KR101557934B1 - Composition comprising extracts of Codonopsis lanceolata or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease - Google Patents

Abstract

The present invention includes at least one selected from the group consisting of fermented green tea extract, lancemaside A, echinocystic acid, and pharmaceutically or pharmacologically acceptable salts thereof as an active ingredient Or preventing obesity or an obesity-related disease caused by an obesity or an obesity-related disease. The fermented sea bream extract, lancemaside A, echinocystic acid, etc. according to the present invention can be used as a pharmaceutical material constituting a pharmaceutical composition or a functional food composition. In particular, the lancemaside A and echinocystic acid according to the present invention activates AMP-activated protein kinase (AMPK) and down-regulates the expression of the gene related to lipolysis, The effect of inhibiting differentiation upon differentiation into adipocytes and the effect of inhibiting the accumulation of neutrophils are excellent.

Description

[0001] The present invention relates to a composition for preventing, ameliorating or treating obesity or obesity-related diseases, which comprises a compound isolated from a fermented duck meat extract or duck meat,

The present invention relates to a novel use of a compound isolated from Fermented Duck Duck Extract or Duck Deer, and more particularly to a composition for preventing, improving or treating an obesity or obesity related disease comprising a compound isolated from Fermented Duck Duck Extract or Duck Deer will be.

Obesity has become one of the most serious diseases as mankind has developed into a rich society, and the World Health Organization (WHO) has declared that obesity is the object of diseases to be treated. Obesity is a metabolic disorder caused by an imbalance in the intake and consumption of calories, and is caused by hypertrophy or hyperplasia of the body fat cells morphologically. Obesity is not only the most common malnutrition disorder in western society, but also in Korea, the importance of the treatment and prevention of the obesity is rapidly increasing due to the rapid increase in the frequency of obesity due to the improvement of diet and westernization of lifestyle. have. Obesity is not only psychologically disturbing individuals, but also an important factor in increasing the risk of various adult diseases. Obesity is known to be directly related to the increased prevalence of various adult diseases such as type 2 diabetes, hypertension, hyperlipidemia, and cardiovascular disease (Cell 87: 377, 1999) and is associated with metabolic syndrome or insulin resistance (Insulin resistance syndrome), which is known as a cause of arteriosclerosis and cardiovascular disease. It can be inferred from the fact that obesity increases the incidence of various metabolic diseases and that actual weight loss significantly reduces the incidence of such diseases, fat-rich adipocytes mediate this phenomenon.

In the past, adipose tissue was thought to be an energy storage organ that stores and releases excessive energy in the form of triacylglycerol, but recently, adiponectin, leptin, and resistin It is accepted as an important endocrine organ that regulates energy homeostasis by secreting various adipokines (Trends Endocrinol Metab 13:18, 2002). Therefore, understanding of the proliferation of adipocytes and the substances secreted by adipocytes and their in vivo mechanisms of regulation are considered to serve as a basis for understanding obesity and various diseases caused by it and for developing an effective therapeutic agent. Studies on the regulation of adipocyte differentiation have been actively conducted and it is considered to be the main mechanism that differentiation from preadipocytes in the body is related to the increase of adipocytes in obese patients. The differentiation process of precursor adipocytes into adipocytes has been studied using cells such as 3T3-L1, and several transcription factors, particularly transcription factors known to be involved in localization, C / EBPs (CAAT enhancer binding proteins, PPARs (Peroxisome Proliferator Activated Receptor), and ADD / SREBPs (Adipocyte determination and differentiation dependent element binding proteins), are known to regulate the process and to control the process (Bart A Jessen et al., Gene, 299, pp 95-100, 2002; Darlington et al., J. Biol. Chem., 273, pp30057-30060, 1998; Brun RP et al., Curr Opin. , pp 826-832, 1996). Given the stimulation of hormones such as MDI (isobutylmethylxanthin, dexamethasone and insulin), C / EBP [beta] and [delta] are first transiently expressed and initiate differentiation into adipocytes (Reusch J. E et al., Mol Cell. Biol., 20, pp 1008-1020, 2000). Which in turn leads to increased expression of C / EBP alpha and PPARy (James M. N. et al., J. Nutr., 130, pp3122S-3126S, 2000). PPARγ is known to be an important transcription factor especially for adipocyte differentiation. It forms a retinoic acid X receptor protein (RXR) and a dimer, and is present in various promoters of adipocyte genes (Tontonoz PE et al., Genes Dev., 8, pp1224-1234, 1994; Hwang, C. S et al., Cell Dev. Biol., 13, pp 873-877) . The interaction of PPARγ and C / EBP α is crucial for the differentiation into mature adipocytes. These transcription factors and adipocyte regulators promote adipocyte differentiation and promote adipocyte fatty acid-binding protein 2 (aP2) And fatty acid synthase (Fas) are increased. In addition, ADD1 / SREBPs play an important role in lipid metabolism, but are also involved in the differentiation process. Expression of ADD1 / SREBP1c in immature adipocytes is believed to contribute to the activation of PPARγ (Rosen ED et al., Annu. Rev. Cell Dev. Biol., 16, pp 145-171, 2000; Osborn TF, J. Biol Chem., 275, pp 32379-32382, 2000). Only the fat cells that have undergone the differentiation process synthesize fatty acids and store triglycerides. Therefore, current research trends are focused on the search for substances that can inhibit the metabolic process of adipocyte differentiation as a method for preventing or treating obesity and lipid-related metabolic diseases. In other words, attempts have been made to treat obesity through the regulation of fat cells based on the mechanism of obesity, and it has been attempted to inhibit fat synthesis, to reduce fat amount by promoting lipolysis and oxidation, The goal is to reduce the number of cells, and transcription factors, proteins and adipokines, which are known to mediate or regulate these processes, are the targets of the development of new anti-obesity drugs. Indeed, the PPAR (Peroxisome proliferator-activated receptor) family of adipocyte differentiation transcription factors, leptin and adiponectin, which are adipocyte-secreting substances, have been the targets of many new drug development.

Currently known herbal remedies include Xenical (Roche Pharmaceuticals, Switzerland), Reductil (Evothe, USA) and Exolise (Atopama, France), which are widely used as appetite suppressants, And most obesity drugs are appetite suppressants that suppress appetite by controlling the neurotransmitters associated with the hypothalamus. However, conventional therapeutic agents have side effects such as heart diseases, respiratory diseases, nervous system diseases and the like, and the persistence of their effects is also low, so that it is necessary to develop a more improved therapeutic agent for obesity. Also, currently developed products have satisfactory therapeutic effects There is little cure for cervical cancer, and development of a new treatment for obesity is required.

Meanwhile, Codonopsis lanceolata ) is a perennial plant of the dicotyledonous plant of the dicotyledonous plant, and its dried root is called a 沙 蔘. In one room, the ginseng is used for the removal of dental fever, gut dementia and lung fever. Regarding the physiological activity of the compound isolated from Duckuk, Korean Patent Laid-Open Publication No. 10-2007-0017540 discloses a blood testosterone lowering inhibitor containing ranchemide A, and Korean Patent Publication No. 10-1267693 Discloses a composition for treating or preventing an immunodeficiency virus containing lancemaside A or echinocystic acid as an active ingredient and Korean Patent Laid-Open Publication No. 10-2012-0031202 discloses a composition for treating or preventing an immunodeficiency virus Korean Patent Laid-Open No. 10-2011-0080697 discloses a composition for prevention or treatment of colitis, which contains echinocystic acid as an active ingredient. Compositions have been disclosed, and in other documents, the effect of improving the colitis in lancemaside A (Jo Eun-ha, Kyung Hee University Four thesis, 2010), is the Shema has been reported, such as side A (lancemaside A) and Echinacea nosayi stick acids (memory protection (Jeongilhun, Kyung Hee University, Master Thesis, 2013) of echinocystic acid). In addition, although the anti-obesity effect of rosacea extract has been disclosed in other documents, there is a limit to the use of rosiglitazone extract itself as an anti-obesity drug.

The present invention has been made under the background of the prior art, and one object of the present invention is to provide a new use of the fermented green tea extract, and more particularly to a fermented green tea extract for use in prevention, improvement or treatment of obesity or obesity- .

Another object of the present invention is to provide a novel use of a compound isolated from Dodok, and specifically to provide a use for the prevention, amelioration or treatment of obesity or obesity related diseases of a compound isolated from Doduck.

The inventors of the present invention conducted studies to develop extracts having a preventive or therapeutic activity against obesity in various medicinal plant extracts or compounds isolated therefrom, which are more safe than synthetic chemicals. As a result, it was found that lancemaside A, which is isolated from the extract or Duck fungus, has an excellent anti-obesity or therapeutic effect on obesity-inducing model animals and completed the present invention.

In order to accomplish one object of the present invention, the present invention provides a fermented yeast extract, which comprises fermented Morinda extract as an active ingredient, wherein the fermented Morinda extract is a product obtained by fermenting a bacterium genus microorganism Wherein said microorganism belonging to the genus Bacillus is selected from Bacillus subtilis , Bacillus coagulans , or a mixed microorganism thereof. The composition for preventing, ameliorating or treating obesity or obesity related diseases, to provide. The composition for preventing, ameliorating or treating the obesity or obesity-related diseases is preferably a pharmaceutical composition or a food composition.

In order to achieve another object of the present invention, the present invention provides a pharmaceutical composition comprising one kind or two or more kinds selected from the group consisting of lancemaside A, echinocystic acid and pharmaceutically or pharmacologically acceptable salts thereof Or more of the total amount of the active ingredient as an active ingredient for preventing or treating obesity or obesity-related diseases. The composition for preventing, ameliorating or treating the obesity or obesity-related diseases is preferably a pharmaceutical composition or a food composition.

The fermented sea bream extract, lancemaside A, echinocystic acid, etc. according to the present invention can be used as a pharmaceutical material constituting a pharmaceutical composition or a functional food composition. In particular, the lancemaside A and echinocystic acid according to the present invention activates AMP-activated protein kinase (AMPK) and down-regulates the expression of the gene related to lipolysis, The effect of inhibiting differentiation upon differentiation into adipocytes and the effect of inhibiting the accumulation of neutrophils are excellent. Accordingly, the fermented duckweed extract according to the present invention, lancemaside A, echinocystic acid, and the like can be used for the treatment of obesity, fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis and lipid-related metabolic syndrome Can be usefully used to prevent, ameliorate, or treat diseases such as < Desc / Clms Page number 2 >

Figure 1 shows the chemical structure of lancemaside A.
Figure 2 shows the chemical structure of echinocystic acid.
Fig. 3 is a schematic diagram showing a process of separating lancemaside A from duckuk.
FIG. 4 is a graph showing the effect of roeae extract on the weight change of a model animal in which obesity was induced by a high fat diet by experimental groups.
FIG. 5 is a graph showing the effect of ransemide A on the body weight change of a model animal in which obesity was induced by a high-fat diet by experimental groups.
FIGS. 6, 7, 8, 9, 10 and 11 show the results of analysis of the liver, subcutaneous fat tissue, epididymal fat tissue, kidney fat tissue, mesenteric fat tissue, The effect of rancemide A on the weight of brown adipose tissue is shown graphically by experimental group.
FIG. 12 is a graph showing the effect of ransemide A on the oral glucose load test of a model animal in which obesity was induced by a high fat diet, and FIG. 13 is a graph showing an oral glucose load test result of FIG. glucose-time curve.
14 shows the results of measurement of the expression level of p-AMPK protein in liver tissues by Western blot analysis to examine the effect of rancemase A on model animals in which obesity was induced by high fat diet, Which is a multiple of the expression amount of protein in the dietary group.
15 shows the expression levels of PPARγ, C / EBPα and FAS protein in liver tissues by Western blot analysis in order to examine the effect of ransemide A on model animals in which obesity was induced by high fat diet And a multiple of the protein expression amount of the normal diet group.
FIG. 16 is a graph showing the effect of mRNA levels of SREBP-1c, FABP4, ACC, SCD1 and LPL in liver tissue when rancemase A was administered to a model animal in which obesity was induced by high fat diet, And the mRNA levels of MCAD, HSL and ATGL in liver tissue when ran sicamide A was administered to a model animal in which obesity was induced by dietary administration.
18 shows the effect of mRNA levels of PPARγ, C / EBPα, SREBP-1c, FAS, FABP4, ACC, SCD1 and LPL in epididymal adipose tissue when ranchomaide A was administered to a model animal in which obesity was induced by high fat diet Fig.
FIG. 19 is an oil red O staining image showing the effect of differentiation pattern of Ranchemase A on the induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes.
FIG. 20 is a graph showing the effect of trandemic side A on the triglyceride content in differentiated adipocytes when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG.
FIG. 21 is a graph showing quantitative results obtained by Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the PPARgamma protein level.
FIG. 22 shows the results of Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of C / EBPα protein and a quantitative graph to be.
FIG. 23 is a graph showing quantitative results obtained by Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes by Ranchemase A treatment and FAS protein level change.
24 shows the results of Western blot analysis of the effect of 3S3-L1 preadipocyte differentiation on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of p-AMPk protein, to be.
25 shows the results of Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of p-AMC protein, and a quantitative graph to be.
FIG. 26 is a graph showing the effect of 3S3-L1 precursor adipocytes on induction of differentiation into adipocytes, and FIG. 27 is a graph showing the effect of 3S3-L1 preadipocytes on the induction of differentiation into adipocytes FIG. 28 is a graph showing the effect of ranchemide A treatment on the mRNA level of C / EBPα. FIG. 28 is a graph showing the effect of rancemase A treatment on the mRNA level of SREBP-1c when inducing differentiation into 3T3-L1 precursor adipocytes FIG. 29 is a graph showing the effect of 3S3-L1 precursor adipocytes on the level of mRNA of FAS when inducing differentiation into adipocytes, and FIG. 30 is a graph showing the effect of 3S3-L1 preadipocyte FIG. 31 is a graph showing the effect of Rancemasaide A treatment on the mRNA level of FABP4 when inducing differentiation into adipocytes. FIG. 31 is a graph showing the effect of Rancemasaide A treatment on the induction of differentiation of 3T3-L1 preadipocytes into adipocytes. FIG. 32 is a graph showing the effect of trandemic A treatment on the mRNA level of SCD1 in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes, FIG. 33 is a graph showing the effect of 3T3-L1 FIG. 34 is a graph showing the effect of Ranchemase A treatment on the level of LPL mRNA in inducing the differentiation of preadipocytes into adipocytes. FIG. 34 is a graph showing the effect of Rancemasaide A treatment on the induction of differentiation of 3T3-L1 preadipocytes into adipocytes Leptin mRNA level. Fig. 35 is a graph showing the effect of treatment with ransemase A on the mRNA level of CPT1 in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes.

Hereinafter, terms used in the present invention will be described.

As used herein, the terms "pharmaceutically acceptable" and "pharmaceutically acceptable" are intended to mean not significantly irritating the organism and not interfering with the biological activity and properties of the administered active substance.

As used herein, the term "prophylactic " means any act that inhibits the symptoms of, or delays the progression of, a particular disease (e.g., colitis) upon administration of the composition of the present invention.

As used herein, the term "treatment" refers to any act that improves or alleviates the symptoms of a particular disease (e.g., colitis) upon administration of the composition of the present invention.

The term "improvement" as used in the present invention means all actions that at least reduce the degree of symptom associated with the condition being treated.

The term "administering" as used herein is meant to provide any desired composition of the invention to an individual by any suitable method. The term " individual " means any animal such as a human, a monkey, a dog, a goat, a pig, or a mouse having a disease in which symptoms of a specific disease can be improved by administering the composition of the present invention.

The term " pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease at a reasonable benefit or risk rate applicable to medical treatment, including the type of disease, severity, activity of the drug, The time of administration, the route and rate of excretion of the drug, the duration of the treatment, factors including drugs used simultaneously and other factors well known in the medical arts.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention relates to a novel use of fermented green tea extract. The present invention provides a composition for preventing, ameliorating or treating obesity or obesity-related diseases comprising fermented green tea extract as an active ingredient.

The fermentation extract of the present invention can be prepared by various methods. For example, there is a method in which an extract is obtained from a product obtained by fermenting Doduck with a specific microorganism belonging to the genus Bacillus, or a method in which a dodeca extract is fermented with a microorganism belonging to the genus Bacillus. Herein, the Bacillus genus-specific microorganism is selected from Bacillus subtilis , Bacillus coagulans , or a mixture thereof. In addition, various organs or parts such as leaves, flowers, roots, stems, rootstocks, fruits, seeds and the like can be used as a raw material for obtaining the fermented green tea extract of the present invention. Of these, . On the other hand, in order to obtain the fermentation extract from Doduck, an extraction process is required. As the extraction method, a conventional extraction method known in the art can be used, for example, a solvent extraction method. The extraction solvent that can be used when preparing the fermentation broth extract by the solvent extraction method includes water, a lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol and butanol), or a mixture thereof, Propylene glycol, 1,3-butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane and mixtures thereof, Is preferred. When water is used as the extraction solvent, the water is preferably hot water. When an alcohol is used as an extraction solvent, the alcohol is preferably a lower alcohol having 1 to 4 carbon atoms, and the lower alcohol is more preferably selected from methanol or ethanol. In addition, when the functional alcohol is used as the extraction solvent, the alcohol content is preferably 50 to 90%. On the other hand, it is obvious to those skilled in the art that an extract having substantially the same effect can be obtained by using not only the above-mentioned extraction solvent but also other extraction solvents. For example, decompression by carbon dioxide, extraction by supercritical extraction at high temperature, extraction by extraction using ultrasound, separation by ultrafiltration membrane with constant molecular weight cut-off value, various chromatography (size, charge, hydrophobic or affinity The active fraction obtained through various purification and extraction methods, such as separation using the above-described method for separation according to sex, is also included in the extract of the present invention. The supercritical fluid extraction refers to supercritical fluid extraction. Generally, the supercritical fluid is extracted from the liquid and the liquid when the gas reaches the critical point at high temperature and high pressure, (J. Chromatogr. A. 1998; 479: 200-205). In addition, it has been reported that the supercritical fluid has a polarity similar to that of a nonpolar solvent. Carbon dioxide is a supercritical fluid with both liquid and gaseous nature, with the operation of supercritical fluid equipment reaching its critical pressure and temperature, resulting in increased solubility in fat-soluble solutes. When supercritical carbon dioxide passes through an extraction vessel containing a certain amount of sample, the lipophilic substance contained in the sample is extracted into supercritical carbon dioxide. When the supernatant carbon dioxide containing a small amount of cosolvent is passed through the sample remaining in the extraction vessel after extracting the lipid-soluble substance, components that were not extracted by pure supercritical carbon dioxide can be extracted. The supercritical fluid used in the supercritical extraction method of the present invention can effectively extract an active ingredient by using a mixed fluid in which a cosolvent is further mixed with supercritical carbon dioxide or carbon dioxide. These co-solvents may be used alone or in admixture of two or more selected from the group consisting of chloroform, ethanol, methanol, water, ethyl acetate, hexane and diethyl ether. Most of the extracted samples contain carbon dioxide. Since the carbon dioxide is volatilized into air at room temperature, the extract obtained by the above method can be used as a cosmetic composition, and the cosolvent can be removed by a reduced pressure evaporator. In addition, the ultrasonic extraction method is an extraction method using energy generated by ultrasonic vibration. Ultrasonic waves can destroy an insoluble solvent contained in a sample in a water-soluble solvent. Due to the high local temperature, Since the kinetic energy of the reactant particles is increased, sufficient energy required for the reaction is obtained. By inducing the high pressure by the shock effect of the ultrasonic energy, the mixing effect of the substance contained in the sample and the solvent is enhanced, thereby increasing the extraction efficiency. As the extraction solvent which can be used for the ultrasonic extraction method, one or a mixture of two or more selected from the group consisting of chloroform, ethanol, methanol, water, ethyl acetate, hexane and diethyl ether can be used. The extracted sample is recovered by vacuum filtration, and the filtrate is recovered, and the extract is removed by a vacuum evaporator and freeze-dried to obtain an extract.

The fermented extract according to the present invention includes various active substances such as lancemaside A or echinocystic acid. However, depending on the extraction method, there may be slight differences in the kind and content of the specific components of the active ingredient of the fermented extract.

The fermented extract according to the present invention can be used as an active ingredient for preventing, improving or treating obesity or obesity-related diseases. The above-mentioned obesity-related diseases are not limited in their kind if they are caused by obesity or are highly correlated with obesity, for example, in fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, atherosclerosis and lipid-related metabolic syndrome Lt; / RTI > In addition, the lipid-related metabolic syndrome refers to a disease in which various metabolic diseases such as diabetes and obesity occur simultaneously in one person.

The composition containing the fermented extract of the present invention as an active ingredient may be formulated into a pharmaceutical composition, a food additive, a food composition (in particular, a functional food composition), a feed additive or the like depending on the intended use or aspect, The content of the extract can also be adjusted in various ranges depending on the specific form of the composition, the purpose of use, and the manner of use.

Another aspect of the present invention relates to novel uses such as lancemaside A, and the present invention relates to novel uses of lancemaside A, echinocystic acid, Or a pharmaceutically acceptable salt thereof, as an active ingredient. The present invention also provides a composition for preventing, ameliorating or treating an obesity or obesity-related disease.

The ransemide A is a glycoside containing an echinosilicic acid as an aglycone and has the chemical structural formula shown in Fig. On the other hand, the echinosaccharic acid has the chemical structural formula shown in Fig. 2 and is known to dominate the physiological activity of ransemide A. Therefore, it has been reported that ransemide A and epoxysilicic acid have the same functionality as anticancer, antiviral, anti-inflammation, etc. (Korean Patent Publication No. 10-1267693, Korean Patent Publication No. 10-2012-0031202 ). Therefore, those skilled in the art will be able to predict the anti-obesity activity of the echinosic acid from the anti-obesity activity of Semaside A. The Ranchesemide A and the Echinosayic acid can be isolated from plants such as roeae, chemically synthesized, or sold commercially. For example, when fermenting doduck with a specific microorganism and then extracting it with alcohol or the like, it is possible to obtain an extract containing both lanthanide A and echinocylic acid, thereby separating lanthanide A from echinocystic acid have. An example of separating ransemide A from dodec is shown in Fig.

As pharmacologically or pharmaceutically acceptable salts in the present invention, acid addition salts formed by free acids are useful. The acid addition salt is prepared by a conventional method, for example, by dissolving the compound in an excess amount of an acid aqueous solution, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. The same molar amount of the compound and the acid or alcohol (e.g., glycol monomethyl ether) in water may be heated and then the mixture may be evaporated to dryness, or the precipitated salt may be subjected to suction filtration. As the free acid, an organic acid and an inorganic acid can be used. As the inorganic acid, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid and the like can be used. Examples of the organic acid include methanesulfonic acid, p- toluenesulfonic acid, acetic acid, (Meth) acrylic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, lactic acid, glycollic acid, gluconic acid, Glucuronic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid and the like can be used. In addition, pharmaceutically or pharmaceutically acceptable metal salts can be prepared using bases. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. As the metal salt, it is particularly preferable to produce sodium, potassium or calcium salt, and the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The lancemaside A, echinocystic acid or a pharmaceutically or pharmacologically acceptable salt thereof of the present invention can be used for the phosphorylation of AMP-activated protein kinase (AMPK) or the acetyl-CoA carboxylase ) To control lipid metabolism or differentiation into adipocytes. AMPK (AMP-activated protein kinase) has recently been attracting attention as a new target for the development of anti-obesity substances. AMPK is a protein that is activated by sensing intracellular AMP (Adenosine Mono-Phosphate), which inhibits the signal transduction pathway that consumes ATP, while protecting the cell from external stress by activating the signal transduction pathway that synthesizes ATP. The substances that increase the activity of AMPK have been reported to have the effects of promotion of ATP (Adenosine Tri-Phosphate) synthesis, increase of glucose uptake, promotion of? -Oxidation of fat, inhibition of cholesterol synthesis, Is used as a drug target for the development of a therapeutic agent for metabolic diseases such as diabetes, insulin resistance, hyperlipidemia, and inflammation. AMPK is a phosphorylation enzyme that plays a role in the detection of intracellular ATP concentration. It is an important enzyme for maintaining energy balance in cells. It is mostly increased by intracellular biosynthesis (ATP consumption process) or increased by rapid ATP consumption It is known that ATP: activation by ATP ratio induces ATP production process. Activated AMPK is known to phosphorylate substrates in several sub-stages, thereby blocking ATP-consuming pathways such as lipid synthesis and cholesterol synthesis, and activating the ATP-producing pathway, such as fatty acid oxidation or sugar degradation (DG Hardie et al. , An important regulator of AMPK in association with lipid metabolism, has been shown to be able to catalyze the conversion of acetyl-CoA carboxyl Acetyl-CoA carboxylase (ACC) inhibits the activity of enzymes. ACC is an important enzyme that regulates lipid metabolism in various tissues such as liver and muscle. It acts as a carbonylating agent for acetyl-CoA to malonyl-CoA (BE Kemp, Biochem. Soc. Trans., 31, pp162-168, 2003) Malonyl-CoA acts as an inhibitor of CPT1 (carnitine palmitoyl transferase 1) present in the outer membrane of mitochondria, and this CPT1 activity plays an important role in the? -Oxidation of fat in mitochondria (Lehninger, Principles of Biochemistry, Cohen P., Miyazaki, M., Socci, ND, Hagge-Greenberg, A., Liedtke, W., Soukas, AA, Sharma, R., Hudgins, Worth Publishers, NY, 3rd Ed., 2000 , LC, Ntambi, JM & Friedman, JM, Science 297, 240-243, 2002). When the activation of AMPK promotes phosphorylation of ACC and inhibits the activity of the enzyme, the amount of malonyl-CoA is reduced and activation of AMPK is induced (Vavvas D et al., J. Biol. Chem., 272, pp13255- 13261, 1997). ATP production is increased by the oxidation of fatty acids. In other words, phosphorylation of ACC by activation of AMPK is important for decreasing body fat by mechanism of fatty acid oxidation. Therefore, when ACC enzyme activity is regulated by AMPK at the early stage of fatty acid synthesis, it is possible to inhibit the accumulation of fat in the body more than necessary, and consequently, weight gain can be suppressed. Furthermore, activation of AMPK also inhibits the activity of HMG-CoA reductase (the target molecule of statin, a therapeutic agent for hyperlipidemia), which implies that the synthesis of cholesterol can also be regulated by liver tissue by activating AMPK, And the effect of lowering the concentration of cholesterol can also be obtained. Therefore, when AMPK is activated, the synthesis of fat is reduced and β-oxidation is increased, and oxidation of body fat is increased, thereby reducing weight loss due to body fat reduction as well as blood triglyceride and cholesterol concentrations.

In addition, the lancemaside A, echinocystic acid, or a pharmaceutically or pharmacologically acceptable salt thereof of the present invention can be used as PPARγ (peroxisome proliferator-activated receptor-γ), C / EBPα (CCAAT / enhancer-binding protein- α), FAS (fatty acid synthase) acid synthase, SREBP-1c, FABP4 ), ACC (acetyl-CoA carboxylase), SCD1 (stearoyl-CoA desaturase-1), LPL (lipoprotein lipase) and leptin. In addition, the lancemaside A, echinocystic acid, or a pharmaceutically or pharmacologically acceptable salt thereof of the present invention is useful as a hormone sensitive lipase (HSL) when differentiating adipocytes into adipocytes. Or upregulation of expression of CPT1 (Carnitine palmitoyltransferase I). Therefore, the lancemaside A, echinocystic acid, or a pharmaceutically or pharmacologically acceptable salt thereof of the present invention can be used as an active ingredient for preventing, improving or treating obesity , And further can be used as an effective ingredient for preventing, ameliorating or treating obesity-related diseases selected from the group consisting of fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis and lipid-related metabolic syndrome. The lipid-related metabolic syndrome refers to a disease in which various metabolic diseases such as diabetes and obesity occur simultaneously in one person.

The composition of the present invention comprising lansameide A, echinocystic acid or a pharmaceutically or pharmacologically acceptable salt thereof as an active ingredient can be used as a pharmaceutical composition, food An additive, a food composition (particularly, a functional food composition), or a feed additive, and the content of the active ingredient in the composition may be adjusted in various ranges depending on the specific form of the composition, the purpose of use, and the manner of use.

A pharmaceutical composition comprising as an active ingredient a fermented green tea extract according to the present invention, a lancemaside A, an echinocystic acid, a pharmaceutically acceptable salt of ranchemide A or an echinosic acid, The content of the active ingredient is not particularly limited and may be 0.01 to 99% by weight, preferably 0.5 to 50% by weight, more preferably 1 to 30% by weight, based on the total weight of the composition. In addition, the pharmaceutical composition according to the present invention may further comprise a pharmaceutically acceptable salt of a fermented green tea extract, lancemaside A, echinocystic acid, ransemide A, or echinosilicic acid, As well as additives such as acceptable carriers, excipients or diluents. Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate , Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition for preventing or treating obesity or obesity related diseases of the present invention is a composition for preventing or treating obesity or obesity-related diseases, which comprises a fermented green tea extract, lancemaside A, echinocystic acid, lancemide A or echinosystic acid In addition to the pharmaceutically acceptable salts, one or more known active ingredients having an effect of preventing or treating obesity or obesity-related diseases may be further contained. The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or parenteral administration by a conventional method, and can be formulated into a pharmaceutical composition such as a filler, an extender, a binder, a wetting agent, a disintegrant, Diluents or excipients. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose ), Lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention may be administered orally or parenterally to a mammal including a human according to a desired method. Examples of the parenteral administration method include external dermal application, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravenous injection, Intravenous injection or intra-thoracic injection. The dosage of the pharmaceutical composition of the present invention is not limited as long as it is a pharmacologically effective amount and is not limited as long as it depends on the body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, Varies. The typical daily dose of the pharmaceutical composition of the present invention is not particularly limited, but is preferably selected from the group consisting of an effective ingredient such as a fermented green tea extract, lancemaside A, echinocystic acid, It is 0.1 to 3000 mg / kg, more preferably 1 to 2000 mg / kg, based on the pharmaceutically acceptable salt of the echinosaccharic acid, and can be administered once or several times a day.

In addition, it is also possible to provide a food comprising the fermented green tea extract of the present invention, lancemaside A, echinocystic acid, rancemycin A or a pharmaceutically acceptable salt of an echinococcus acid as an active ingredient Examples of the food include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums , Dairy products including ice cream, various soups, beverages, tea, functional water, drinks, alcoholic beverages, and vitamin complexes, all of which include health foods in a conventional sense. In the food composition of the present invention, the content of active ingredients such as fermented green tea extract, lancemaside A, echinocystic acid, rancemasonide A, or a pharmaceutically acceptable salt of an echinococcus acid Is 0.01 to 50% by weight, preferably 0.1 to 25% by weight, more preferably 0.5 to 10% by weight, based on the total weight of the composition. The food composition of the present invention may contain various flavoring agents in addition to the fermented meat extract, lancemaside A, echinocystic acid, rancemycin A or a pharmaceutically acceptable salt of an echinococcus acid, Natural carbohydrates and the like as additional components. In addition, the food composition of the present invention can be used as a food composition containing various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, , A carbonating agent used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The above-mentioned natural carbohydrates are sugar alcohols such as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and xylitol, sorbitol and erythritol. Natural flavors such as tau Martin and stevia extract, and synthetic flavors such as saccharin and aspartame may be used as the flavor.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Preparation of Root Root Extract, Ferment Root Root Extract and Compounds Isolated from It

Preparation Example 1: Preparation of roots extract

35 kg of 80% aqueous ethanol solution was added to 3.5 kg of dried roasted ground roots, extracted with reflux cooling method at 90 ° C for about 3 hours, and then filtered with a filter paper to separate the extract and the residue. Then, 35 liters of 80% ethanol aqueous solution was added to the remaining residue, and the extract was repeatedly extracted three times in the same manner to obtain an extract. The extract was combined with the extract obtained previously and concentrated under reduced pressure to obtain about 263.54 g of Duckweed extract.

Production Example 2: Preparation of fermented green tea extract

Bacillus subtilis KCTC 1022 and Bacillus coagulans KCTC 3625, both of which were sold in 5 liter of liquid TSB medium (Tryptic Soy Broth) from the Microorganism Resource Center (Scientific & And incubated for about 24 hours. Thereafter, the culture broth was centrifuged to remove the medium, and cells were obtained. Thereafter, 500 g of the dried root powder was suspended in 5 L of water, and the cells were inoculated thereto, followed by culturing for about 72 hours to prepare a fermented product. Then, 5 L of ethanol was added to the fermentation product of Dulbecco's yeast extract, which was then extracted with a reflux condenser at 90 DEG C for about 2 hours, and then filtered through a filter paper to separate the fermented Duluck extract and the residue. Thereafter, 2 L of a 50% ethanol aqueous solution was added to the remaining residue, and the mixture was extracted with a reflux cooling method at 90 DEG C for 1 hour to obtain an extract. The extract was combined with the extract obtained previously and concentrated under reduced pressure to obtain about 73.2 g of a fermented extract .

Preparation Example 3: Preparation of lancemaside A from dodec

The duckweed extract obtained in Preparation Example 1 was suspended in 0.4 L of distilled water, 2 L of n-butanol was added thereto, and the mixture was shaken and left to separate into a water-soluble fraction layer and an n-butanol-soluble fraction layer. Thereafter, the n-butanol soluble fraction layer was taken and concentrated under reduced pressure to obtain about 104.02 g of the n-butanol soluble fraction. Thereafter, the n-butanol-soluble fraction of Dullofume extract was subjected to silica gel column chromatography (Merck, 12 (trade name)) with two elution solvents (chloroform: methanol: water = 120: 35: 10; chloroform: methanol: Cm 占 60 cm, 63 to 200 占 퐉) to obtain four small fractions. Reverse-phase silica gel column chromatography (Merck, 7 cm x 40 cm, 40 to 60 μm) was carried out on 61.71 g of the fourth small fraction (Fr. IV) out of the four small fractions using 20% aqueous methanol solution as elution solvent to obtain 6 Lt; / RTI > The fifth small fraction (Fr. IV-5) out of the six small fractions was recrystallized from methanol to obtain 720 mg of Compound 1 in the form of brown needle crystals. The structure of the compound 1 was analyzed by ¹ H-NMR (Bruker, AVANCE digital 400) and ¹³ C-NMR (Bruker, AVANCE digital 400) and found to be lancemaside A having the chemical structure of FIG. 1 .

<Ransemade A>

^{1 H-NMR (600 ㎒,} C 57 H 90 O 26) δ: 5.37 s, 5.37 s, 5.36 s, 5.36 s, 5.35 s, 5.03 d (7.45), 4.8 s, 4.58 d (4.57), 4.52 s, 4.52 s , 4.50 s , 4.50 s , 4.51 s , 4.41 s , 4.39 s , 4.37 s , 4.31 s , 4.27 dd (2.65, 5.30), 4.21 s , 4.19 s, 4.16 s, 4.11 m, 4.02 m, 4.01 m, 4.01 m, 3.99 m, 3.92 d (3.84), 3.64 s, 3.54 m, 3.41 s, 3.05 dd (2.41, 2.03), 2.65 s, 2.30 s , 2.27 s, 2.24 s, 1.99 s, 1.93 s, 1.91 s, 1.89 s, 1.80 s, 1.79 s, 1.71 s, 1.68 s, 1.56 s, 1.42 s, 1.39 s, 1.39 s , 1.37 s , 1.36 s , 1.29 s , 1.28 s , 1.12 s , 1.03 s , 0.97 s , 0.96 s , 0.88 s , 0.80 s , 0.77 s.

¹³ C-NMR (150 MHz, C ₅₇ H ₉₀ O ₂₆ )?: 175.9, 175.8, 143, 122.4, 105.5, 105, 104.8, 99.9, 92.5, 89.7, 86.2, 82.2, 76.4, 76.3, 74.4, 73.8, 73.6 , 73.2, 71.9, 71, 70.7, 70.5, 70, 69.7, 69.5, 68.3, 67.5, 62.3, 55.8, 48.9, 47.1, 46.8, 46.2, 41.3, 40.7, 38.6, 38.4, 37.4, 36.4, 35.6, 35.5, 35.3 , 34.9, 32.9, 32, 30.5, 29.9, 27.1, 26, 25.7, 23.8, 23.1, 18, 16.9, 16.6, 15.7, 14.8

2. In-vivo experiments on anti-obesity efficacy of roots extract

(1) Experimental method

Twenty four male C57BL / 6J mice were infected with chow diet (CD; Purina, Korea) for 1 week at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. Then, the experimental animals were divided into two groups, and the normal diets (CON, n = 6) were fed a general diet of 4.5% of the total calories for 7 weeks. In the high fat diet group (n = 18) (D12492, Research Diets, New Brunswick, NJ) were fed for 7 weeks to induce obesity. The high fat diets were divided into three groups (HF, HF + LCL, and HF + HCL) in groups of 6 animals fed with high fat diet, and the high fat diets were fed to the HF group and the distilled water was orally administered for 7 weeks. Group and the HF + HCL group were supplied with a high fat diet, and the extract of Duckweed obtained in Preparation Example 1 was dissolved in distilled water and orally administered in different amounts for 7 weeks. In addition, the normal diets were fed with the general diet and the distilled water was orally administered for 7 weeks.

(2) Measurement items and measurement results

The body weight and the dietary intake of the experimental animals were measured at a constant time every day during the whole experimental period, and the results are shown in Table 1 below. FIG. 4 is a graph showing the effect of roeae extract on the body weight change of a model animal in which obesity was induced by a high fat diet by experimental groups.

Experimental group CON HF HF + LCL HF + HCL Initial weight (g) 24.5 ± 0.8 26.9 ± 0.4 27.1 ± 0.4 27.0 + - 0.4 Final weight (g) 27.3 ± 1.0 37.8 ± 1.3 33.6 ± 0.7 33.3 ± 1.3 Weight gain (g) 4.1 ± 0.9 11.5 ± 1.1 7.3 ± 0.7 7.1 ± 1.7 Weight gain (%) 16.6 ± 3.5 42.7 ± 3.6 27.0 ± 2.3 26.5 ± 6.3 Dietary intake (g) 4.1 ± 0.1 2.9 ± 0.01 3.1 ± 0.1 2.9 ± 0.02

* CON: general dietary supplement group

* HF: high fat diet group

* HF + LCL: High fat diet and dodeca extract administered at 1 g / kg body weight

* HF + HCL: high fat diet and dodeca extract of 2.5 g / kg body weight

As shown in Table 1, the body weight of the high fat diet group was significantly increased after 7 weeks of induction of obesity than that of the normal diet group. On the other hand, in the group to which Orthodox extract was orally administered in combination with the high fat dietary supplement, the dietary intake was not significantly different from that in the high fat dietary group, but the weight increase and the weight increase rate were low, It is known that it has efficacy.

3. In-vivo experiments on the anti-obesity effect of Fermented Duck Duck Extract

(1) Experimental method

Twenty four male C57BL / 6J mice were infected with chow diet (CD; Purina, Korea) for 1 week at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. Then, the experimental animals were divided into two groups, and the normal diets (CON, n = 6) were fed a general diet of 4.5% of the total calories for 7 weeks. In the high fat diet group (n = 18) (D12492, Research Diets, New Brunswick, NJ) were fed for 7 weeks to induce obesity. The high fat diet group was divided into three groups (HF, HF + LFCL, and HF + HFCL) by 6 groups. The high fat diets were fed to the HF group and the distilled water was orally administered for 7 weeks. Group and the HF + HFCL group were fed with a high fat diet, and the fermented Duckweed extract obtained in Preparation Example 2 was dissolved in distilled water and orally administered in different amounts for 7 weeks. In addition, the normal diets were fed with the general diet and the distilled water was orally administered for 7 weeks.

(2) Measurement items and measurement results

Body weights and dietary intakes of the animals were measured at a constant time every day throughout the experiment. The feed efficiency ratio (FER) was calculated by dividing the weight gain during the same period by the dietary intake over the same period. Table 2 shows the results of measurement of body weight change, dietary intake and dietary efficiency according to the experimental group.

Experimental group CON HF HF + LFCL HF + HFCL Initial weight (g) 25.2 ± 0.5 28.8 ± 0.7 29.1 ± 0.7 29.7 ± 1.1 Final weight (g) 28.2 ± 0.5 39.5 ± 1.6 34.1 ± 0.9 33.5 ± 1.4 Weight gain (g) 3.0 ± 0.2 9.7 ± 0.8 5.0 ± 0.8 3.8 ± 1.0 Weight gain (%) 11.9 ± 0.8 33.7 ± 2.0 17.2 ± 2.7 12.8 ± 3.2 Dietary intake (g) 3.5 ± 0.1 2.8 ± 0.1 2.7 ± 0.1 2.9 ± 0.02 Dietary efficiency 0.02 0.001 0.06 ± 0.004 0.03 ± 0.006 0.02 0.008

* CON: general dietary supplement group

* HF: high fat diet group

* HF + LFCL: fed with high fat diet and fed 1 g / kg body weight of Fusarium oxysporum extract

* HF + HFCL: fed with high fat diet and fermented Duck Duck extract with a body weight of 2.5 g / kg

As shown in Table 2 above, the body weight of the high fat dietary group was significantly increased after 7 weeks of induction of obesity than that of the normal dietary group. On the other hand, in the group fed with the high fat diet and the fermented Duck Duck extract, there was no significant difference in the dietary intake compared to the group fed only the high fat diet, but the weight gain and weight gain were low, It has an excellent anti-obesity effect. In addition, the anti-obesity effect of the fermented Ferret extract obtained in Preparation Example 2 was about 35 to 50% higher than the anti-obesity effect of Ferret extract obtained in Preparation Example 1, based on the same dose.

4. In-vivo experiments on anti-obesity efficacy of lancemaside A

(1) Experimental method

A total of 36 C57BL / 6J male mice were weighed on a chow diet (CD; Purina, Korea) for 1 week at a temperature of 20 ± 2 ° C, a humidity of 50 ± 5% and a light- Adapted. Thereafter, the experimental animals were divided into two groups and fed a regular diet of 4.5% of the total calories in the normal diet group (CON, n = 9) for 8 weeks. In the high fat diet group (n = 27) (D12451, Research Diets, New Brunswick, NJ) were fed for 8 weeks to induce obesity. HF, LF, HF, HF, HF, LF, HF, LF, HF, LF, HF, LF, HF, Group and HF + HLA group were fed a high fat diet, while the racemase A obtained in Preparation Example 3 was dissolved in distilled water and orally administered in different amounts for 9 weeks. In addition, the normal diet group was fed with the general diet and the distilled water was orally administered for 9 weeks.

(2) Methods and measurement results of body weight, dietary intake and diet efficiency

Body weights and dietary intakes of the animals were measured at a constant time every day throughout the experiment. The feed efficiency ratio (FER) was calculated by dividing the weight gain during the same period by the dietary intake over the same period. Table 3 below shows the results of measurement of body weight change, dietary intake and dietary efficiency according to the experimental group. FIG. 5 is a graph showing the effect of ransemide A on body weight change of a model animal in which obesity was induced by a high fat diet according to experimental groups.

Experimental group CON HF HF + LLA HF + HLA Initial weight (g) 25.4 ± 0.6 29.9 ± 0.8 29.4 ± 0.8 29.8 ± 1.0 Final weight (g) 28.5 ± 0.6 39.3 ± 1.5 34.5 ± 1.0 33.4 ± 1.5 Weight gain (g) 3.1 ± 0.2 9.4 ± 0.8 5.1 ± 0.8 3.6 ± 1.0 Weight gain (%) 12.2 ± 0.9 31.1 ± 2.1 17.6 ± 2.9 12.0 ± 3.3 Dietary intake (g) 3.6 ± 0.1 2.8 ± 0.1 2.6 ± 0.1 2.9 ± 0.02 Dietary efficiency 0.02 0.001 0.06 ± 0.005 0.03 ± 0.007 0.02 0.009

* CON: general dietary supplement group

* HF: high fat diet group

* HF + LLA: High-fat dietary supplement and 10 mg / kg body weight dose of ranzemide A

* HF + HLA: High-fat dietary supplement and 20 mg / kg body weight dose of rancemide A

As shown in Table 3, in the group administered orally with ranchemide A together with the high fat diet after induction of obesity, the dietary intake was not significantly different from the group fed only with the high fat diet after induction of obesity, Weight gain and diet efficiency were very low. From this, it can be seen that ransemide A has an excellent anti-obesity effect.

(3) Measurement of weight change of liver and adipose tissue

The animals were sacrificed by cardiac puncture and the subcutaneous fat (SF), epididymal fat (EF), and kidney circumference Perirenal fat (PF), mesenteric fat (MF), brown adipose tissue (BAT) and liver were weighed and weighed.

FIGS. 6, 7, 8, 9, 10 and 11 show the results of analysis of the liver, subcutaneous fat tissue, epididymal fat tissue, kidney fat tissue, mesenteric fat tissue, The effect of rancemide A on the weight of brown adipose tissue is shown graphically by experimental group. 6 to 11, " CON "represents a normal diet group fed with a general diet," HF "represents a high fat dietary supplement group," HF + LLA "represents a high fat dietary supplement and a 10 mg / "HF + HLA" represents a high-fat diet and a dose of 20 mg / kg body weight of rancemide A. As shown in Figs. 6 to 11, the weight of all adipose tissues was significantly decreased in ranchomaside A treated group compared to the group fed only high fat diets.

(4) Oral glucose tolerance test (OGTT)

Oral glucose tolerance test was performed on experimental animals that induced obesity and administered ransemide A for 9 weeks. After completion of the experiment, the animals were fasted for 6 hours, and glucose was orally administered at a dose of 2 g / kg body weight. Blood was collected from the tail at 0, 15, 30, 60, Were measured. During the oral glucose load test, the animals were provided with a stable environment and water was allowed to ingest freely. The area under the glucose-time curve (AUC) was calculated using the following formula.

AUC = 0.5 占 0.5 C0 + C15 + C30 + C60 + C90 + 0.5 占 C120)

C0, C15, C30, C60, C90 and C120 are the glucose concentrations measured at 0 minute, 15 minutes, 30 minutes, 60 minutes, 90 minutes and 120 minutes, respectively.

FIG. 12 is a graph showing the effect of ransemide A on the oral glucose load test of a model animal in which obesity was induced by a high fat diet, and FIG. 13 is a graph showing an oral glucose load test result of FIG. glucose-time curve. 12 to 13, "CON" represents a normal diet group fed with a general diet, "HF" represents a high fat dietary supplement group, "HF + LLA" represents a high fat dietary supplement and a 10 mg / Semase A group. As shown in FIG. 12 to FIG. 13, blood glucose level and AUC of the group administered with high-fat dietary supplement and rancemase A were significantly lower than those fed only high-fat diets, We approximated the value of the dietary group.

(5) Measurement method and measurement result of lipid metabolism related signal change

(AMP-activated protein kinase) and p-ACC (AMP-activated protein kinase) in experimental liver tissues were investigated in order to investigate the effect of high fat dietary supplementation and actin administration on the activation and related signal changes of AMPK (Phosphorylated Acetyl-CoA carboxylase) levels were measured by Western blot analysis. Effects of high fat diet and actin on the activation and related signal changes of PPARγ, C / EBPα, and FAS (fatty acid synthase) (Peroxisome proliferator-activated receptor), C / EBP alpha (CCAAT-enhancer-binding protein alpha) and FAS (fatty acid synthase) levels in experimental liver tissues were measured by Western blot analysis Respectively.

After completion of the experiment, the liver tissues of the experimental animals were incubated with RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP-1) supplemented with protease inhibitor (Roche, USA), phosphatase inhibitor (Roche), and phenylmethanesulfonylfluoride 40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA) and centrifuged at 14,000 rpm for 15 minutes to obtain supernatant. Proteins were separated from the supernatant by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The separated protein samples were transferred to a PVDF membrane (Millipore, USA). After the sample was transferred, PVDF membrane was blocked with 5% skim milk (Difco, France) for 1 hour and 30 minutes in TBS-T buffer. The PPARγ (peroxisome proliferator-activated receptor-γ), C / EBPα AMP-activated protein kinase (AMPK), p-ACC (phospho-acetyl-CoA carboxylase), ACC (fatty acid synthase), p-AMPK (primary antibody) or β-actin primary antibody (Santa Cruz biotechnology, USA) to acetyl-CoA carboxylase and shaking The reaction was allowed to proceed overnight. After washing with TBS-T buffer, secondary antibody was diluted at a ratio of 1: 5000 and reacted for 1 hour and 30 minutes. We used goat anti-rabbit IgG (H + L) -HRP conjugate (BIORAD) as a secondary antibody to detect PPARγ, C / EBPα, FAS, p-AMPK, AMPK, p-ACC and ACC. In addition, goat anti-mouse IgG (H + L) -HRP conjugate (BIORAD) was used as a secondary antibody to detect β-actin. After washing with TBS-T buffer and reacting with ECL solution (Clarity western ECL substrate, BIORAD), proteins were detected by chemiluminescence (CLINX science instruments, USA). The density of each band was quantitated, and the level of expression of each protein was normalized to β-actin. The amount of protein expression in the other experimental groups was calculated on the basis of the protein expression level of the normal diet group.

14 shows the results of measurement of the expression level of p-AMPK protein in liver tissues by Western blot analysis to examine the effect of rancemase A on model animals in which obesity was induced by high fat diet, Which is a multiple of the expression amount of protein in the dietary group. 14, "CON" represents a group of normal diets supplemented with a general diet, "HF" represents a high fat dietary supplement group, "HF + LLA" represents a high fat dietary dietary supplement and a losemide A , "HF + HLA" represents a high fat dietary supplement and a dose of 20 mg / kg body weight of rancemide A. As shown in Fig. 14, lancemide A was found to increase phosphorylation of AMPK lowered by high fat diet.

15 shows the expression levels of PPARγ, C / EBPα and FAS protein in liver tissues by Western blot analysis in order to examine the effect of ransemide A on model animals in which obesity was induced by high fat diet And a multiple of the protein expression amount of the normal diet group. 15, "CON" represents a normal diet group fed with a general diet, "HF" represents a high fat dietary supplement group, "HF + LLA" represents a high fat dietary fat diet and a losemide A , "HF + HLA" represents a high fat dietary supplement and a dose of 20 mg / kg body weight of rancemide A. As shown in Fig. 15, the levels of PPARgamma, C / EBPa and FAS protein were lower in the ranchomaide A group than in the high fat diet group only, as compared with the high fat diet group.

(6) Analysis of gene expression level related to lipid metabolism

To investigate the effect of high fat dietary supplement and ransemide A on the expression level of lipid metabolism related genes, total RNA was extracted from liver tissue and epididymal adipose tissue of experimental animals, and then PPARγ, C / EBPα, FAS (fatty acid CoA desaturase-1 (SCPL), LPL (lipoprotein lipase), MCAD (coenzyme A), and SADB-1c (fatty acid binding protein 4) mRNA levels of medium chain acyl-CoA dehydrogenase, HSL (hormone sensitive lipase), ATGL (adipose triglyceride lipase) and leptin were confirmed by real-time PCR. Specifically, after the end of the experiment, liver tissue or epididymal adipose tissue of the experimental animals was homogenized in Trizol solution, and RNA was isolated using conventional RNA extraction method. CDNA was synthesized using 1 μg of extracted RNA and PrimeScript ™ RT reagent kit (Takara, Japan). Real-time PCR was performed using SYBR® Premix EX Taq assay ™ and the primers shown in Table 4 below. GAPDH was used as a reference gene.

Target mRNA Primer direction The primer sequence (5 '- &gt; 3') GAPDH Forward CAACAGCAACTCCCACTCTTC Reverse GGTCCAGGGTTTCTTACTCCTT PPARγ Forward CCAGAGCATGGTGCCTTCGCT Reverse CAGCAACCATTGGGTCAGCTC C / EBPα Forward GAACAGCAACGAGTACCGGGT Reverse GCCATGGCCTTGACCAAGGAG SREBP-1c Forward CGCTACCGGTCTTCTATCATTG Reverse TTGCTTTTGTGTGCACTTCG FAS Forward GCTTTGCTGCCGTGTCCTTCT Reverse TCTAGCCCTCCCGTACACTCA FABP4 Forward TCACCTGGAAGACAGCTCCT Reverse AATCCCCATTTACGCTGATG ACC Forward GGACAGACTGATCGCAGAGAAAG Reverse TGGAGAGCCCCACACACA SCD1 Forward CCTACGACAAGAACATTCAATC Reverse TTCTCTTAATCCTGGCTCAGAC LPL Forward AGTAGACTGGTTGTATCGGG Reverse AGCGTCATCAGGAGAAAGG MCAD Forward GATCGCAATGGGTGCTTTTGATAGAA Reverse AGCTGATTGGCAATGTCTCCAGCAAA HSL Forward GGTGACACTCGCAGAAGACAATA Reverse GCCGCCGTGCTGTCTCT ATGL Forward GACCTGATGACCACCCTTTC Reverse TGCTACCCGTCTGCTCTTT Leptin Forward CTATGCCACCTTGGTCACCT Reverse ACCAAACCAAGCATTTTTGC

FIG. 16 is a graph showing the effect of mRNA levels of SREBP-1c, FABP4, ACC, SCD1 and LPL in liver tissue when rancemase A was administered to a model animal in which obesity was induced by high fat diet, And the mRNA levels of MCAD, HSL and ATGL in liver tissue when ran sicamide A was administered to a model animal in which obesity was induced by dietary administration. 18 shows the effect of mRNA levels of PPARγ, C / EBPα, SREBP-1c, FAS, FABP4, ACC, SCD1 and LPL in epididymal adipose tissue when ranchomaide A was administered to a model animal in which obesity was induced by high fat diet Fig. 16 to 18, "CON" represents a group of normal diets supplemented with a general diet, "HF" represents a high fat dietary group, "HF + LLA" represents a high fat dietary supplement, "HF + HLA" represents a high-fat diet and a dose of 20 mg / kg body weight of rancemide A. As shown in FIG. 16 to FIG. 18, Lancesmaid A down-regulates mRNA levels of PPARγ, C / EBPα, SREBP-1c, FAS, FABP4, ACC, SCD1 and LPL genes involved in lipogenesis, The HSL mRNA level of the gene that is involved in the regulation of the gene.

5. In-vitro experiments on the antiobesity effect of lancemaside A

(1) Experimental method

3T3-L1 precursor adipocytes were purchased from Korean Cell Line Bank and used for the experiment. 3T3-L1 progenitor adipocytes are widely used to study the metabolic processes of adipocytes. As the differentiation of these cells becomes more active, the accumulation of adipocytes in the adipocytes leads to obesity. Therefore, when a substance expected to have an anti-obesity effect is treated on the cell, the smaller the differentiation of the cell, the greater the anti-obesity effect.

3T3-L1 mouse precursor adipocytes were seeded at a density of 2 × 10 ⁴ / ml in a 12-well plate and cultured at 37 ° C and 5% CO ₂ . In this case, 3T3-L1 complete media [DMEM / high glucose (Thermo scientific, USA), newborn calf serum (Thermo scientific), 1% penicillin-streptomycin solution (Thermo scientific)] was used until 100% Respectively. At the 100% confluency point, they were maintained for another 2 days. After 2 days of incubation with MDI media (DMEM / high glucose, 10% fetal bovine serum, 1% penicillin-streptomycin solution, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethazone, 5 μg / (1% penicillin-streptomycin solution, 5 ㎍ / ㎖ insulin) was added 2 days after the induction of differentiation. Lt; / RTI &gt; After that, the cells were replaced with growth medium (DMEM / high glucose, 10% fetal bovine serum, 1% penicillin-streptomycin solution) every 2 days for 4 days to complete differentiation into adipocytes. On the other hand, from the day when differentiation of 3T3-L1 precursor adipocytes into adipocytes was induced, ricemasaide A was treated at a concentration of 1.25, 2.5, 5, 10, and 20 uM for 8 days every 2 days, On day 8, the degree of differentiation into adipocytes was observed. At this time, ransemide A was dissolved in dimethylsulfoxide to prepare a stock, which was diluted to various concentrations.

(2) Oil red O dyeing and analysis

To confirm the accumulation of fat after induction of differentiation into the fat cells of pre - adipocytes, pre - adipocytes and adipocytes obtained by differentiating them for 8 days were subjected to oil red O staining. The degree of differentiation of adipocytes into adipocytes was firstly confirmed by microscopy through Oil Red O staining and the amount of fat accumulation was quantitatively determined by measuring the absorbance at 520 nm using a spectrophotometer.

FIG. 19 is an oil red O staining image showing the effect of differentiation pattern of Ranchemase A on the induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes. As shown in FIG. 19, ranchemide A inhibited lipid peroxidation in a concentration-dependent manner upon induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes.

(3) Analysis of total neutral lipid content

The amount of total neutrophils contained in precursor adipocytes and adipocytes obtained by differentiating them for 8 days was measured. On the eighth day after the induction of adipocyte differentiation, the precursor adipocyte culture medium was washed three times with PBS to remove the culture medium, and 0.5 ml of PBS-10 mM EDTA (pH 7.4) solution was added to homogenize the differentiated adipocytes. After dilution of the adipocyte homogenate, proteins were quantitated by the BCA method (Thermo scientific). Prepare a test tube treated with prehexane to have a protein concentration of 150 μg per 300 μl, add 2 ml of an isopropanol-hexane-water (80: 20: 2 v / v / v) mixed solvent, And allowed to stand at room temperature for 30 minutes. Thereafter, 500 μl of a mixed solvent of hexane-diethyl ether (1: 1 v / v) was added, stirred vigorously for 30 seconds or more, covered with foil, and allowed to stand at room temperature for 10 minutes. Then, 1 ml of distilled water was added, stirred vigorously, covered with foil, and allowed to stand at room temperature for 20 minutes. Then, about 900 μl of the supernatant was taken and transferred to a test tube which had been previously washed with hexane and dried. Thereafter, the organic solvent was volatilized in the presence of nitrogen gas, and 20 μl of isopropanol was added to the test tube and stirred to sufficiently dissolve the neutral lipid on the wall of the test tube. Then, the neutral lipid (Trigylceride) content was measured using a kit for measuring neutral lipids ((Bio Clinical System, Korea).

FIG. 20 is a graph showing the effect of trandemic side A on the triglyceride content in differentiated adipocytes when inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. FIG. As shown in Fig. 20, rancemide A inhibited the generation of neutrophil in the concentration-dependent induction of differentiation of 3T3-L1 precursor adipocytes into adipocytes.

(4) Analysis of lipid metabolism-related protein levels

AMP-activated protein kinase (AMPK) and AMP-activated protein kinase (AMPK) in differentiated adipocytes were examined in order to investigate the effect of ranchemide A treatment on lipid metabolism-related protein levels during differentiation of preadipocytes kinase, p-ACC (phospho-acetyl-CoA carboxylase), PPAR gamma (peroxisome proliferator-activated receptor), C / EBP alpha (CCAAT- enhancer- Western blot analysis.

The adipocytes obtained by differentiating the adipocytes were cultured in RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% NP, pH 7.4) supplemented with protease inhibitor (Roche, USA), phosphatase inhibitor (Roche) and phenylmethanesulfonylfluoride -40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA) and centrifuged at 14,000 rpm for 15 minutes to obtain supernatant. Proteins were separated from the supernatant by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The separated protein samples were transferred to a PVDF membrane (Millipore, USA). ATP-activated protein kinase (AMPK), AMPK-activated protein kinase (AMPK), and AMPK-activated protein kinase (AMPK) were incubated for 2 h with 5% skim milk (Difco, France) protein kinase), p-ACC (phospho-acetyl-CoA carboxylase), PPAR gamma (peroxisome proliferator-activated receptor-?), C / EBP? (CCAAT / enhancer- A primary antibody (Santa Cruz biotechnology, USA) for primary antibody or β-actin was diluted at a ratio of 1: 500 and the cells were shaken overnight, Lt; / RTI &gt; After washing with TBS-T buffer, the secondary antibody was diluted at a predetermined ratio and reacted for 2 hours. (H + L) -HRP conjugate (BIORAD) as a secondary antibody to detect p-AMPK, AMPK, p-ACC, PPARγ, C / EBPα and FAS Respectively. In addition, goat anti-mouse IgG (H + L) -HRP conjugate (BIORAD) was diluted at a ratio of 1: 1000 as a secondary antibody for detecting β-actin. After washing with TBS-T buffer and reacting with ECL solution (Clarity western ECL substrate, BIORAD), proteins were detected by chemiluminescence (CLINX science instruments, USA). The density of each sensitized band was quantitated by gel analysis V2.02 (CLINX science instruments, USA), and the density of adipocytes obtained by differentiating precursor adipocytes without treatment with ransemide A Values were relatively expressed.

FIG. 21 is a graph showing quantitative results obtained by Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the PPARgamma protein level. FIG. 22 shows the results of Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of C / EBPα protein and a quantitative graph to be. FIG. 23 is a graph showing quantitative results obtained by Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes by Ranchemase A treatment and FAS protein level change. 24 shows the results of Western blot analysis of the effect of 3S3-L1 preadipocyte differentiation on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of p-AMPk protein, to be. 25 shows the results of Western blot analysis of the effects of 3S3-L1 precursor adipocytes on the induction of differentiation into adipocytes and the effect of rancemase A treatment on the level of p-AMC protein, and a quantitative graph to be. As shown in FIGS. 21 to 23, when differentiating precursor adipocytes into adipocytes, lanchemase A showed a concentration-dependent decrease in the level of PPARγ, C / EBPα, and FAS protein, which are major factors controlling lipogenesis . In addition, as shown in Figs. 24 and 25, rancemide A increased phosphorylation of AMPK and phosphorylation of ACC, which is a downstream target thereof.

(5) Analysis of gene expression level related to lipid metabolism

In the differentiation stage of adipocytes from adipocytes, the expression level of C / EBPα and PPARγ increases as adipocyte differentiation progresses, and the expression level of most adipokines increases. After the differentiation of the precursor adipocytes for 8 days, the lipid metabolism related genes PPARγ, C / EBPα, FAS (fatty acid synthase), SREBP-1c (sterol regulatory element binding protein-1c), FABP4 MRNA levels of ACC (acetyl-CoA carboxylase), SCD1 (stearoyl-CoA desaturase-1), LPL (lipoprotein lipase), CPT1 (Carnitine palmitoyltransferase I) and leptin were confirmed by real-time PCR. Specifically, 3T3-L1 precursor adipocytes were washed twice with PBS, and cell pellets were collected and RNA was isolated using Trizol. CDNA was synthesized using 1 μg of extracted RNA and PrimeScript ™ RT reagent kit (Takara, Japan). Real-time PCR was performed using SYBR® Premix EX Taq assay ™ and the primers shown in Table 5 below, and GAPDH was used as a reference gene.

Target mRNA Primer direction The primer sequence (5 '- &gt; 3') GAPDH Forward CAACAGCAACTCCCACTCTTC Reverse GGTCCAGGGTTTCTTACTCCTT PPARγ Forward CCAGAGCATGGTGCCTTCGCT Reverse CAGCAACCATTGGGTCAGCTC C / EBPα Forward GAACAGCAACGAGTACCGGGT Reverse GCCATGGCCTTGACCAAGGAG SREBP-1c Forward CGCTACCGGTCTTCTATCATTG Reverse TTGCTTTTGTGTGCACTTCG FAS Forward GCTTTGCTGCCGTGTCCTTCT Reverse TCTAGCCCTCCCGTACACTCA FABP4 Forward TCACCTGGAAGACAGCTCCT Reverse AATCCCCATTTACGCTGATG ACC Forward GGACAGACTGATCGCAGAGAAAG Reverse TGGAGAGCCCCACACACA SCD1 Forward CCTACGACAAGAACATTCAATC Reverse TTCTCTTAATCCTGGCTCAGAC LPL Forward AGTAGACTGGTTGTATCGGG Reverse AGCGTCATCAGGAGAAAGG CPT1 Forward CTATGCCACCTTGGTCACCT Reverse ACCAAACCAAGCATTTTTGC Leptin Forward CTATGCCACCTTGGTCACCT Reverse ACCAAACCAAGCATTTTTGC

FIG. 26 is a graph showing the effect of 3S3-L1 precursor adipocytes on induction of differentiation into adipocytes, and FIG. 27 is a graph showing the effect of 3S3-L1 preadipocytes on the induction of differentiation into adipocytes FIG. 28 is a graph showing the effect of ranchemide A treatment on the mRNA level of C / EBPα. FIG. 28 is a graph showing the effect of rancemase A treatment on the mRNA level of SREBP-1c when inducing differentiation into 3T3-L1 precursor adipocytes FIG. 29 is a graph showing the effect of 3S3-L1 precursor adipocytes on the level of mRNA of FAS when inducing differentiation into adipocytes, and FIG. 30 is a graph showing the effect of 3S3-L1 preadipocyte FIG. 31 is a graph showing the effect of Rancemasaide A treatment on the mRNA level of FABP4 when inducing differentiation into adipocytes. FIG. 31 is a graph showing the effect of Rancemasaide A treatment on the induction of differentiation of 3T3-L1 preadipocytes into adipocytes. FIG. 32 is a graph showing the effect of trandemic A treatment on the mRNA level of SCD1 in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes, FIG. 33 is a graph showing the effect of 3T3-L1 FIG. 34 is a graph showing the effect of Ranchemase A treatment on the level of LPL mRNA in inducing the differentiation of preadipocytes into adipocytes. FIG. 34 is a graph showing the effect of Rancemasaide A treatment on the induction of differentiation of 3T3-L1 preadipocytes into adipocytes Leptin mRNA level. Fig. 35 is a graph showing the effect of treatment with ransemase A on the mRNA level of CPT1 in inducing differentiation of 3T3-L1 precursor adipocytes into adipocytes. As shown in FIGS. 26 to 35, when differentiating the precursor adipocytes into adipocytes, actin is involved in lipogenesis-related genes PPARγ, C / EBPα, FAS (fatty acid synthase), sterol regulatory element binding protein-1c ), FABP4 (fatty acid binding protein 4), ACC (acetyl-CoA carboxylase), SCD1 (stearoyl-CoA desaturase-1), LPL (lipoprotein lipase) and leptin , Whereas it upregulated the mRNA level of CPT1 (Carnitine palmitoyltransferase I), a lipid-related gene.

6. Preparation of pharmaceutical composition containing fermented extract

In the preparation of the following pharmaceutical compositions, the fermented extract may be replaced by lancemaside A or its aglycon echinocystic acid.

<6-1> Manufacture of powder

20 mg of the fermentation product of Preparation Example 2

Lactose 100 mg

10 mg of talc

The above components were mixed and packed in airtight bags to prepare powders.

<6-2> Preparation of tablets

10 mg of the fermentation product of Preparation Example 2

Corn starch 100 mg

100 mg of milk

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

&Lt; 6-3 > Preparation of capsules

10 mg of the fermentation product of Preparation Example 2

3 mg of crystalline cellulose

15 mg of milk

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

&Lt; 6-4 >

10 mg of the fermentation product of Preparation Example 2

Lactose 150 mg

100 mg of glycerin

Xylitol 50 mg

After mixing the above components, they were prepared so as to be 4 g per one ring according to a conventional method.

<6-5> Production of granules

15 mg of the fermentation product of Preparation Example 2

Soybean extract 50 mg

200 mg of glucose

600 mg of starch

After mixing the above components, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in a capsule.

<6-6> Preparation of Injection

10 mg of the fermentation product of Preparation Example 2

Sodium metabisulphite 3.0 mg

Methyl paraben 0.8 mg

0.1 mg of propylparaben

Sterile sterilized water for injection

After mixing the above ingredients, 2 ml of the mixture was filled in an ampoule and sterilized to prepare an injection.

7. Preparation of Food Composition Containing Fermented Whole Root Extract

In the preparation of the following food composition, the fermented green tea extract can be replaced by lancemaside A or its aglycon echinocystic acid.

<7-1> Production of flour food

To 100 parts by weight of wheat flour, 0.5 part by weight of the fermentation product of Preparation Example 2 was added to wheat flour, and the mixture was used to prepare bread, cake, cookies, crackers and noodles.

<7-2> Manufacture of dairy products

To 100 parts by weight of milk, 0.5 part by weight of the fermented product of Preparation Example 2 was added to milk, and the milk was used to make various dairy products such as butter and ice cream.

<7-3> Manufacturing of Sunshine

Brown rice, barley, glutinous rice, and yulmu were dried by a known method and dried, and the mixture was granulated to a powder having a particle size of 60 mesh.

Black soybeans, black sesame seeds, and perilla seeds were steamed and dried by a conventional method, and then they were prepared into powder having a particle size of 60 mesh by a pulverizer.

The grains, seeds, and fermentation products of Preparation Example 2 prepared above were blended in the following proportions.

(30 parts by weight of brown rice, 17 parts by weight of yulmu, 20 parts by weight of barley)

Seeds (7 parts by weight of perilla, 8 parts by weight of black beans, 7 parts by weight of black sesame seeds)

The fermentation product (1 part by weight) of Preparation Example 2,

(0.5 part by weight),

(0.5 parts by weight)

<7-4> Production of health drinks

(1 g) of the fermentation product of Preparation Example 2 was homogeneously mixed with a raw material such as liquid fructose (0.5 g), oligosaccharide (4 g), sugar (2 g), salt (0.5 g) Sterilized, and packaged in glass bottles, plastic bottles, and other small containers.

<7-5> Manufacture of vegetable juice

A vegetable juice was prepared by adding 2 g of the fermentation product of Preparation Example 2 to 1,000 ml of tomato or carrot juice.

<7-6> Manufacture of fruit juice

Fruit juice was prepared by adding 1 g of the fermentation product of Preparation Example 2 to 1,000 ml of apple or grape juice.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Therefore, the scope of the present invention should be construed as including all embodiments falling within the scope of the appended claims.

Claims (6)

A composition comprising, as an active ingredient, at least one selected from lancemaside A, echinocystic acid, or a pharmaceutically acceptable salt thereof,
Obesity, fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis, or lipid-related metabolic syndrome in which the diseases occur simultaneously.
The pharmaceutical composition of claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier.
2. The pharmaceutical composition according to claim 1, wherein the lancemaside A or the echinocystic acid is separated from the duckuck.
A composition comprising, as an active ingredient, at least one selected from lancemaside A, echinocystic acid or a pharmaceutically acceptable salt thereof,
Obesity, fatty liver, type 2 diabetes, hyperlipidemia, cardiovascular disease, arteriosclerosis, or lipid-related metabolic syndrome in which these diseases occur simultaneously.
5. The food composition of claim 4, wherein the composition further comprises a pharmaceutically acceptable carrier.
The food composition according to claim 4, wherein the lancemaside A or echinocystic acid is separated from the duckuck.

Images