accumulation during the differentiation of preadipocytes into adipocytes, and down-regulates expression on transcription factors related to the differentiation of preadipocytes into adipocytes. Thus, the soya saponin Aa according to the present invention can be used to prevent or treat metabolic diseases such as obesity, fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular diseases, atherosclerosis, and lipid related metabolic syndrome.

Description

Composition comprising soyasaponin Aa for preventing or treating obesity or lipid related metabolic disease}

The present invention relates to a composition for preventing or treating obesity or lipid-related metabolic diseases, and more particularly, to a composition for preventing or treating obesity or lipid-related metabolic diseases comprising specific saponin isolated from soybean as an active ingredient.

As mankind has developed into a prosperous society, obesity has emerged as one of the serious diseases, and the World Health Organization (WHO) has declared it the object of the disease to be treated. Obesity is a metabolic disease caused by an imbalance between calorie intake and consumption and is morphologically caused by hypertrophy or hyperplasia of fat cells in the body. Obesity is not only the most common malnutrition in Western society, but the importance of treatment and prevention has been highlighted in recent years in Korea, as the frequency of obesity is rapidly increasing due to the improvement of dietary life and the westernization of lifestyle. have. Obesity is an important factor that not only psychologically diminishes individuals but also increases the risk of developing various adult diseases. Obesity is known to be directly related to the increased prevalence of various adult diseases, such as type 2 diabetes, hypertension, hyperlipidemia, and heart disease (Cell 87: 377, 1999), and the combination of obesity-related disorders together with metabolic syndrome or insulin resistance It is called syndrome (insulin resistance syndrome), and these have been found to be the cause of atherosclerosis and cardiovascular disease. It can be inferred that fat-rich fat cells mediate this phenomenon by the fact that obesity increases the incidence of various metabolic diseases and actual weight loss significantly reduces the incidence of these diseases.

In the past, adipose tissue was only thought of as an energy storage organ that stores excess energy in the form of triglyceryl (triacylglycerol) and releases it when needed, but recently, adiponectin, leptin, and resistin Various adipokines are accepted as important endocrine organs that regulate the homeostasis of energy (Trends Endocrinol Metab 13:18, 2002). Therefore, understanding of the proliferation of fat cells and the substances secreted from fat cells and their in vivo regulation mechanisms are expected to be the foundation for understanding obesity and various diseases and developing effective treatments. Studies on the regulation of adipocyte differentiation are being actively conducted, and the main mechanism is that differentiation from preadipocytes in the body is associated with increased adipocyte derivation in obese patients. The process of differentiation of pro-adipocytes into adipocytes has been studied using cells such as 3T3-L1, and several transcription factors, especially transcription factors known to be involved in localization, C / EBPs (CAAT enhancers). It is known that binding proteins, PPARs (Peroxisome Proliferator Activated receptor) and ADD / SREBPs (Adipocyte determination and differentiation dependent factor 1 / sterol response element binding proteins) are expressed over time and regulate the process (Bart A Jessen). et al., Gene, 299, pp95-100, 2002; Darlington et al., J. Biol. Chem., 273, pp30057-30060, 1998; Brun RP et al., Curr. Opin. Cell. Biol., 8 , pp826-832, 1996). Given the stimulation of hormones such as isobutylmethylxanthin, dexamethasone and insulin (MDI), C / EBP β and δ are the first, transiently expressed, to initiate differentiation into adipocytes (Reusch J. E et al., Mol Cell Biol., 20, pp 1008-1020, 2000). This continues to lead to increased expression of C / EBPa and PPARγ (James M. N. et al., J. Nutr., 130, pp 3122S-3126S, 2000). PPARγ is a particularly important transcription factor for adipocyte differentiation, and forms dimers with the retinoic acid X receptor protein (RXR), which is present in the promoters of various adipocyte genes. Binds to peroxisome proliferator response elements (Tontonoz PE et al., Genes Dev., 8, pp1224-1234, 1994; Hwang, C. S et al., Cell Dev. Biol., 13, pp873-877) . The interaction of PPARγ with C / EBP α is critical for differentiation into mature adipocytes. These transcription factors and adipocyte regulatory factors promote differentiation into adipocytes, and ap2 (adipocyte fatty acid-binding protein 2) The expression levels of fat cell specific proteins such as and fat metabolizing enzymes such as fat acid synthase (Fas) are increased. In addition, ADD1 / SREBPs play an important role in fat metabolism, but are also known to be involved in the differentiation process. Expression of ADD1 / SREBP1c in immature adipocytes is believed to contribute to the activation of PPARγ (Rosen ED et al., Annu. Rev. Cell Dev. Biol., 16, pp 145-171, 2000; Osborn TF, J. Biol Chem., 275, pp 32379-32382, 2000). Only the differentiated fat cells synthesize fatty acids and store triglycerides. Therefore, current research trends are focused on the discovery of substances that can inhibit metabolic processes related to adipocyte differentiation as a method for preventing or treating obesity and lipid-related metabolic diseases. In other words, attempts have been made to treat obesity through the regulation of fat cells based on the mechanism of the development of obesity, which aims to reduce fat synthesis by inhibiting fat synthesis or promoting fat breakdown and oxidation, and inhibiting fat cell differentiation. To reduce cell numbers, transcription factors, proteins and adipokines, known to mediate or regulate these processes, have emerged as targets for the development of new anti-obesity drugs. In fact, the adipose cell differentiation transcription factor PPAR (Peroxisome proliferator-activated receptor) family, the adipocyte secreting substances leptin and adiponectin have been the target of many new drug development.

Known obesity treatments such as Xenical (Roche Pharmaceuticals, Switzerland), Reductil (Eboth, USA), Exolise (Atopama, France), etc. Classified as inhibitors, most anti-obesity agents are appetite suppressants that suppress appetite by regulating neurotransmitters associated with the hypothalamus. However, conventional treatments have low side effects such as heart disease, respiratory disease, and neurological disease, and thus have low sustainability. Therefore, development of an improved obesity treatment agent is needed, and currently developed products have satisfactory treatment effects without side effects. Since there are few therapeutic agents, development of new obesity agents is required.

On the other hand, saponin is a glycoside compound contained in plants and has a structure in which at least one sugar molecule is bound to aglycone such as steroid or triterpenoid, and about 500 kinds of plant saponin Is known to contain. There are several kinds of saponins in soybeans. Soybean saponins, soysaponin, have a complex and diverse molecular structure based on the aglycone structure. Specifically, soy saff saponin is produced by soyasapogenol A represented by the following formula (1), soyasapogenol B represented by the following formula (2) and soyasapogenol E represented by the following formula (3) Saponin group A, soybean saponin group B, and soya saponin E group. The group A soy sa saponin is bisdesmoside saponin having a sugar chain bound to the sugar chains at two positions C-3 and C-22, and soya saponin B and soybean saponin E belong to C-3 position It is a monodesmoside saponin whose chain is bound to only one place. In addition, soybean saponin in group B was again classified as having DDMP (2,3-dihydro-2,5-dihydroxy-6-methyl-4H-pyran-4-one) attached to C- DDMP-conjugated soya saponin may be classified as soya saponin DDMP group separately from soya saponin group B.

[Chemical Formula 1]

(2)

(3)

In addition, soya saponin compounds corresponding to the group A soy saff saponin may be classified as soy saff saponin Aa, Ab, Ad, Ae, Af according to the scholars, or classified as A1 to A6. In addition, soya saponin corresponding to soya saponin of group B without DDMP is classified as soya saponin Ba, Bb, Bb ', Bc, etc., or may be classified as soya saponin I to V. Recently, Nomenclature is also expressed a little differently. Fig. 1 shows the structure of soybean saponin of group A, Fig. 2 shows soya saponin of group B, soybean saponin of group E and soya saponin of DDMP group. The soy saff saponins shown in Figs. 1 and 2 can be summarized as shown in Table 1 below.

Soya saponin group Soya saponin compound
name Soya saponin molecular structure Molecular Weight
(MW) Group A Soya saponin Aa (A4) (1 → 2) gal (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) xyl (2,3,4-tri- 1364 Soya saponin Ab (A1) glc (1 → 2) gal (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) glc (2,3,4,6-tetra- 1436 Soya saponin Ac rha (1 → 2) gal (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) glc (2,3,4,6-tetra- 1420 Soya saponin Ad glc (1 → 2) intermediate (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) glc (2,3,4,6-tetra- 1390 Soya saponin Ae (A5) gal (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) xyl (2,3,4-tri- 1202 Soya saponin Af (A2) gal (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) glc (2,3,4,6-tetra-O-acetyl) 1274 Soya saponin Ag (A6) intermediate (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 → 1) xyl (2,3,4-tri-O-acetyl) 1172 Soya saponin Ah (A3) (1 → 2) glcUA (1 → 3) -A- (22 ← 1) intermediate (3 ← 1) glc (2,3,4,6-tetra-O-acetyl) 1244 Group B Soya saponin Ba (Ⅴ) glc (1 → 2) gal (1 → 2) glcUA (1 → 3) -B 958 Soya saponin Bb (I) rha (1 → 2) gal (1 → 2) glcUA (1 → 3) -B 942 Soya saponin Bc (II) rha (1 → 2) intermediate (1 → 2) glcUA (1 → 3) -B 912 Soya saponin Bb '(III) gal (1 → 2) glcUA (1 → 3) -B 796 Soya saponin Bc '(IV) intermediate (1 → 2) glcUA (1 → 3) -B 766 DDMP group Soya saponin αg glc (1 → 2) gal (1 → 2) glcUA (1 → 3) -B- (22 ← 2 ') - DDMP 1084 Soya saponin βg rha (1 → 2) gal (1 → 2) glcUA (1 → 3) -B- (22 ← 2 ') - DDMP 1068 Soya saponin beta a rha (1 → 2) intermediate (1 → 2) glcUA (1 → 3) -B- (22 ← 2 ') - DDMP 1038 Soya saponin gamma g gal (1 → 2) glcUA (1 → 3) -B- (22 ← 2 ') - DDMP 922 Soya saponin gamma a intermediate (1 → 2) glcUA (1 → 3) -B- (22 ← 2 ') - DDMP 892 Group E Soya saponin Bd glc (1 → 2) gal (1 → 2) glcUA (1 → 3) -E 956 Soya saponin Be rha (1 → 2) gal (1 → 2) glcUA (1 → 3) -E 940

In the above Table 1, "A" represents soyasapogenol A, "B" represents soyasapogenol B, "E" represents soyasapogenol E, "glc" represents β-D-glucopyranosyl, "gal" β-D-galactopyranosyl, "glcUA" refers to β-D-glucuronopyranosyl, "ara" refers to α-L-arabinopyranosyl, "rha" refers to α-L-rhamnopyranosyl and "xyl" refers to β-D-xylopyranosyl , And "DDMP" represents 2,3-dihydro-2,5-dihydroxy-6-methyl-4H-pyran-4-one.

Recently, studies on the qualitative and quantitative determination of soya saponin using HPLC and LC-MS have been conducted, but most of them are related to soya saponin of group B with no DDMP contained in a relatively large amount in soybean, Studies on soybean saponin of DDMP group are insufficient. Regarding the soybean saponin of group A, US Pat. No. 4524067 discloses that soya saponin Ab and Af inhibit the formation of lipid peroxide. With respect to soybean saponin of the DDMP group, Yumiko YOSHIKI, Takashi KAHARA1, Kazuyoshi OKUBO1, Terumi SAKABE, Terumasa YAMASAKI: Superoxide- and 1,1-Diphenyl-2-picrylhydrazyl Radical-Scavenging Activities of Soyasaponin βg Related to Puberty 7-10896 or Yumiko Yoshiki et al. Gallic Acid, Bioscience, Biotechnology, and Biochemistry Vol. 65 (2001). 10 P 2162-2165 discloses the antioxidant activity of soya saponin compounds belonging to the soybean saponin group DDMP.

The present invention is derived from this background, and an object of the present invention is to provide a novel use of a specific soyasaponin compound corresponding to group A soyasaponin.

The present invention to solve the above object, provides a pharmaceutical composition for the prevention or treatment of obesity or lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient.

In another aspect, the present invention provides a food composition for the prevention or improvement of obesity or lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient.

Soyasaponin Aa according to the present invention has a superior effect of inhibiting the differentiation of pro-adipocytes into adipocytes, compared to the soyasaponin Ab, inhibits the accumulation of lipids during differentiation of pro-adipocytes into adipocytes, and into adipocytes Down-regulation of transcription factors and the like involved in differentiation. Thus, soyasaponin Aa according to the present invention can be usefully used for the prevention or treatment of lipid-related metabolic diseases such as obesity or fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis and lipid-related metabolic syndrome.

Fig. 1 shows the structure of soybean saponin of group A, Fig. 2 shows soya saponin of group B, soybean saponin of group E and soya saponin of DDMP group.
FIG. 3 is an oil red O staining photograph illustrating the effect of soyasaponin Aa and soyasaponin Ab on differentiation patterns when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. Soyasaponin Aa and Soyasaponin Ab affect the lipid accumulation in captivity differentiation. In Fig. 3, "Control (vehicle only) " means that MDI, 1 [mu] g / ml insulin and soy saff saponin were not treated, and" MDI "means only soy saff saponin was not treated.
5 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of PPARγ during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. Soyasaponin Aa and Soyasaponin Ab are graphs showing the effects of C / EBPa on mRNA expression levels during differentiation induction, and FIG. 7 shows that Soyasaponin Aa and Soyasaponin Ab were induced when differentiation of 3T3-L1 profat cells into adipocytes. It is a graph showing the effect of adiponectin on the mRNA expression level, Figure 8 is a graph showing the effect of Soyasaponin Aa and Soyasaponin Ab on the mRNA expression level of ADD1 / SREBP1c during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes 9 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of aP2 upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, 10 is a graph showing the effect of Soyasaponin Aa and Soyasaponin Ab on the mRNA expression level of Fas during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. 11 shows differentiation of 3T3-L1 precursor adipocytes into adipocytes. It is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of the resistin during induction.
12 is a Western blot photograph showing the effect of soyasaponin Aa on the expression of PPARγ protein and C / EBPa protein when inducing the differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. 13 is a fat tax of 3T3-L1 precursor adipocytes. A graph quantifying the effect of soyasaponin Aa on the expression of PPARγ protein in the differentiation of captive cells. FIG. 14 shows the effect of soyasaponin Aa on the expression of C / EBPa protein upon induction of differentiation of 3T3-L1 proadiocytes into adipocytes. A graph quantifying the impact.
FIG. 15 is a Western blot photograph showing the effect of soyasaponin Ab on the expression of PPARγ protein and C / EBPa protein when inducing differentiation of 3T3-L1 progenitor cells into adipocytes. FIG. Figure 17 is a graph quantifying the effect of soyasaponin Ab on the expression of PPARγ protein in the differentiation of captive cells, Figure 17 shows the effect of soyasaponin Ab on the expression of C / EBPa protein when induction of differentiation of 3T3-L1 profat cells into adipocytes A graph quantifying the impact.
18 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the transcriptional activity of PPARγ.

Hereinafter, the present invention will be described in detail.

The present invention relates to a novel use of a specific soyasaponin compound corresponding to group A soyasaponin, an example of the present invention provides a pharmaceutical composition for the prevention or treatment of obesity or lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient do.

The soya saponin compound can be separated / purified by various methods known from soybeans. For example, Kim, Sun-Lim et al. [Isolation and Structural Analysis of Acetyl Soyasaponin A1 from Hypocotyl of Soybean, Korean Journal of Crop Science, v.51 suppl.1, 2006, pp.166-173] 4524067 discloses a method for separating / purifying soya saponin Ab, Af. Taniyama et al. [Taniyama, T., Nagahama, Y., Yoshikawa, M. and Kitagawa, I., Saponin and sapogenol. XLIII. Acetyl-soyasaponins A4, A5, and A6, new astringent bisdesmosides of soyasapogenol, from Japanese soybean, the seeds of Glycine max MERRILL. Chem. Pharm. (Kudou, S., Tonomura, M., Uchida, T., Bull., 36, 2829-2839 (1988)) discloses a method for separating / purifying soy saff saponins Aa, Ae, , Sakabe, T., Tamura, N., and Okubo, K., Isolation and structural elucidation of DDMP-conjugated soyasaponins as genuine saponins from soybean seeds. Biosci. Biotech. Biochem., 57, 546-550 (1993)) discloses a method of isolating / purifying a soya saponin compound corresponding to soybean saponin of the DDMP group. Wei Zhang et al. [Wei Zhang and David G. Popovich, and soybean saponin Aa, Ab,? g,? a,? g,? g,? g,? g, , a method of separating / purifying a soya saponin compound corresponding to soya saponin of Group A, gamma sa and the like, soybean saponin of Group B and soya saponin of DDMP group, and Korean Patent Laid-Open Nos. 10-2010-0066589 and 10-2011 -0077739 discloses a method for separating / purifying soya saponin Ab, and Chinese Patent Publication No. 101891796 discloses a method for separating / purifying soya saponin Aa, Ab, Ba, Bb and Be, Patent Publication No. 101914127 discloses that soy saff saponin Aa, Ab,? G,? G JP-A No. 5-178879 discloses a method for separating and purifying soya saponin corresponding to soya saponin corresponding to the DDMP group and a method for isolating and purifying soya saponin corresponding to soya saponin corresponding to DDMP group, And JP-A-6-100583 discloses a method for separating / purifying soya saponins? A,? G and? A corresponding to soybean saponins of the DDMP group. Methods for isolating / purifying soy saff saponin compounds from soybeans disclosed in the above documents are included in the scope of the present invention. In addition, soyasaponin is Aa commercially available from ChemStrong Scientific Co., Ltd .; Shanghai Tauto Biotech Co., Ltd. It can be obtained from the back.

Soyasaponin Aa according to the present invention inhibits the differentiation of pro-dipotent cells into adipocytes or inhibits lipid accumulation upon inducing differentiation of pro-adipocytes into adipocytes and the effect is much higher than that of soyasaponin Ab. In addition, soyasaponin Aa according to the present invention is a peroxisome proliferator-activated receptor (PPARγ), C / EBP α (CCAAT-enhancer-binding protein α), aP2 (adipocyte fatty acid-binding) upon induction of differentiation of profat cells into adipocytes protein 2), adiponectin, adiponectin, ADD1 / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), Fas (fatty acid synthase) or resistin (resistin) expression is down-regulated. Therefore, soyasaponin Aa according to the present invention can be used as an active ingredient for preventing, improving or treating obesity, and furthermore, can be used as an active ingredient for preventing, improving or treating lipid-related metabolic diseases. The lipid-related metabolic diseases include at least one disease selected from the group consisting of fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis and lipid-related metabolic syndrome. In addition, the metabolic syndrome refers to a disease in which various metabolic diseases such as diabetes and obesity occur simultaneously in one person.

In the pharmaceutical composition comprising soyasaponin Aa of the present invention as an active ingredient, the content of soyasaponin Aa is not particularly limited, for example, 0.01 to 99% by weight, preferably 0.5 to 50% by weight, based on the total weight of the composition. More preferably, it may be 1 to 30% by weight. In addition, the pharmaceutical composition according to the present invention may further include additives such as pharmaceutically acceptable carriers, excipients or diluents in addition to Soyasaponin Aa. Carriers, excipients and diluents which may be included in the pharmaceutical compositions of the invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition of the present invention may further contain at least one known active ingredient having a prophylactic or therapeutic effect in addition to soyasaponin Aa for obesity or lipid-related metabolic diseases. The pharmaceutical composition of the present invention may be formulated into a formulation for oral administration or a parenteral administration by a conventional method, and when formulated, such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. Diluents or excipients may be used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, Sucrose, lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents, water and liquid paraffin. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like. Furthermore, it may be preferably formulated according to each disease or component by an appropriate method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention can be administered orally or parenterally to mammals including humans according to a desired method, and parenteral administration methods include external skin, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, muscle Intra-injection or intrathoracic injection; The dosage of the pharmaceutical composition of the present invention varies depending on the weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the patient. A typical daily dosage of the pharmaceutical composition of the present invention is not particularly limited but is preferably 0.1 to 1000 mg / kg, more preferably 1 to 500 mg / kg, based on soyasaponin Aa, an active ingredient. It may be administered once a day or divided into several times.

In addition, another embodiment of the present invention provides a food composition for the prevention or improvement of obesity or lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient.

Food composition comprising the soyasaponin Aa of the present invention as an active ingredient includes the form of pills, powders, granules, acupuncture, tablets, capsules, or liquids, and examples of specific foods are meat, sausage, bread, chocolate, candy , Snacks, confectionery, pizza, ramen, other dairy products including noodles, gum, ice cream, various soups, drinks, tea, functional water, drinks, alcoholic beverages and vitamin complexes. It includes everything. The content of soyasaponin Aa in the food composition of the present invention is 0.01 to 50% by weight, preferably 0.1 to 25% by weight, more preferably 0.5 to 10% by weight based on the total weight of the composition, but is not limited thereto. The food composition of the present invention may contain various flavors, natural carbohydrates, and the like as additional components in addition to soyasaponin Aa. In addition, the food composition of the present invention can be used as a food composition containing various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, , A carbonating agent used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The above-mentioned natural carbohydrates are sugar alcohols such as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and xylitol, sorbitol and erythritol. Natural flavors such as tau Martin and stevia extract, and synthetic flavors such as saccharin and aspartame may be used as the flavor.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

One. Soya Saponin Aa Get and Soya Saponin Ab Separation of

(1) Acquisition of Soya Saponin Aa

Soya Saponin Aa (Molecular Formula: C ₆₄ H ₁₀₀ O ₃₁ ; CAS No. 117230-33-8) is a product having a purity of 98% or more from Shanghai Tauto Biotech Co., Ltd. (China) (Catalog No .: E-0371) ) Was used.

(2) Isolation of Soya Saponin Ab

Soya saponin Ab was isolated from soybeans with reference to the contents disclosed in Korean Patent Publication No. 10-2011-0077739. Beans grown from the Rural Development Administration (Suwon, South Korea) [ Glycine max (L.) Merr.] seed (variety name: Wooram; phenotype of Soya Saponin: Ab) was obtained, and seeds were separated into hypocotyl and cotyledon. 15 liters of 80% methanol was added to 5 kg of embryonic powder of soybean, extracted at 80 ° C. for 5 hours, and filtered. In addition, 15 L of 80% methanol was added to the remaining residue, followed by extraction at 80 ° C. for 5 hours, and filtration. The filtrate was collected and concentrated under reduced pressure, 1.5 L of water was added thereto, suspended, 1.5 n of n-hexane was added thereto, followed by shaking. The mixture was separated into an n-hexane layer and a water layer. The n-hexane layer was removed, ethyl acetate 1.5 L was added to the water layer, and the mixture was shaken and separated into an ethyl acetate layer and a water layer. The ethyl acetate layer was removed, n-butanol 1.5 L was added to the water layer, and the mixture was shaken and separated into a butanol layer and a water layer. The water layer was removed, only the n-butanol layer was taken and concentrated under reduced pressure to obtain an n-butanol fraction. Silica gel column chromatography (10 cm × 50 cm, 70-230 mesh, Merck) was performed on the n-butanol fraction to obtain 6 small fractions. At this time, a mixed solvent having a volume ratio of 65:35:10 for CHCl ₃ : MeOH: H ₂ O was used as the elution solvent. The eluted small fraction IV was recrystallized from methanol to give a white amorphous powder. The white amorphous powder obtained was analyzed using ¹ H -NMR, ¹³ C -NMR and FAB-MS to identify Soyasaponin Ab.

2. Soya Saponin Aa  And Ab of Anti-obesity  Evaluation of activity or lipid production inhibitory activity

(1) Preparation of 3T3-L1 precursor adipocytes

3T3-L1 precursor adipocytes were purchased from the American Cell Line Bank (ATCC) and used for the experiments. 3T3-L1 progenitor adipocytes are widely used to study the metabolic processes of adipocytes. As the differentiation of these cells becomes more active, the accumulation of adipocytes in the adipocytes leads to obesity. Therefore, when a substance expected to have an anti-obesity effect is treated on the cell, the smaller the differentiation of the cell, the greater the anti-obesity effect.

(2) induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes

3T3-L1 mouse precursor adipocytes were placed in 10% BCS DMEM medium and cultured at 37 ° C and 5% CO ₂ . 3T3-L1 precursor adipocytes were plated at a density of 5 × 10 ⁴ cells / well in a 24-well plate and maintained at 100% confluency for 2 days. The differentiation of precursor adipocytes into adipocytes was induced for 2 days with 10% FBS DMEM medium containing MDI (0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 uM dexamethasone, 1 ug / ml insulin) Two days after the induction of differentiation, the cells were cultured in DMEM medium containing 10% FBS containing insulin at 1 / / ml for 2 days. Thereafter, the cells were replaced with 10% FBS DMEM medium for 2 days every 2 days to induce differentiation into adipocytes. Four days after the induction of differentiation, soyasaponin Aa or soyasaponin Ab was treated for 4 days every 2 days at 25, 50, and 100 uM concentrations, respectively, and the degree of differentiation into adipocytes was observed on day 8, when the differentiation was completed. Observed. At this time, soyasaponin Aa and soyasaponin Ab was dissolved in dimethylsulfoxide (Dimethylsulfoxide) to make a 100 mM stock (stock) and then used to dilute it to each concentration.

(3) Oil red O dyeing and analysis

After induction of differentiation into fat cells of pre - adipocytes, oil red O staining was performed to confirm the degree of fat accumulation. The degree of differentiation of adipocytes into adipocytes was firstly confirmed by microscopy through Oil Red O staining and the lipid content was quantitatively determined by measuring the absorbance at 510 nm with a spectrophotometer.

FIG. 3 is an oil red O staining photograph illustrating the effect of soyasaponin Aa and soyasaponin Ab on differentiation patterns when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. Soyasaponin Aa and Soyasaponin Ab affect the lipid accumulation in captivity differentiation. In Fig. 3, "Control (vehicle only) " means that MDI, 1 [mu] g / ml insulin and soy saff saponin were not treated, and" MDI "means only soy saff saponin was not treated. As shown in FIGS. 3 and 4, the soyasaponin compound inhibited the differentiation and accumulation of lipids when inducing differentiation of 3T3-L1 progenitor cells into adipocytes, and soyasaponin Aa was larger than soyasaponin Ab. .

(4) Real-time PCR

In the differentiation stage of adipocytes from adipocytes, the expression level of C / EBP α and PPAR γ increases as adipocyte differentiation progresses, and the expression level of most adipokines increases. As in the above-described method of inducing differentiation of 3T3-L1 progenitor cells into adipocytes, soyasaponin Aa or soyasaponin Ab was treated at 50 and 100 uM concentrations for 2 days every 4 days, and 8 days from the day of inducing differentiation. Afterwards, differentiation-inducing transcription factors such as C / EBP α and PPARγ and adipocaine expressed in differentiation-induced adipocytes, for example Fas, aP2, ADD1 / SREBP1c, resistin, adiponectin, ADD1 The expression levels of mRNAs of / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), Fas (fatty acid synthase) and resistin were determined by real-time PCR. Specifically, 3T3-L1 precursor adipocytes, which were differentiated, were washed twice with PBS, and cell pellets were collected to separate only RNA using Trizol. CDNA was synthesized using 1 추출 of the extracted RNA, real-time PCR was performed using SYBR green and the primers shown in Table 2 below, and GAPDH was used as a control gene.

Target mRNA Primer Directivity Primer sequence (5 '→ 3') Gene Bank Approval Number GAPDH sense GTATGACTCCACTCACGGCAAA BC083080 Antisense GGTCTCGCTCCTGGAAGATG PPARγ
sense CGCTGATGCACTGCCTATGA NM_011146 Antisense AGAGGTCCACAGAGCTGATTCC C / EBP α
sense AGGTGCTGGAGTTGACCAGT BC058161 Antisense CAGCCTAGAGATCCAGCGAC Adiponectin sense AGCCTGGAGAAGCCGCTTAT NM_009605 Antisense TTGCAGTAGE ACTTGCCAGTGC aP2 sense CATGGCCAAGCCCAACAT NM_024406 Antisense CGCCCAGTTTGAAGGAAATC ADD1 / SREBP1c sense CAAACTGCCCATCCACCGAC NM_011480 Antisense TGCCTCCTCCACTGCCACAA Resistin sense TCAACTCCCTGTTTCCAAATGC NM_022984 Antisense TCTTCACGAATGTCCCACGA Morocco sense CTGAGATCCCAGCACTTCTTGA NM_007988 Antisense GCCTCCGAAGCCAAATGAG

5 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of PPARγ during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. Soyasaponin Aa and Soyasaponin Ab are graphs showing the effects of C / EBPa on mRNA expression levels during differentiation induction, and FIG. 7 shows that Soyasaponin Aa and Soyasaponin Ab were induced when differentiation of 3T3-L1 profat cells into adipocytes. It is a graph showing the effect of adiponectin on the mRNA expression level, Figure 8 is a graph showing the effect of Soyasaponin Aa and Soyasaponin Ab on the mRNA expression level of ADD1 / SREBP1c during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes 9 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of aP2 upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, 10 is a graph showing the effect of Soyasaponin Aa and Soyasaponin Ab on the mRNA expression level of Fas during induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. 11 shows differentiation of 3T3-L1 precursor adipocytes into adipocytes. It is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the mRNA expression level of the resistin during induction. As shown in FIGS. 5 to 11, soyasaponin Aa and soyasaponin Ab are induced by differentiation-inducing transcription factors such as C / EBP α and PPARγ and Fas, aP2, ADD1 / SREBP1c upon induction of differentiation of 3T3-L1 profat cells into adipocytes. MRNA levels of adipocaine such as resistin, adiponectin, adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein (ADD1 / SREBP1c), fatty acid synthase (FAS), and resistin (resistin) It was shown to downregulate.

(5) Western blot

As in the above-described method of inducing differentiation of 3T3-L1 progenitor cells into adipocytes, soyasaponin Aa or soyasaponin Ab was treated at 50 and 100 uM concentrations for 2 days every 4 days, and 8 days from the day of inducing differentiation. Afterwards, wash 3T3-L1 progenitor cells twice with PBS and use RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM sodium chloride, 1% NP-40, 0.5% sodium dexycholate, 0.1% sodium dodecyl sulfate, protease inhibitor). Cells were lysed. Cell lysates were centrifuged at 13000 rpm for 30 minutes to extract proteins and electrophoresed using 8% SDS-PAGE gel. The electrophoresed proteins were transferred to a nitrocellulose membrane at 100 V and 400 mA for 1 hour and 10 minutes. The nitrocellulose membrane on which the protein was transferred was blocked with TBST containing 5% skim milk, and then the primary antibody (Santa Cruz Biotechnology, USA) for PPARγ or C / EBP α and the secondary antibody (Santa Cruz Biotechnology, USA), and the degree of protein expression of PPARγ or C / EBPα was measured after fluorescence color development. In addition, the degree of protein expression of PPARγ or C / EBP α was evaluated by comparing with the expression level of β-actin.

12 is a Western blot photograph showing the effect of soyasaponin Aa on the expression of PPARγ protein and C / EBPa protein when inducing the differentiation of 3T3-L1 precursor adipocytes into adipocytes, and FIG. 13 is a fat tax of 3T3-L1 precursor adipocytes. A graph quantifying the effect of soyasaponin Aa on the expression of PPARγ protein in the differentiation of captive cells. FIG. 14 shows the effect of soyasaponin Aa on the expression of C / EBPa protein upon induction of differentiation of 3T3-L1 proadiocytes into adipocytes. A graph quantifying the impact. FIG. 15 is a Western blot photograph showing the effect of soyasaponin Ab on the expression of PPARγ protein and C / EBPa protein in inducing differentiation of 3T3-L1 profat cells into adipocytes, and FIG. 16 is 3T3-L1 profat cells. Is a graph quantifying the effect of soyasaponin Ab on the expression of PPARγ protein in induction of differentiation into adipocytes, Figure 17 shows the expression of C / EBPa protein in soyasaponin Ab upon induction of differentiation of 3T3-L1 profat cells into adipocytes It is a graph quantifying the effect on. As shown in FIGS. 12 to 17, soyasaponin Aa markedly inhibited the expression of PPARγ protein upon induction of differentiation of 3T3-L1 progenitor cells into adipocytes.

(6) PPARγ transcriptional activity assay (PPARγ transcriptional activity assay)

pGL3-basic luciferase expression vector (Promega) to PPRE (PPARγ response element) as a recombinant vector and a control Renilla reporter gene by inserting the gene and PPARγ The pRL-SV-40 plasmid (Promega) carrying the luciferase cDNA was co-transfected into HEK 293T cells. Co-transfected HEK 293T cells were cultured for one day to express the genes, and then soyasaponin Aa (25, 50, 100 uM concentration) or soyasaponin Ab (25, 50, 100 uM concentration) and PPARγ inducer 10uM troglitazone After treatment for 24 hours, the effect of soyasaponin Aa or soyasaponin Ab on the transcriptional activity of PPARγ was measured by luciferase expression intensity.

18 is a graph showing the effect of soyasaponin Aa and soyasaponin Ab on the transcriptional activity of PPARγ. As shown in FIG. 18, soyasaponin Aa and soyasaponin Ab suppressed the transcriptional activity of PPARγ in a concentration-dependent manner.

3. Soya Saponin Aa ≪ / RTI >

<3-1> Preparation of Powder

Soya Saponin Aa 200 mg

Lactose 100 mg

Talc 10 mg

The above components were mixed and packed in airtight bags to prepare powders.

<3-2> Preparation of Tablet

Soya Saponin Aa 50 mg

Corn starch 100 mg

100 mg of milk

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<3-3> Preparation of Capsule

Soya Saponin Aa 50 mg

Corn starch 100 mg

100 mg of milk

2 mg of magnesium stearate

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

<3-4> Preparation of the ring

Soya Saponin Aa 1 g

Lactose 1.5 g

Glycerin 1 g

0.5 g of xylitol

After mixing the above components, they were prepared so as to be 4 g per one ring according to a conventional method.

<3-5> Preparation of Granules

Soya Saponin Aa 150 mg

Soybean extract 50 mg

200 mg of glucose

600 mg of starch

After mixing the above components, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in a capsule.

<3-6> Preparation of Injection

Soya Saponin Aa 100 mg

Sodium metabisulphite 3.0 mg

Methyl paraben 0.8 mg

0.1 mg of propylparaben

Sterile sterilized water for injection

After mixing the above ingredients, 2 ml of the mixture was filled in an ampoule and sterilized to prepare an injection.

4. Soya Saponin Aa Preparation of a food composition comprising

<4-1> Production of flour food

0.5-5.0 parts by weight of soyasaponin Aa was added to 100 parts by weight of wheat flour, and the mixture was used to prepare bread, cake, cookies, crackers and noodles.

<4-2> Manufacture of soups and gravies

Soyasaponin Aa 0.1-5.0 parts by weight was added to soups and gravy to prepare health products for health promotion, soup of noodles and gravy.

<4-3> Preparation of ground beef

10 parts by weight of soyasaponin Aa was added to 100 parts by weight of ground beef to prepare a ground beef for health promotion.

<4-4> Manufacture of dairy products

5-10 parts by weight of soyasaponin Aa was added to 100 parts by weight of milk, and various milk products such as butter and ice cream were prepared using the milk.

<4-5> Manufacturing of Sunshine

Brown rice, barley, glutinous rice, and yulmu were dried by a known method and dried, and the mixture was granulated to a powder having a particle size of 60 mesh.

Black soybeans, black sesame seeds, and perilla seeds were steamed and dried by a conventional method, and then they were prepared into powder having a particle size of 60 mesh by a pulverizer.

The grains, seeds and soya saponin Aa prepared above were combined and prepared in the following ratio.

(30 parts by weight of brown rice, 15 parts by weight of yulmu, 20 parts by weight of barley)

Seeds (7 parts by weight of perilla, 8 parts by weight of black beans, 7 parts by weight of black sesame seeds)

Soya Saponin Aa (3 parts by weight),

(0.5 part by weight),

(0.5 parts by weight)

<4-6> Manufacture of health drinks

Instant sterilization by homogeneously mixing 1 g of Soya Saponin Aa with subsidiary materials such as liquid fructose (0.5 g), oligosaccharide (2 g), sugar (2 g), salt (0.5 g) and water (75 g). It was prepared by packaging in a small packaging container.

<4-7> Manufacture of vegetable juice

Vegetable juice was prepared by adding 1 g of soyasaponin Aa to 1,000 ml of tomato or carrot juice.

<4-8> Preparation of fruit juice

1 g of soya saponin Aa was added to 1,000 ml of apple or grape juice to prepare a fruit juice.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Therefore, the protection scope of the present invention should be construed as including all embodiments falling within the scope of the claims appended to the present invention.

Claims (14)

A pharmaceutical composition for preventing or treating obesity, comprising soyasaponin Aa as an active ingredient.
[Claim 2] The pharmaceutical composition for preventing or treating obesity, according to claim 1, wherein the soyasaponin Aa inhibits the differentiation of profat cells into adipocytes.
The method of claim 2, wherein the soyasaponin Aa is a peroxisome proliferator-activated receptor (PPARγ), C / EBP α (CCAAT-enhancer-binding protein α), aP2 (adipocyte fatty acid-binding) upon differentiation of profat cells into adipocytes protein 2), adiponectin, adiponectin, ADD1 / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), Fas (fatty acid synthase) or resistin (resistin) characterized by the down regulation of expression Or therapeutic pharmaceutical compositions.
A food composition for preventing or improving obesity, comprising soyasaponin Aa as an active ingredient.
5. The food composition for preventing or improving obesity according to claim 4, wherein the soyasaponin Aa inhibits the differentiation of profat cells into adipocytes. 6.
The method according to claim 5, wherein the soyasaponin Aa is a peroxisome proliferator-activated receptor (PPARγ), C / EBP α (CCAAT-enhancer-binding protein α), aP2 (adipocyte fatty acid-binding) upon differentiation of profat cells into adipocytes protein 2), adiponectin, adiponectin, ADD1 / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), Fas (fatty acid synthase) or resistin (resistin) characterized by the down regulation of expression Or food composition for improvement.
Pharmaceutical composition for the prevention or treatment of lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient.
[Claim 8] The pharmaceutical composition for preventing or treating lipid-related metabolic disease according to claim 7, wherein the soyasaponin Aa inhibits lipid accumulation upon differentiation of profat cells into adipocytes.
8. The method of claim 7, wherein the soyasaponin Aa is a peroxisome proliferator-activated receptor (PPARγ), C / EBP α (CCAAT-enhancer-binding protein α), aP2 (adipocyte fatty acid-binding) upon differentiation of profat cells into adipocytes. protein 2), adiponectin, adiponectin, ADD1 / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), fat-related lipids characterized by down-regulating the expression of fat acid synthase (FAS) or resistin (resistin) Pharmaceutical composition for preventing or treating metabolic diseases.
The method of claim 7, wherein the lipid-related metabolic disease is at least one disease selected from the group consisting of fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis, and lipid-related metabolic syndrome. Or therapeutic pharmaceutical compositions.
Food composition for the prevention or improvement of lipid-related metabolic diseases comprising soyasaponin Aa as an active ingredient.
The food composition for preventing or improving lipid-related metabolic disease according to claim 11, wherein the soyasaponin Aa inhibits lipid accumulation upon differentiation of profat cells into adipocytes.
12. The method of claim 11, wherein the soyasaponin Aa is a peroxisome proliferator-activated receptor (PPARγ), C / EBP α (CCAAT-enhancer-binding protein α), aP2 (adipocyte fatty acid-binding) upon differentiation of profat cells into adipocytes protein 2), adiponectin, adiponectin, ADD1 / SREBP1c (adipocyte determination and differentiation factor 1 / sterol regulatory element binding protein), fat-related lipids characterized by down-regulating the expression of fat acid synthase (FAS) or resistin (resistin) Food composition for preventing or improving metabolic diseases.
12. The method of claim 11, wherein the lipid-related metabolic disease is at least one disease selected from the group consisting of fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis, and lipid-related metabolic syndrome. Or food composition for improvement.

Images