KR20060013868A - Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes - Google Patents

Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes Download PDF

Info

Publication number
KR20060013868A
KR20060013868A KR1020040062475A KR20040062475A KR20060013868A KR 20060013868 A KR20060013868 A KR 20060013868A KR 1020040062475 A KR1020040062475 A KR 1020040062475A KR 20040062475 A KR20040062475 A KR 20040062475A KR 20060013868 A KR20060013868 A KR 20060013868A
Authority
KR
South Korea
Prior art keywords
gastric cancer
genes
expression
gastric
group
Prior art date
Application number
KR1020040062475A
Other languages
Korean (ko)
Other versions
KR100645979B1 (en
Inventor
김남순
김정민
김용성
윤선영
오정화
이주연
양진옥
염영일
유향숙
김주헌
송규상
노승무
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020040062475A priority Critical patent/KR100645979B1/en
Publication of KR20060013868A publication Critical patent/KR20060013868A/en
Application granted granted Critical
Publication of KR100645979B1 publication Critical patent/KR100645979B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57446—Specifically defined cancers of stomach or intestine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 위암 유전자 마커 및 이를 이용한 위암 진단킷트에 관한 것으로서, 더욱 상세하게는 수집된 ESTs(expressed sequence tags)로부터 위암관련 신규 유전자를 밝히고 이 유전자가 배열된 cDNA 마이크로어레이를 이용하여 위 조직 내에 발생하는 위암에 대한 고발현 유전자와 저발현 유전자의 발현정도를 측정하여 위암 진단에 매우 유용하게 사용될 수 있도록 개발된 위암 진단방법 및 진단킷트에 관한 것이다.The present invention relates to a gastric cancer gene marker and a gastric cancer diagnostic kit using the same. More specifically, the present invention discloses a novel gene related to gastric cancer from collected ESTs (expressed sequence tags) and is generated in gastric tissue using a cDNA microarray in which the gene is arranged. The present invention relates to a method and diagnostic kit for gastric cancer, which is developed to measure the expression level of high and low expression genes for gastric cancer.

위암, 유전자 마커, cDNA 마이크로어레이, 진단킷트Gastric cancer, Gene markers, cDNA microarrays, Diagnostic kits

Description

위암 유전자 마커 및 이를 이용한 위암 진단킷트{DETECTION KIT FOR GASTRIC CARCINOMA BY MEASURING THE EXPRESSION OF GASTRIC CARCINOMA-RELATED GENES} Gastric cancer gene marker and gastric cancer diagnostic kit using same {DETECTION KIT FOR GASTRIC CARCINOMA BY MEASURING THE EXPRESSION OF GASTRIC CARCINOMA-RELATED GENES}             

도 1은 선별한 20종의 유전자의 발현정도를 경쟁적(competitive) RT-PCR 방법으로 정상 위 세포주(Hs 677.St)와 위암 세포주(SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638, SNU-668, SNU-719)에서 수행한 것이고,1 shows the expression level of 20 selected genes in a competitive gastric cell line (Hs 677.St) and gastric cancer cell lines (SNU-1, SNU-16, SNU-216, SNU-484) by a competitive RT-PCR method. , SNU-601, SNU-638, SNU-668, SNU-719),

도 2는 선별한 20종 중에서 임의로 선별한 12종의 유전자의 발현정도를 정상 위 조직과 위암 조직에서 경쟁적 RT-PCR 방법을 수행한 것이다[X축은 위암 진행단계별로 정상 위 조직과 암조직을 나타내고, Y축은 유전자 발현값을 베타-엑틴 발현값으로 나눈 값임].Figure 2 shows the expression of 12 genes randomly selected from the 20 selected species were performed in a competitive RT-PCR method in normal gastric and gastric cancer tissue [X-axis shows normal gastric tissue and cancer tissue according to the stage of gastric cancer progression , Y-axis is the gene expression value divided by the beta-actin expression value.

도 3은 위암 고발현 유전자 중 CDC20 과 SKB1의 발현을 정상 위 세포주(Hs 677.St)와 위암 세포주(SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638, SNU-668, SNU-719)에서 웨스턴블랏팅(Western Blotting)으로 확인한 결과이다.Figure 3 shows the expression of CDC20 and SKB1 in high gastric cancer genes of normal gastric cell line (Hs 677.St) and gastric cancer cell lines (SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638). , SNU-668, SNU-719) is confirmed by Western Blotting.

도 4는 위암 고발현 유전자 중 CDC20과 SKB1의 발현을 위암 환자로부터 절제한 임상 조직시료에서 면역조직화학 염색법으로 확인한 결과이다.Figure 4 shows the results of immunohistochemical staining in clinical tissue samples resected from gastric cancer patients with the expression of CDC20 and SKB1 in gastric cancer high expression genes.

본 발명은 위암 유전자 마커 및 이를 이용한 위암 진단킷트에 관한 것으로서, 더욱 상세하게는 수집된 ESTs(expressed sequence tags)로부터 위암관련 신규 유전자를 밝히고 이 유전자가 배열된 cDNA 마이크로어레이를 이용하여 위 조직 내에 발생하는 위암에 대한 고발현 유전자와 저발현 유전자의 발현정도를 측정하여 위암 진단에 매우 유용하게 사용될 수 있도록 개발된 위암 진단방법 및 진단킷트에 관한 것이다.The present invention relates to a gastric cancer gene marker and a gastric cancer diagnostic kit using the same. More specifically, the present invention discloses a novel gene related to gastric cancer from collected ESTs (expressed sequence tags) and is generated in gastric tissue using a cDNA microarray in which the gene is arranged. The present invention relates to a method and diagnostic kit for gastric cancer, which is developed to measure the expression level of high and low expression genes for gastric cancer.

위암(gastric carcinoma)은 한국 및 일본 등의 아시아에서 발생하는 가장 흔한 암으로서 사망률 1위를 나타내는 암이다[Parkin 등, Int. J. Cancer 80: 827-841, 1999; Neugut 등, Semin. Oncol. 23: 281-291, 1996]. 위암과 관련한 유전자에 대해서 많이 보고되지 않고 있으나, 최근에는 분자적 생물학적 분석을 사용하여 p53[Yokozaki 등, Int. Rev. Cytol. 204: 49-95, 2001], β-카테닌[박 등, Cancer Res. 59: 4257-4260, 1999], E-카데린[Berx 등, Hum. Mutat. 12: 226-237, 1998], 삼엽형 인자 1(trefoil factor 1)[박 등, Gastroenterology 119: 691-698, 2000], c-met[이 등, Oncogene 19: 4947-4953, 2000], Rnux3[Li 등, Cell 109: 113-124]와 같은 유전자들이 위암에서 유전적으로 많이 변이되어 있다는 것이 확인, 보고되고 있다. 또한, CA11[Yoshikawa 등, Jpn. J. Cancer Res. 91: 459-463, 2000; Shiozaki 등, Int. J. Oncol. 19: 701-707, 2001]과 위장 점막에서 합성되는 삼엽형 인자(trefoil factor)인 TFF1과 TFF2[Shiozaki 등, Int. J. Oncol. 19: 701-707, 2001; Kirikoshi 등, Int. J. Oncol. 21: 655-659, 2002]과 같은 유전자들이 위암에서 저발현된다는 보고도 있다. 그러나, 위암 발암과정(carcinogenesis)에서의 일반적인 공통경로(common pathway)와 위암의 진행에 관해서는 많이 보고되지 않았다. Gastric carcinoma is the most common cancer that occurs in Asia, including Korea and Japan. It is the cancer with the highest mortality rate [Parkin et al. , Int. J. Cancer 80: 827-841, 1999; Neugut et al., Semin. Oncol . 23: 281-291, 1996. Although there have not been many reports on genes related to gastric cancer, recently, molecular and biological assays have been used for p53 [Yokozaki et al. , Int. Rev. Cytol. 204: 49-95, 2001] β-catenin [Pak et al., Cancer Res . 59: 4257-4260, 1999, E-cadherin [Berx et al . , Hum. Mutat . 12: 226-237, 1998], trefoil factor 1 [Pak et al., Gastroenterology 119: 691-698, 2000], c-met [Lee et al., Oncogene 19: 4947-4953, 2000], Rnux3 Genes such as [Li et al., Cell 109: 113-124] have been identified and reported to be genetically altered in gastric cancer. In addition, CA11 [Yoshikawa et al . , Jpn. J. Cancer Res. 91: 459-463, 2000; Shiozaki et al. , Int. J. Oncol. 19: 701-707, 2001] and TFF1 and TFF2 [Shiozaki et al. , Int. J. Oncol. 19: 701-707, 2001; Kirikoshi et al. , Int. J. Oncol. 21: 655-659, 2002] have been reported to be low expression in gastric cancer. However, not much has been reported about the common pathway in gastric carcinogenesis and the progression of gastric cancer.

cDNA 마이크로어레이 방법은 1회의 실험으로 수많은 유전자의 발현양상을 동시에 연구하는데 사용되는 방법이다[DeRisi 등, Nat. Genet. 14: 457-460, 1996; Duggan 등, Nat. Genet. 21: 10-14, 1999]. 이러한 cDNA 마이크로어레이 방법을 사용하여 다양한 질병과 암에서의 유전자 발현양상에 대한 결과가 보고되고 있다[Ross 등, Nat. Genet. 24: 227-235, 2000; Wikman 등, Oncogene 21: 5804-5813, 2002; Han 등, Cancer Res. 62: 2890-2896, 2002; Jiang 등, Oncogene 21: 2270-2282]. 또한, 위암 관련 연구에서도 cDNA 마이크로어레이 방법이 사용되어 위암 세포주와 악성 조직(malignant tissues)에서의 S100A4, CDK4, MMP1 및 β-카테닌 유전자의 발현이 증가되고, GIF 유전자는 감소된다는 것이 보고되고 있다[El-Rifai 등, Int. J. Cancer 92: 832-838, 2001]. 이외에도, cDNA 마이크로어레이 방법을 이용한 위암 조직과 정상조직의 유전자 발현의 차이에 관한 보고도 있었고[이 등, Cancer Lett. 184: 197-206, 2002; Boussioutas 등, Cancer Res. 63: 2569-2577, 2003], 위암환자의 예후를 판단하는 보고도 있었다[Inoue 등, Clin. Cancer Res. 8: 3475-3479, 2002]. The cDNA microarray method is a method used to simultaneously study the expression patterns of numerous genes in one experiment [DeRisi et al . , Nat. Genet. 14: 457-460, 1996; Duggan et al . , Nat. Genet. 21: 10-14, 1999]. Results of gene expression patterns in various diseases and cancers have been reported using this cDNA microarray method [Ross et al . , Nat. Genet. 24: 227-235, 2000; Wikman et al., Oncogene 21: 5804-5813, 2002; Han et al . , Cancer Res. 62: 2890-2896, 2002; Jiang et al., Oncogene 21: 2270-2282]. In addition, studies on gastric cancer have been reported to increase the expression of S100A4, CDK4, MMP1, and β-catenin genes in the gastric cancer cell lines and malignant tissues, and to reduce the GIF gene. El-Rifai et al. , Int. J. Cancer 92: 832-838, 2001. In addition, there were reports of differences in gene expression of gastric cancer tissues and normal tissues using the cDNA microarray method . 184: 197-206, 2002; Boussioutas et al., Cancer Res. 63: 2569-2577, 2003], there have been reports of judging the prognosis of gastric cancer patients [Inoue et al. , Clin. Cancer Res. 8: 3475-3479, 2002.

본 발명에서는 위암 시료로부터 수집된 ESTs 중에서 위암에서 발현되는 신규 유전자로 판단되는 1,995개의 유전자를 마이크로어레이 고형지지체에 배열시 키고, 이를 이용한 cDNA 마이크로어레이 분석을 통하여 위암 관련 유전자를 1차적으로 선별한 후, 최종적으로 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자를 위암 관련 신규 유전자로 발굴하였다. 이들은 위암과의 관련성이 전혀 보고되지 않은 것으로 현재 이들 유전자에 대해 알려진 내용은 다음과 같다. 위암에서 발현이 증가되는 유전자를 먼저 알아보면, CKS1B(CDC28 protein kinase regulatory subunit 1B)은 사이클린 의존 인산화효소(cyclin dependent kinase)의 촉매 부분(catalytic subunit)에 해당하는 단백질로 세포주기(cell cycle)에 관여하며, CKS1은 위암 조직에서 발현이 증가된다고 보고되고 있다[El-Rifai 등, Int. J. Cancer 92: 832-838, 2001; Hippo 등, Cancer Res. 62: 233-240, 2002]. D1S155E(NRAS-related gene)는 UNR(upstream of NRAS)로 알려져 있는 유전자로서, 종양형성 기니픽 세포(tumorigenic guinea pig cells)에서 처음 분리되었고, NRAS(neuroblastoma ras viral oncogene homolog)와 같이 조절(coordinately regulation)되는 것으로 추정되어 암과의 연관성이 보고되고 있다[Doniger 등, Nucleic Acids Res. 16: 969-980, 1998]. FKBP4(FK506-binding protein 4(59kD)는 이뮤노필린(immunophilin) 단백질의 일종으로, 면역조절과 단백질 접힘(folding)에서 중요한 기능을 하고, 또한 유방암에서 발현이 증가된다고 보고되고 있다[Ward 등, Breast Cancer Res. Treat. 58: 267-280, 1999]. SKB1(SKB1 homolog)은 세포 극성(cell polarity)의 조절[Wiley 등, J. Biol. Chem. 278: 25256-25263, 2003]과 유사분열(mitosis)[Gilbreth 등, Proc. Natl. Acad. Sci. USA 95: 14781-14786, 1998]의 조절에서 역할을 하는 것으로 알려져 있지만, 현재 까지 발암(Oncogenesis)과의 연관성은 보고되고 있지 않다. NT5C3(5' nucleotidase, cytosolic III)은 핵산 대사경로에 관여하는 효소로서 보통염색체 열성 용혈 빈혈(autosomal recessive hemolytic anemia)을 야기시키는 것으로 알려져 있다[Marinaki 등, Blood 97: 3327-3332, 2001]. p30(nuclear protein p30)은 쥐 간 핵(rat liver nuclei)으로부터 정제된 뉴클레오포린 프랙션(nucleoporin fraction)의 성분으로 분리되었지만[Cronshaw 등,J. Cell Biol. 158 : 915-927, 2002], 아직 기능은 알려져 있지 않다. GPI(glucose phosphate isomerase)는 췌장암에서 저산소증(hypoxia)하에서 유도되는 것이 보고되었고[Yoon 등, Biochem. Biophys. Res. Commun. 288: 882-886, 2001], PRO2000(PRP2000 protein)은 골육종(osteosarcoma)세포에서 항 종양 약제(anti-cancer drug) 처리시에 약제 관련(drug-related) 유전자로 보고되었다[Fellenberg 등, Int. J. Cancer 105: 636-643, 2003]. CDC20(CDC20 cell division cycle 20 homolog)은 세포주기(cell cycle) 구성성분이고, 이 유전자의 과발현이 췌장암에서 보고되었고[Li 등, Clin. Cancer Res. 9: 991-997, 2003], 또한 이 유전자의 발현변화가 폐암의 초기에 발견되었다[Singhal 등, Cancer Biol. Ther. 2: 291-298]. FEN1(flap structure-specific endonuclease 1)은 DNA 합성(synthesis)과 수복(repair)에 관여하는 효소로서, 이 유전자의 과발현이 생쥐(mouse)에서 위장관(gastrointestinal tract)암의 빠른 암진행을 유도하고[Kucherlapati 등, Proc. Natl. Acad. Sci. USA 99: 9924-9929, 2002], 또한 폐암 세포주에서 과발현되는 것으로 보고되고 있다[Sato 등, Oncogene 22: 7243-7246, 2003]. 또한, ZNF9(zinc finger protein 9)은 근육긴 장 퇴행위축(myotonic dystrophy)에 관련되어 있고[Liquori 등, Science 293: 864-867, 2001], RPS16(ribosomal protein 16)은 40S 서브유닛(subunit)의 성분으로 리보조말 단백질(ribosomal protein)을 코딩하고, 인간 전립선 암 세포에서 발현이 보고되고 있다[Karan 등, Carcinogenesis 23: 967-975, 2002]. 위암에서 발현이 감소되는 유전자를 알아보면, LGALS1(lectin, galactose-binding, soluble, 1)은 세포사멸(cell apoptosis)과 세포분화(cell differentiation)에 관여하는 것으로 알려져 있고, 이 유전자의 과발현이 대장암[Hittelet 등, Int. J. Cancer 103: 370-379, 2003]과 췌장암[Berberat 등, J. Histochem. Cytochem. 49: 539-549]에서 보고되고 있지만, 위암에서는 아직까지 보고되고 있지 않다. PEA15(phosphoprotein enriched in astrocytes 15)는 포도당 전달(glucose transport)에 관여하고, 제2형 당뇨병(type 2 diabetes mellitus)에서 과발현되는 것으로 보고되고 있다[Condorelli 등, EMBO J. 17: 3858-3866, 1998]. SEC61A1(protein transport protein SEC61A alpha subunit isoform 1)은 막성 단백질(membrane protein)과 분비성(secretory protein)의 조립(assembly)에 필요한 것으로 보고되고 있고, 암과는 관련성은 전혀 보고되고 있지 않다. MT2A(metallothionein 2A)는 중금속 결합 저분자량 단백질로 알려져 있고, 금속을 비독성화시키는 작용을 하며, 반응산소로부터 방어작용을 하는 메탈로티오네인(methallothionein)의 일종으로 알려져 있다. 또한, 이 유전자는 유방암[Jin 등, Carcinogenesis 23: 81-86, 2002]과 식도암[Cui 등, Biochem. Biophys. Res. Commun. 302: 904-915, 2003]에서 과발현되는 것으로 보고되고 있다. MAGED2(melanoma antigen, family D, 2)는 유방암 관련 유전자로, 유방암 조직에서 발현되는 것으로 보고되고 있다[Kurt 등, Breast Cancer Res. Treat 59: 41-48, 2000]. NPDC1(neural proliferation differentiation and control, 1)은 신경세포(neural cell) 증식과 분화에 중요한 역할을 하는 것으로 제시되고 있다[Qu 등, Gene 264: 37-44, 2001]. CXX1(CAAX box 1)은 CAAX motif를 가지고 있다는 사실만이 보고되고 있다. 나머지 FLJ34386은 아직 기능이 보고되고 있지 않다.In the present invention, 1,995 genes determined to be new genes expressed in gastric cancer among the ESTs collected from the gastric cancer samples are arranged in a microarray solid support, and the primary cancer genes are first selected through cDNA microarray analysis using the same. Finally, 12 types of gastric cancer high expression genes and 8 types of gastric cancer low expression genes were identified as new genes related to gastric cancer. They have not been reported to be associated with gastric cancer at this time. The first expression of genes with increased expression in gastric cancer is CKS1B (CDC28 protein kinase regulatory subunit 1B), a protein that corresponds to the catalytic subunit of cyclin dependent kinase. CKS1 is reported to have increased expression in gastric cancer tissues [El-Rifai et al. , Int. J. Cancer 92: 832-838, 2001; Hippo et al., Cancer Res . 62 : 233-240, 2002. D1S155E (NRAS-related gene) is a gene known as the upstream of NRAS (UNR), first isolated from tumorigenic guinea pig cells, and coordinated regulation, such as the neuroblastoma ras viral oncogene homolog (NRAS). Has been reported to be associated with cancer [Doniger et al., Nucleic Acids Res. 16: 969-980, 1998]. FKBP4 (FK506-binding protein 4 (59kD)) is a type of immunophilin protein that plays an important role in immunoregulation and protein folding and is reported to increase expression in breast cancer [Ward et al. Breast Cancer Res. Treat. 58: 267-280, 1999] .SKB1 (SKB1 homolog) is a mitosis similar to the regulation of cell polarity [Wiley et al. , J. Biol. Chem. 278: 25256-25263, 2003] . mitosis [Gilbreth et al . , Proc. Natl. Acad. Sci. USA 95: 14781-14786, 1998], although known to play a role in the regulation of oncogenesis, has not been reported to date. (5 'nucleotidase, cytosolic III) is an enzyme involved in nucleic acid metabolic pathways and is known to cause autosomal recessive hemolytic anemia (Marinaki et al., Blood 97: 3327-3332, 2001). nuclear protein p30) is a nucleoporin frag purified from rat liver nuclei. Although isolated as a component of the nucleoporin fraction (Cronshaw et al., J. Cell Biol. 158 : 915-927, 2002), the function is not yet known Gglucose phosphate isomerase (GPI) is induced under hypoxia in pancreatic cancer [Yoon et al. , Biochem. Biophys. Res. Commun. 288: 882-886, 2001], PRO2000 (PRP2000 protein) has been reported to be effective in the treatment of anti-cancer drugs in osteosarcoma cells. Reported as a drug-related gene [Fellenberg et al. , Int. J. Cancer 105: 636-643, 2003]. CDC20 (CDC20 cell division cycle 20 homolog) is a cell cycle component and overexpression of this gene has been reported in pancreatic cancer [Li et al. , Clin. Cancer Res. 9: 991-997, 2003], and also a change in expression of this gene was found early in lung cancer [Singhal et al . , Cancer Biol. Ther. 2: 291-298. FEN1 (flap structure-specific endonuclease 1) is an enzyme involved in DNA synthesis and repair. Overexpression of this gene induces rapid cancer progression of gastrointestinal tract cancer in mice. Kucherlapati et al . , Proc. Natl. Acad. Sci. USA 99: 9924-9929, 2002, and is also reported to be overexpressed in lung cancer cell lines [Sato et al., Oncogene 22: 7243-7246, 2003]. In addition, zinc finger protein 9 (ZNF9) is involved in myotonic dystrophy [Liquori et al., Science 293: 864-867, 2001], and ribosomal protein 16 (RPS16) is a 40S subunit. Ribosomal protein is encoded as a component of and expression in human prostate cancer cells has been reported (Karan et al., Carcinogenesis 23: 967-975, 2002). In genes with reduced expression in gastric cancer, LGALS1 (lectin, galactose-binding, soluble, 1) is known to be involved in cell apoptosis and cell differentiation. Cancer [Hittelet et al. , Int. J. Cancer 103: 370-379, 2003] and pancreatic cancer [Berberat et al . , J. Histochem. Cytochem. 49: 539-549, but not yet in gastric cancer. Phosphoprotein enriched in astrocytes 15 (PEA15) are involved in glucose transport and are reported to be overexpressed in type 2 diabetes mellitus [Condorelli et al., EMBO J. 17: 3858-3866, 1998 ]. SEC61A1 (protein transport protein SEC61A alpha subunit isoform 1) has been reported to be required for the assembly of membrane and secretory proteins, and no association with cancer has been reported. MT2A (metallothionein 2A) is known as a heavy metal-binding low molecular weight protein, is a kind of metallothionein (methallothionein) that acts to detoxify the metal, and defends from reactive oxygen. In addition, this gene has been described in breast cancer [Jin et al. , Carcinogenesis 23: 81-86, 2002] and esophageal cancer [Cui et al. , Biochem. Biophys. Res. Commun. 302: 904-915, 2003]. MAGED2 (melanoma antigen, family D, 2) is a breast cancer-related gene and has been reported to be expressed in breast cancer tissues [Kurt et al., Breast Cancer Res. Treat 59: 41-48, 2000]. NPDC1 (neural proliferation differentiation and control, 1) has been suggested to play an important role in neural cell proliferation and differentiation [Qu et al., Gene 264: 37-44, 2001]. Only the fact that CXX1 (CAAX box 1) has a CAAX motif is reported. The rest of the FLJ34386 has yet to be reported.

이에, 본 발명자들은 위암 시료로부터 수집된 ESTs 중에서 위암에서 발현되는 신규 유전자로 판단되는 1,995개의 유전자를 마이크로어레이 고형지지체에 배열시키고, cDNA 마이크로어레이 분석을 수행하여 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자를 찾아내고, 경쟁적 RT-PCR 방법, 웨스턴블랏팅법, 면역조직화학 염색법을 이용하여 위암 세포주와 위암 임상 조직시료에서 위암 고발현 유전자와 저발현 유전자를 확인함으로써 본 발명을 완성하게 되었다.Accordingly, the present inventors arranged 1,995 genes, which are determined to be new genes expressed in gastric cancer, among ESTs collected from gastric cancer samples in a microarray solid support, and performed cDNA microarray analysis to perform 12 kinds of gastric cancer high expression genes and 8 kinds. The present invention was completed by identifying the low expression genes of gastric cancer and identifying the high and low expression genes of gastric cancer cell lines and gastric cancer clinical tissue samples using competitive RT-PCR, Western blotting, and immunohistochemical staining. It became.

따라서, 본 발명은 위암 조직에서 특이적으로 발현되는 유전자들의 발현정도 측정을 이용한 위암 진단방법을 제공하는데 그 목적이 있다.Therefore, an object of the present invention is to provide a method for diagnosing gastric cancer using measurement of expression levels of genes specifically expressed in gastric cancer tissues.

또한, 본 발명은 위암 조직에서 특이적으로 발현되는 유전자들의 발현정도 측정을 이용한 위암 진단킷트를 제공하는데 또 다른 목적이 있다.
In addition, the present invention is another object to provide a gastric cancer diagnostic kit using the expression level measurement of genes specifically expressed in gastric cancer tissue.

본 발명은 20종의 위암 특이적 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1 중에서 선택된 하나 이상의 유전자에 대한 발현 정도의 측정을 통하여 위암을 진단하는 위암 진단방법 및 진단킷트를 그 특징으로 한다.The present invention provides 20 kinds of gastric cancer specific genes, CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX Gastric cancer diagnostic method and diagnostic kit for diagnosing gastric cancer by measuring the expression level of one or more genes selected from the features.

이와 같은 본 발명을 보다 상세히 설명한다.This invention will be described in more detail.

본 발명은 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 대한 발현 정도의 측정을 통하여 위암을 진단하는 위암 진단킷트에 관한 것이다.The present invention is one or more genes selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16, and gastric cancer specific low expression The present invention relates to a gastric cancer diagnostic kit for diagnosing gastric cancer by measuring expression levels of one or more genes selected from the group consisting of genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1, and CXX1.

본 발명의 위암 마커 유전자는 위암 조직에서 고발현되거나 저발현되는 유전자의 전장 및 그의 단편을 포함한다.Gastric cancer marker genes of the present invention include the full length and fragments of genes that are highly or low expression in gastric cancer tissues.

또한, 본 발명에 따른 진단킷트는 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자의 정방향 프라이머 및 역방향 프라이머와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자의 정방향 프라이머 및 역방향 프라이머를 포함한다. In addition, the diagnostic kit according to the present invention is one or more genes selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 Forward and reverse primers and forward and reverse primers of at least one gene selected from the group consisting of gastric cancer specific low expression genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1.

또한, 본 발명에 따른 진단킷트는 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 상보적인 프로브와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 상보적인 프로브를 포함한다. In addition, the diagnostic kit according to the present invention is at least one gene selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 Complementary probes and probes complementary to one or more genes selected from the group consisting of gastric cancer specific low expression genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1.

또한, 본 발명에 따른 진단킷트는 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질을 인식하는 항체와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질을 인식하는 항체를 포함한다. In addition, the diagnostic kit according to the present invention is at least one gene selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 Antibody that recognizes a protein encoded by the protein and one or more genes selected from the group consisting of gastric cancer specific low expression genes, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1, and CXX1. Antibody.

또한, 상기 항체, 기질, 적당한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체, 발색 기질 등을 포함할 수 있다.In addition, the antibody, the substrate, a suitable buffer, a secondary antibody labeled with a coloring enzyme or a fluorescent material, it may include a coloring substrate and the like.

상기에서 기질은 니트로셀룰로오즈 막, 폴리비닐(Polyvinyl) 수지로 합성된 96 웰 플레이트(96 well plate), 폴리스티렌(Polystyrene) 수지로 합성된 96 웰 플레이트 및 유리로 된 슬라이드글라스 등이 사용될 수 있고, 발색효소는 퍼옥시데이즈(peroxidase), 알칼라인 포스파테이즈(Alkaline Phosphatase)가 사용될 수 있고, 형광물질은 FITC, RITC 등이 사용될 수 있고, 발색기질액은 ABTS(2, 2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) 또는 OPD(o-Phenylenediamine), TMB(Tetramethyl Benzidine)가 사용될 수 있다.The substrate may be a nitrocellulose membrane, a 96 well plate synthesized with a polyvinyl resin, a 96 well plate synthesized with a polystyrene resin, a slide glass made of glass, and the like. The enzyme may be used peroxidase, alkaline phosphatase (Alkaline Phosphatase), the fluorescent material may be used FITC, RITC, etc., the color substrate is ABTS (2, 2'-Azino-bis (3) -ethylbenzothiazoline-6-sulfonic acid), or OPD (o-Phenylenediamine) or TMB (Tetramethyl Benzidine) can be used.

본 발명에서 확인된 위암 고발현 유전자 12종의 서열정보는 다음 표 1에 나타낸 바와 같고, 위암 저발현 유전자 8종의 서열정보는 다음 표 2에 나타낸 바와 같다.Sequence information of the 12 stomach cancer high expression genes confirmed in the present invention is as shown in Table 1, the sequence information of the eight stomach cancer low expression genes is shown in Table 2 below.

유전자gene 길이Length CDS(단백질 영역)CDS (protein region) 위치location GenBank Accession No.GenBank Accession No. CKS1BCKS1B 717717 10, 24910, 249 1q21.21q21.2 NM_001826NM_001826 D1S155ED1S155E 35823582 421, 2733421, 2733 1p221p22 NM_007158NM_007158 FKBP4FKBP4 22512251 154, 1533154, 1533 12p13.3312p13.33 NM_002014NM_002014 SKB1SKB1 24132413 92, 200592, 2005 14q11.2-q2114q11.2-q21 NM_006109NM_006109 NT5C3NT5C3 15731573 92, 95292, 952 7p14.37p14.3 NM_016489NM_016489 p30p30 11911191 64, 89164, 891 17p11.217p11.2 NM_181716NM_181716 GPIGPI 20752075 104, 1780104, 1780 19q13.119q13.1 NM_000175NM_000175 PRO2000PRO2000 49164916 91, 426391, 4263 8q24.138q24.13 NM_014019NM_014019 CDC20CDC20 16861686 111, 1610111, 1610 1p34.11p34.1 NM_001255NM_001255 FEN1FEN1 22652265 373, 1515373, 1515 11q1211q12 NM_004111NM_004111 ZNF9ZNF9 15001500 103, 636103, 636 3q213q21 NM_003418NM_003418 RPS16RPS16 621621 104, 544104, 544 19q13.219q13.2 NM_001020NM_001020

유전자gene 길이Length CDS(단백질 영역)CDS (protein region) 위치location GenBank Accession No.GenBank Accession No. LGALS1LGALS1 526526 69, 47669, 476 22q13.122q13.1 NM_002305NM_002305 PEA15PEA15 24862486 194, 586194, 586 1q21.11q21.1 NM_003768NM_003768 FLJ34386FLJ34386 21192119 unknownunknown 12q13.212q13.2 AK091705AK091705 SEC61A1SEC61A1 35713571 251, 1522251, 1522 3q21.33q21.3 BC002951BC002951 MT2AMT2A 372372 58, 24358, 243 16q1316q13 NM_005953NM_005953 MAGED2MAGED2 20802080 100, 1920100, 1920 Xp11.2Xp11.2 NM_014599NM_014599 NPDC1NPDC1 15541554 215, 1192215, 1192 9q34.39q34.3 NM_015392NM_015392 CXX1CXX1 12091209 335, 964335, 964 Xq26Xq26 NM_003928NM_003928

본 발명에서는 위암 시료로부터 수집된 ESTs 중에서 위암 발현 신규 유전자로 판단되는 1,995개의 유전자를 마이크로어레이 고형지지체에 배열시키고, cDNA 마이크로어레이 분석을 수행하여 12종의 위암 고발현 유전자(CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16)와 8종의 위암 저발현 유전자(LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1, CXX1)를 각각 선별하여 위암 마커 유전자를 찾아내었다.In the present invention, 1,995 genes determined to be new genes for gastric cancer expression among ESTs collected from gastric cancer samples are arranged in a microarray solid support, and cDNA microarray analysis is performed to determine 12 kinds of gastric cancer genes (CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16) and eight types of gastric cancer low expression genes (LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1, CXX1), respectively. I found it.

cDNA 마이크로어레이 분석에 사용된 정상 위 세포주와 위암 세포주 시료에서 본 발명의 위암 고발현 유전자 12종과 위암 저발현 유전자 8종의 발현량을 정량적 RT-PCR 방법에 의해 비교한 결과, 12종의 위암 고발현 유전자는 위암 세포주 시료에서 고발현됨이 관찰되었고, 8종의 위암 저발현 유전자는 위암 세포주 시료에서 저발현됨이 관찰됨으로써 본 발명의 위암 마커 유전자들과 위암과의 관련성이 확인되었다. The expression levels of 12 gastric high expression genes and 8 gastric low expression genes of the present invention in samples of normal gastric and gastric cancer cell lines used for cDNA microarray analysis were compared by quantitative RT-PCR. The high expression gene was observed to be highly expressed in gastric cancer cell line samples, and eight types of gastric cancer low expression genes were observed to be low expressed in gastric cancer cell line samples, thereby confirming the association between gastric cancer marker genes of the present invention and gastric cancer.

또한, 25명의 환자에서 채취한 25쌍(정상 위 조직과 위암 조직)의 임상시료를 사용하여 위암 고발현 유전자 중에 12종과 위암 저발현 유전자 8종의 발현량을 비교한 결과, 12종의 위암 고발현 유전자 중 10종의 유전자는 정상 위 조직 임상시료에 비해 위암 조직 임상시료에서 고발현되는 경우가 많았고, 8종의 위암 저발현 유전자 중 2종의 유전자는 위암 조직 임상시료에서 저발현되는 경향을 나타내고 나머지 8종의 유전자는 자체 발현량이 적어서 발현여부를 확인할 수 없었다.In addition, twenty-five pairs (normal gastric and gastric cancer tissues) collected from 25 patients were used to compare the expression levels of 12 types of gastric cancer high expression genes and 8 types of low gastric cancer expression genes. Ten genes of high expression genes were more frequently expressed in gastric cancer tissue samples than normal gastric tissue samples, and two of eight gastric cancer low expression genes tend to be low in gastric cancer tissue samples. The remaining eight genes were not able to confirm their expression due to their small amount of expression.

본 발명에서 제시한 위암 진단마커 유전자의 임상적인 유용성을 검증하는 한 방법으로 정상 위 세포주와 위암 세포주 시료에서는 웨스턴블랏팅을 이용하고, 위암 환자의 조직 시료에서 면역조직화학 염색법을 이용하여 진단마커 유전자 중 이미 항체가 확보되어 있는 CDC20과 SKB1 항체로 발현을 확인한 결과, 두 종류 모두 위암 세포주와 위암 조직 시료에서 발현이 현저히 증가됨이 확인되었다.As a method of verifying the clinical utility of the gastric cancer diagnostic marker gene according to the present invention, Western blotting is used for normal gastric and gastric cancer cell samples and immunohistochemical staining is performed on tissue samples of gastric cancer patients. As a result of confirming the expression with the CDC20 and SKB1 antibodies which have already secured the antibody, it was confirmed that the expression of both types was significantly increased in gastric cancer cell lines and gastric cancer tissue samples.

따라서, 20종의 위암 특이적 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1 중에서 선택된 1종 이상의 유전자의 발현 정도를 측정함으로써 위암을 진단할 수 있다. Thus, among 20 gastric cancer specific genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 Gastric cancer can be diagnosed by measuring the expression level of one or more selected genes.

또한, 본 발명에 따른 위암 특이적 유전자들의 발현 정도를 측정하여 위암을 진단하는 방법을 상세하게 설명하면 다음과 같다: 즉,In addition, the method for diagnosing gastric cancer by measuring the expression level of gastric cancer specific genes according to the present invention will be described in detail as follows:

(a) 시험 위암 조직에서 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 이루어진 군 중에서 선택된 하나 이상의 위암 고발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계;(a) measuring the expression level or protein amount of one or more gastric cancer high expression genes selected from the group consisting of CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 in test gastric cancer tissue Making;

(b) 비교 정상 위 조직에서 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 이루어진 군 중에서 선택된 하나 이상의 위암 고발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계;(b) the expression level or protein amount of one or more gastric cancer high expression genes selected from the group consisting of CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 in comparative normal gastric tissue. Measuring;

(c) 시험 위암 조직에서 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 이루어진 군 중에서 선택된 하나 이상의 위암 저발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계;(c) measuring the expression level or protein amount of one or more gastric cancer low expression genes selected from the group consisting of LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 in the test gastric cancer tissue;

(d) 비교 정상 위 조직에서 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 이루어진 군 중에서 선택된 하나 이상의 위암 저발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계; 및(d) measuring the expression level or protein amount of one or more gastric cancer low expression genes selected from the group consisting of LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 in comparative normal gastric tissue; And

(e) 상기 (a)에 의해 얻어진 측정값을 상기 (b)에서 얻어진 측정값과 비교하고, 상기 (c)에 의해 얻어진 측정값을 상기 (d)에서 얻어진 측정값과 비교하여 위암 여부를 판정하는 단계를 포함한다. (e) comparing the measured value obtained by (a) with the measured value obtained by (b), and comparing the measured value obtained by (c) with the measured value obtained by (d) to determine whether gastric cancer It includes a step.

본 발명은 총 20종의 마커 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1의 발현양은 마커 유전자 또는 그 단편에 대하여 상보적인 염기 서열을 갖는 정방향 프라이머 및 역방향 프라이머를 이용한 공지의 방법을 통하여 측정할 수 있다. 예를 들면, 경쟁적 RT-PCR 방법으로 측정할 수 있다. 이러한 프라이머는 20종 마커 유전자의 DNA 영역 중에서 단백질을 코딩하는 DNA 영역의 일부 또는 전부의 배열이 함유되고 적어도 15 bp 길이의 DNA이어야 한다. 예를 들어, 표 6에 기재된 프라이머들이 사용될 수 있다. 본 발명에서 상보적이란 적어도 15개의 연속 염기배열에서 완전히 상보적인 배열인 경우로 제한하지 않고 염기 서열상에서 70%, 바람직하게는 80% 이상의 상동성이 있으면 된다. The present invention provides a total of 20 marker genes of CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, RPS16, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 The amount of expression can be measured by a known method using forward primers and reverse primers having base sequences complementary to marker genes or fragments thereof. For example, it can be measured by a competitive RT-PCR method. Such primers contain an array of some or all of the DNA region encoding the protein among the DNA regions of the 20 marker genes and must be at least 15 bp in length. For example, the primers listed in Table 6 can be used. Complementary in the present invention is not limited to the case where the arrangement is completely complementary in at least 15 consecutive nucleotide sequences, it is only necessary to have a homology of 70%, preferably 80% or more on the base sequence.

또한, 본 발명의 20종의 마커 유전자의 발현량은 마커 유전자 또는 그 단편을 프로브로 사용한 공지의 혼성화(하이브리다이제이션) 반응을 통하여 측정할 수 있다. 예를 들면, 노던 하이브리다이제이션("Molecular Cloning - A Laboratory Manual" Cold Spring Habor Laboratory, NY, Maniatis, T. at al., 1982, section 7.37-7.52), 인시츄 하이브리다이제이션[Jacquemier 등, Bull Cancer 90: 31-8, 2003] 또는 마이크로어레이[Macgregor, Expert Rev Mol Diagn 3: 185-200, 2003] 등의 방법으로 측정할 수 있다. 프로브는 20종 유전자의 염기 서열을 함유한 통상 200 ∼ 1000 bp이며, 바람직하게는 400 ∼ 800 bp의 길이를 가진다. 염기 서열은 20종 유전자의 염기 서열과 70% 이상의 유사성을 가지면 된다. 본 발명의 마커 유전자의 프로브는 상기에서 제조된 20종의 마커 유전자의 정방향 프라이머 및 역방향 프라이머를 이용한 유전자 증폭법(PCR) 등의 통상적인 방법에 의해 제조할 수 있다.In addition, the expression amount of 20 marker genes of the present invention can be measured through a known hybridization (hybridization) reaction using a marker gene or a fragment thereof as a probe. For example, Northern hybridization ("Molecular Cloning-A Laboratory Manual" Cold Spring Habor Laboratory, NY, Maniatis, T. at al., 1982, section 7.37-7.52), in situ hybridization [Jacquemier et al., Bull Cancer 90: 31-8, 2003] or microarrays (Macgregor, Expert Rev Mol Diagn 3: 185-200, 2003). The probe is usually 200 to 1000 bp containing the nucleotide sequences of 20 genes, and preferably has a length of 400 to 800 bp. The base sequence may have 70% or more similarity with that of 20 genes. The probe of the marker gene of the present invention can be prepared by conventional methods such as gene amplification (PCR) using forward primers and reverse primers of the 20 kinds of marker genes prepared above.

또한, 상기 20종의 위암 마커 유전자의 발현량은 각 유전자에 의하여 코드되는 단백질의 양을 측정함으로써 측정할 수 있다. 상기 방법에서 단백질은 위암마커 단백질에 특이적으로 결합하는 항체를 이용하여 통상적인 ELISA 및 면역침강법 등에 의해 정량화될 수 있다.In addition, the expression amount of the 20 kinds of gastric cancer marker genes can be measured by measuring the amount of protein encoded by each gene. In the above method, the protein may be quantified by conventional ELISA and immunoprecipitation using an antibody that specifically binds to gastric cancer marker protein.

본 발명의 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자에 대한 항체는 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 여기에는 20종의 단백질에서 만들어질 수 있는 부분 펩타이드도 포함되며, 본 발명의 부분 펩타이드로는, 최소한 7개 아미노산, 바람직하게는 9개 아미노산, 더욱 바람직하게는 12개 이상의 아미노산을 포함한다. 본 발명의 항체의 형태는 특별히 제한되지 않으며 폴리클론날 항체[Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wiley & Sons Section 11.12-11.13], 모노클론날 항체[Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wiley & Sons Section 11.4-11.11] 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고 모든 면역 글로불린 항체가 포함된다. 나아가, 본 발명의 항체에는 인간화 항체(Methods in Enzymology 203, 99-121, 1991) 등의 특수항체도 포함된다. Antibodies against 12 gastric high expression genes and 8 gastric cancer low expression genes of the present invention are obtained by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene, It can be prepared by the phosphorus method. This includes partial peptides that can be made from 20 proteins, and the partial peptides of the present invention include at least 7 amino acids, preferably 9 amino acids, more preferably 12 or more amino acids. The form of the antibody of the present invention is not particularly limited and may be polyclonal antibody [Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wiley & Sons Section 11.12-11.13], monoclonal antibodies [Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. Jhon Wiley & Sons Section 11.4-11.11] or some of which are antigen-binding, are included in the antibodies of the invention and all immunoglobulin antibodies are included. Furthermore, the antibodies of the present invention also include special antibodies such as humanized antibodies (Methods in Enzymology 203, 99-121, 1991).

본 발명의 20종의 위암 마커 유전자 또는 단백질은 단독으로 또는 조합하여 위암 진단에 사용될 수 있다.Twenty gastric cancer marker genes or proteins of the present invention may be used alone or in combination to diagnose gastric cancer.

또한, 본 발명의 위암 진단킷트는 상기 위암 특이적 마커 유전자의 정방향 프라이머 및 역방향 프라이머 또는 프로브 이외에 RNA 또는 폴리 (A)+ RNA 분리 시약을 더 포함할 수 있으며, 마이크로어레이를 통하여 발현양을 조사하는 경우에는 20종 유전자의 고형지지체를 포함한다.In addition, the gastric cancer diagnostic kit of the present invention may further comprise an RNA or poly (A) + RNA separation reagent in addition to the forward primer and reverse primer or probe of the gastric cancer specific marker gene, and to investigate the expression amount through a microarray Cases include solid supports of 20 genes.

또한, 20종의 위암 마커 유전자는 발암 관련 유전자 또는 발암 억제 유전자일 가능성이 높으므로, 이러한 표적 유전자가 코딩하는 단백질에 결합하는 작은 분자의 화합물은 표적 단백질을 저해 또는 촉진하는 화합물의 후보가 될 수 있으며 이는 항암제, 치료제 등의 의약품으로 사용할 수 있다. In addition, since 20 gastric cancer marker genes are likely to be carcinogenic or carcinogenic genes, small molecule compounds that bind to the proteins encoded by these target genes may be candidates for compounds that inhibit or promote the target protein. It can be used as a medicine for anticancer drugs and treatments.

이런 화합물을 스크리닝하는 방법으로는, 상기 20종의 위암 마커 유전자가 코딩하는 단백질을 어피니티칼럼에 고정시키고 이를 피검시료와 접촉시켜 정제하는 방법[Pandya 등, Virus Res 87: 135-143, 2002], 투하이브리드법을 이용하는 방법[Fields, S and Song, O., Nature 340: 245 -246, 1989], 웨스턴블랏팅법["Molecular Cloning - A Laboratory Manual" Cold Spring Habor Laboratory, NY, Maniatis, T. at al. (1982) section 18.30-18.74], 하이스루풋스크리닝법 [Aviezer 등, J Biomol Screen 6: 171-7, 2001] 등 다수의 공지의 방법을 사용할 수 있다. 스크리닝에 사용하는 피검시료로서는 세포 추출액, 유전자라이브러리의 발현산물, 합성저분자화합물, 합성 펩타이드, 천연 화합물 등이 있으나 이에 제한되지는 않는다. As a method of screening such a compound, a method of fixing the proteins encoded by the 20 gastric cancer marker genes in an affinity column and contacting them with a test sample is purified [Pandya et al., Virus Res 87: 135-143, 2002]. , Methods of using the hybrid method [Fields, S and Song, O., Nature 340: 245-246, 1989], Western blotting ["Molecular Cloning-A Laboratory Manual" Cold Spring Habor Laboratory, NY, Maniatis, T. at al. (1982) section 18.30-18.74], a high throughput screening method [Aviezer et al., J Biomol Screen 6: 171-7, 2001] can be used. Test samples used for screening include but are not limited to cell extracts, gene library expression products, synthetic low molecular weight compounds, synthetic peptides, natural compounds, and the like.

이하, 본 발명은 다음 실시예에 의거하여 더욱 상세히 설명하겠는바, 본 발명이 이에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail based on the following examples, but the present invention is not limited thereto.

실시예 1: cDNA 마이크로어레이 분석에 의한 위암 관련 후보 유전자 검출Example 1 Detection of Candidate Genes Related to Gastric Cancer by cDNA Microarray Analysis

(1) 정상 위 세포주와 위암 세포주에서 총 RNA의 분리 (1) Isolation of Total RNA from Normal Gastric and Gastric Cancer Cell Lines

정상 위 세포주인 Hs 677.St[ATCC CRL-7407]는 10% 소혈청(Fetal Bovine Serum)[Gibco BRL 사], 페니실린(10000 U/ml)과 스트렙토마이신(10 mg/㎖)을 첨가한 DMEM[Jeil Biotech사] 배양액을 15 cm 디쉬에 30 ㎖씩 분주한 후 디쉬당 세포가 5 ×106이 되도록 접종하고 이를 37 ℃, 5% CO2가 존재하는 배양기에서 배양하였다. 위암세포주인 SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638, SNU-668 및 SNU-719[한국세포주은행]는 DMEM[Jeil Biotech사] 배양액 대신에 RPMI1640[Jeil Biotech 사] 배양액을 사용한 것을 제외하고는 상기의 조건과 같은 조건에서 배양하였다. Hs 677.St [ATCC CRL-7407], a normal gastric cell line, was supplemented with 10% bovine serum (Fetal Bovine Serum) (Gibco BRL), penicillin (10000 U / ml) and streptomycin (10 mg / ml). [Jeil Biotech Co., Ltd.] The culture solution was dispensed 30 ml each in a 15 cm dish and inoculated so that the cells per dish to 5 × 10 6 It was incubated in the incubator at 37 ℃, 5% CO 2 present. Gastric cancer cell lines SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638, SNU-668, and SNU-719 [Korea Cell Line Bank] were replaced with RPMI1640 instead of DMEM (Jeil Biotech) culture. [Jeil Biotech Co., Ltd. was cultured under the same conditions as above except that the culture solution was used.

세포의 총 RNA는 QIAGEN 킷트(RNeasy Maxi 킷트: cat#75162)를 사용하여 분리하였다. 우선, 부착 세포는 EDTA와 트립신을 이용해 회수한 후, 150 ㎕의 베타 머캅토에탄올(β-Mercaptoethanol)을 첨가한 15 ㎖의 분해 완충액(킷트 내 포함)에 용해시켰다. 여기에 15 ㎖의 70% EtOH을 첨가하여 잘 섞은 후, 3000 g에서 5분간 원심분리하여 총 RNA를 막에 부착시켰다. 두 차례의 세척 과정을 수행 후, 1.2 ㎖의 RNase가 제거된 물을 첨가하여 총 RNA를 용출, 분리하였다. Total RNA of cells was isolated using QIAGEN kit (RNeasy Maxi kit: cat # 75162). First, adherent cells were recovered using EDTA and trypsin, and then lysed in 15 ml of digestion buffer (included in the kit) to which 150 μl of beta mercaptoethanol was added. 15 ml of 70% EtOH was added thereto and mixed well, followed by centrifugation at 3000 g for 5 minutes to attach total RNA to the membrane. After two washing procedures, total RNA was eluted and separated by adding 1.2 ml of RNase-free water.

(2) Cy3 또는 Cy5를 표식한 cDNA의 합성 (2) Synthesis of cDNA Labeled with Cy3 or Cy5

상기 (1)에서 추출한 총 RNA를 사용하여 3DNA Array 50 키트[Genisphere Inc, Hatfield, PA, USA]에 기재된 방법에 따라 역전사(reverse transcription) 반응을 수행하여 cDNA를 합성하였다. 즉, 위암 세포주인 실험군은 3 ㎕의 Cy5에 대한 RT 프라이머(3DNA Array 50 키트에 포함, Genisphere 사), 17 ㎕의 총 RNA(25 ㎍ 함유)을 함유한 RT 혼합물을 80 ℃에서 10분간 처리하고 바로 얼음에 방치한 후, RNase 저해제를 각각 1 ㎕ 첨가하였다. 여기에 2 ㎕의 10mM의 dNTP 혼합물(A, T, G, C 각 10 mM)와 4 ㎕의 0.1M의 DTT(dithiotreitol)[Invitrogen life technologies, USA], 250 mM 트리스-HCl(pH 8.3), 375 mM KCl 및 15 mM MgCl2를 포함하는 8 ㎕의 5 X RT 완충액[Invitrogen life technologies, USA]을 넣고 잘 혼합하였다. 여기에 2 ㎕의 SuperScript II RNase H-역전사효소(200 unit/㎕)[Invitrogen life technologies, USA]를 넣고 42 ℃에서 2시간 동안 반응시켰다. 7 ㎕의 0.5M NAOH/50 mM EDTA를 넣어 반응을 중단시키고 65 ℃에서 10분간 반응하여 반응물을 가수분해한 후 10 ㎕의 1M 트리스-HCl(pH 7.5)를 넣어 중화시켰다. 합성된 cDNA는 스핀 칼럼(Microcon YM-30)[Millipore Corporation, Bedford, MA]으로 처리하여 순수하게 분리하였다. 한편, 정상 위 세포주인 대조군은 3 ㎕의 Cy3에 대한 RT 프라이머를(3DNA Array 50 키트에 포함, Genisphere 사) 첨가하고, 상기와 동일한 방법으로 cDNA를 합성하고 분리하였다.Using the total RNA extracted in (1), cDNA was synthesized by performing reverse transcription reaction according to the method described in 3DNA Array 50 kit [Genisphere Inc, Hatfield, PA, USA]. That is, the experimental group, which is a gastric cancer cell line, was treated with an RT mixture containing 3 μl of RT primer for Cy5 (included in the 3DNA Array 50 kit, Genisphere) and 17 μl of total RNA (containing 25 μg) for 10 minutes at 80 ° C. Immediately after being left on ice, 1 μl of each RNase inhibitor was added. Here, 2 μl of 10 mM dNTP mixture (10 mM each for A, T, G, C) and 4 μl of 0.1 M dithiotreitol (DTT) [Invitrogen life technologies, USA], 250 mM Tris-HCl (pH 8.3), 8 μl of 5 × RT buffer [Invitrogen life technologies, USA] containing 375 mM KCl and 15 mM MgCl 2 was added and mixed well. 2 μl of SuperScript II RNase H-reverse transcriptase (200 unit / μl) [Invitrogen life technologies, USA] was added thereto and reacted at 42 ° C. for 2 hours. The reaction was stopped by adding 7 μl of 0.5 M NAOH / 50 mM EDTA and reacted for 10 minutes at 65 ° C. to hydrolyze the reaction, followed by neutralization with 10 μl of 1M Tris-HCl (pH 7.5). Synthesized cDNA was purified by spin column (Microcon YM-30) [Millipore Corporation, Bedford, Mass.]. Meanwhile, the control group, which is a normal gastric cell line, was added with 3 μl of RT primer for Cy3 (included in the 3DNA Array 50 kit, Genisphere), and cDNA was synthesized and isolated in the same manner as above.

(3) 혼성화 반응 (3) hybridization reaction

실험군 및 대조군으로부터 취득한 cDNA를 총 부피 40 ㎕로 혼합하고 이를 2K cDNA 칩[21C 인간유전체기능연구 사업단 제공, 한국]과 1차 혼성화 반응을 16시간 수행하였다. 그런 다음, 2% SDS를 포함하는 2XSSC, 2XSSC 및 0.2XSSC로 각각 5분간 세척하고, 95% 에탄올로 cDNA 프로브를 고정시킨 후, 다시 3DNA 포획 시약(Capture Reagent) #1과 3DNA 포획 시약 #2를 혼합하여 총 부피 40 ㎕로 2K cDNA 칩과 2차 혼성화 반응을 6시간 수행하였다. 반응 후 상기와 같은 방법으로 세척하고 최종적으로 1000 rpm에서 3분간 원심분리하여 건조시켰다. 실험군인 위암 세포주 8개에 대해서 상기와 같은 실험을 각각 두 번씩 반복 수행하여 총 16번의 마이크로어레이 실험을 수행하였다.The cDNA obtained from the experimental group and the control group was mixed in a total volume of 40 μl and subjected to a primary hybridization reaction with a 2K cDNA chip [provided by the 21C Human Genome Functional Research Project, Korea] for 16 hours. Then, wash with 2XSSC, 2XSSC and 0.2XSSC each containing 2% SDS for 5 minutes, fix the cDNA probe with 95% ethanol, and again add 3DNA Capture Reagent # 1 and 3DNA Capture Reagent # 2. The hybridization was performed for 2 hours with the 2K cDNA chip and the second hybridization reaction in a total volume of 40 µl. After the reaction was washed in the same manner as above and finally centrifuged at 1000 rpm for 3 minutes to dry. The same experiment was repeated twice for eight gastric cancer cell lines, which were experimental groups, and a total of 16 microarray experiments were performed.

(4) 데이터 분석 (4) data analysis

칩상의 형광 이미지를 스캔어레이 5000 마이크로어레이 스캐너(Packard BioScience)로 532 nm에서 Cy3 및 635 nm에서 Cy5를 스캐닝하고 Gene PIX 프로그램(Axon Instruments, Inc.)을 사용하여 이미지 분석을 수행하고 R 패키지 프로그램을 이용하여 노말라이제이션(normalization)을 수행한 후 전체 16번의 실험 결과를 모아서 SAM(Significance Analysis of Microarrays) 프로그램을 이용하여 SAM 점수(scores)에 따라 위암 세포주에서 발현량이 증가 또는 감소하는 의미있는 유전자를 분석하였다. 그 결과, 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자 를 발굴하였다[표 3].Scanning Fluorescent Images on Chip Scanning Cy3 at 532 nm and Cy5 at 635 nm with an Array 5000 microarray scanner (Packard BioScience), performing image analysis using the Gene PIX program (Axon Instruments, Inc.) After the normalization was performed, a total of 16 experiments were collected, and the Significance Analysis of Microarrays (SAM) program was used to identify meaningful genes that increase or decrease the expression level in gastric cancer cell lines according to SAM scores. Analyzed. As a result, 12 gastric cancer genes and 8 gastric cancer genes were identified [Table 3].

Figure 112004035483786-PAT00001
Figure 112004035483786-PAT00001

실시예 2: RT-PCR 반응에 의한 선별된 표적 유전자의 발현량 분석Example 2 Analysis of Expression of Selected Target Genes by RT-PCR Response

cDNA 마이크로어레이에서 발굴한 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자의 발현량을 경쟁적 RT-PCR 방법을 통해 정량적으로 분석하였다. The expression levels of 12 gastric high expression genes and 8 gastric cancer low expression genes extracted from cDNA microarray were quantitatively analyzed by competitive RT-PCR method.

(1) 역전사 효소 반응 (1) reverse transcriptase reaction

상기 실시예 1에서 분리한 총 20종의 총 RNA 중에서 각각 5 ㎍의 총 RNA을 사용하여 다음 표 4와 같은 역전사 반응액에서 42 ℃, 60분간 반응시켜 총 9종의 1st cDNA를 합성하였다. 그 후, 70 ℃ 가열 블럭(heating block)에서 15분간 반응함으로써 cDNA 합성을 종료시켰다.Of the total 20 species of RNA isolated in Example 1, using 5 μg of total RNA, respectively, and reacted for 60 minutes at 42 ℃, reverse transcription reaction solution as shown in Table 4 to synthesize a total of nine 1 st cDNA. Thereafter, cDNA synthesis was terminated by reacting for 15 minutes in a 70 ° C. heating block.

poly dT(12-18) 프라이머 (0.4 ㎍/㎕)poly dT (12-18) primer (0.4 μg / μl) 1㎕1 μl 5X first-strand buffer5X first-strand buffer 4㎕4 μl 10mM dNTP 혼합물10 mM dNTP mixture 1㎕1 μl 0.1M DTT0.1M DTT 2㎕2 μl RNaseOUT (40 U/㎕)RNaseOUT (40 U / μl) 1㎕1 μl 역전사효소 (200 U/㎕)Reverse transcriptase (200 U / μl) 1㎕1 μl 총 RNA (5 ㎍)Total RNA (5 μg) X㎕X μl 증류수Distilled water (10-X)㎕(10-X) μl 총 부피Total volume 20㎕20 μl

(2) 경쟁적(competitive) PCR을 이용한 cDNA의 증폭 및 발현량 확인 (2) Confirmation of amplification and expression level of cDNA using competitive PCR

① 경쟁적 PCR을 위한 주형의 농도 보정 ① Correction of template concentration for competitive PCR

마커 유전자를 정량하기 위한 표준 유전자로 본 실험에서는 베타-엑틴 유전자를 사용하였다. 표준 유전자와 프라이머의 프라이밍 부분은 같으나, PCR 산물의 크기가 다른 경쟁 DNA(competitor)를 표준 유전자와 함께 PCR 반응을 수행하여, 시료간 표준 유전자의 발현양과 경쟁 DNA의 발현양이 같은 농도를 찾아, PCR에 사용되는 각 주형의 농도가 동일하게 되도록 시료의 농도를 보정하였다. Beta-actin gene was used in this experiment as a standard gene for quantifying marker genes. Priming parts of standard genes and primers are identical, but PCR DNA reactions are performed with competing DNAs (competitors) having different sizes of PCR products with standard genes. The concentration of the sample was corrected so that the concentration of each template used for PCR was equal.

베타-엑틴 경쟁 DNA는 시판의 DNA[Takara, 일본]를 사용하였으며, 이를 이용한 PCR 산물의 길이는 340 bp이며, 베타-엑틴 유전자로부터 PCR 산물의 길이는 275bp였다. 베타-엑틴 경쟁 DNA를 6 단계로 희석하고, 희석한 2 ㎕를 상기 (1) 의 역전사 효소 반응액의 희석액 5 ㎕에 각각 혼합한 후, 3 ㎕의 5XPCR 반응액[바이오니아, 한국], 각각 0.6 ㎕의 2종류의 베타-엑틴 프라이머[10 pmole/㎕: 정방향 프라이머(서열번호 1) : 5'-caagagatggccacggctgct-3', 역방향 프라이머(서열번호2) : 5'-tccttctgcatcctgtcggca-3'], 3.8 ㎕의 증류수를 함유한 총 15 ㎕의 6개 PCR 반응액을 사용하여 경쟁적 PCR을 수행하였다. 이때, PCR 반응 조건은 94 ℃(30초), 68 ℃(1분), 72 ℃(1분)로 25회씩 수행하였다. As the beta-actin competition DNA, commercially available DNA [Takara, Japan] was used, and the length of the PCR product using the same was 340 bp and the length of the PCR product from the beta-actin gene was 275bp. The beta-actin competition DNA was diluted in 6 steps, and 2 µl of the diluted solution was mixed with 5 µl of the dilution of the reverse transcriptase reaction solution of (1), respectively, followed by 3 µl of 5XPCR reaction solution [Bionia, Korea], respectively. 2 μL of two beta-actin primers [10 pmole / μl: forward primer (SEQ ID NO: 1): 5'-caagagatggccacggctgct-3 ', reverse primer (SEQ ID NO: 2): 5'-tccttctgcatcctgtcggca-3'], 3.8 μl Competitive PCR was performed using a total of 15 μl of 6 PCR reaction solutions containing distilled water. At this time, PCR reaction conditions were performed 25 times at 94 ℃ (30 seconds), 68 ℃ (1 minutes), 72 ℃ (1 minutes).

PCR 산물을 2% 아가로스 젤에 3 ㎕씩 로딩하여 100 V에서 30분 전기영동한 후, FrogTM 기계(젤 이미지 어낼리시스 시스템)[Core Bio 사]를 이용하여 젤 사진을 촬영하였다. 최종적으로 얻은 젤 밴드 이미지 파일(.tif)을 ToltalLab v1.0 프로그램[NonLinear Dynamix 사]을 이용하여, 두 밴드(베타-엑틴 경쟁 DNA에서는 340 bp, 원래 베타-엑틴유전자에서는 275 bp)의 감도가 비슷한 농도를 선별, 정량화한 후, 각 시료의 농도를 보정하였다. PCR products were loaded on 3 μl of 2% agarose gel, followed by electrophoresis at 100 V for 30 minutes, and gel pictures were taken using a Frog ™ machine (Gel Image Analysis System) [Core Bio]. The final gel band image file (.tif) was obtained using the ToltalLab v1.0 program (NonLinear Dynamix), which showed sensitivity of two bands (340 bp for beta-actin competition DNA and 275 bp for the original beta-actin gene). After similar concentrations were screened and quantified, the concentrations of each sample were corrected.

② PCR을 이용한 cDNA의 증폭 ② Amplification of cDNA by PCR

상기 ①에서 보정한 시료의 cDNA를 각 유전자의 정방향 프라이머 및 역방향 프라이머를 함유한 다음 표 5의 PCR 반응액에서 증폭시켰다. 이때, PCR 반응은 94 ℃ 1분, 55 ℃ 30초, 72 ℃ 1분으로 25회씩 수행하였다. CDNA of the sample corrected in ① was amplified in the PCR reaction solution of Table 5 containing the forward primer and the reverse primer of each gene. At this time, the PCR reaction was performed 25 times at 94 ℃ 1 minute, 55 ℃ 30 seconds, 72 ℃ 1 minute.

위암 특이적 고발현 유전자 12종인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16와, 위암 특이적 저발현 유전자 8 종인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1의 프라이머는 다음 표 6과 같이 단백질 코딩 영역 내부에서 디자인하였고, 각 프라이머의 길이는 19 ∼ 22 bp, GC 함량은 45 ∼ 60% 정도이다. 다음은 PCR 반응액의 조성을 나타낸다.CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 with 12 gastric cancer specific high expression genes, LGALS1, PEA15, FLJ34386, SEC61A1, MT2A , MAGED2, NPDC1 and CXX1 primers were designed inside the protein coding region as shown in Table 6 below, the length of each primer is 19-22 bp, GC content is about 45-60%. The following shows the composition of the PCR reaction solution.

cDNAcDNA 5 ㎕5 μl 5X PCR 반응 mix[바이오니아 사]5X PCR reaction mix [Bionia Corporation] 3 ㎕3 μl 정방향 프라이머 (10pmole/㎕)Forward primer (10 pmole / μl) 1 ㎕1 μl 역방향 프라이머 (10pmole/㎕)Reverse primer (10 pmole / μl) 1 ㎕1 μl 증류수Distilled water 5 ㎕5 μl 총 부피Total volume 15 ㎕15 μl

경쟁적 PCR에 사용한 각 위암 마커 유전자들의 프라이머Primers of each gastric cancer marker gene used for competitive PCR 유전자gene 정방향 프라이머(5'-> 3')Forward Primer (5 '-> 3') 역방향 프라이머(5'-> 3')Reverse primer (5 '-> 3') CKS1BCKS1B acgacgacgaggagtttgag (서열번호 3) acgacgacgaggagtttgag (SEQ ID NO: 3) ccgcaagtcaccacacatac (서열번호 4) ccgcaagtcaccacacatac (SEQ ID NO: 4) D1S155ED1S155E gcaacaaagtcagtgcaga (서열번호 5) gcaacaaagtcagtgcaga (SEQ ID NO: 5) cctcatctcctgcctgtagc (서열번호 6) cctcatctcctgcctgtagc (SEQ ID NO: 6) FKBP4FKBP4 caccaaatgctgagctgaaa (서열번호 7) caccaaatgctgagctgaaa (SEQ ID NO: 7) ggctttgttgttggggtaga (서열번호 8) ggctttgttgttggggtaga (SEQ ID NO: 8) SKB1SKB1 caagttggaggtgcagttca (서열번호 9) caagttggaggtgcagttca (SEQ ID NO: 9) gcccactcataccacacctt (서열번호 10) gcccactcataccacacctt (SEQ ID NO: 10) NT5C3NT5C3 tgatgccagaattccagaaa (서열번호 11) tgatgccagaattccagaaa (SEQ ID NO: 11) caacattggccactccatct (서열번호 12) caacattggccactccatct (SEQ ID NO: 12) p30p30 cttctcgcttcaagctcctg (서열번호 13) cttctcgcttcaagctcctg (SEQ ID NO: 13) tgttcttgatggtcttgtgctc (서열번호 14) tgttcttgatggtcttgtgctc (SEQ ID NO: 14) GPIGPI tcacggacgtcatcaacatt (서열번호 15) tcacggacgtcatcaacatt (SEQ ID NO: 15) aagaagttggccaggaggat (서열번호 16) aagaagttggccaggaggat (SEQ ID NO: 16) PRO2000PRO2000 aatgagaccggaaacacagg (서열번호 17) aatgagaccggaaacacagg (SEQ ID NO: 17) ttgcgatgccgataaataca(서열번호 18) ttgcgatgccgataaataca (SEQ ID NO: 18) CDC20CDC20 gtacctgtggagtgcaagc (서열번호 19) gtacctgtggagtgcaagc (SEQ ID NO: 19) gtaatggggagaccagagg (서열번호 20) gtaatggggagaccagagg (SEQ ID NO: 20) FEN1FEN1 catggactgcctcaccttc (서열번호 21) catggactgcctcaccttc (SEQ ID NO: 21) cggtcaccttgaagaaatc (서열번호 22) cggtcaccttgaagaaatc (SEQ ID NO: 22) ZNF9ZNF9 ttcaagtgtggacgatctgg (서열번호 23) ttcaagtgtggacgatctgg (SEQ ID NO: 23) ttgctgcagttgatggctac (서열번호 24) ttgctgcagttgatggctac (SEQ ID NO: 24) RPS16RPS16 tgcagtctgtgcaggtcttc (서열번호 25) tgcagtctgtgcaggtcttc (SEQ ID NO: 25) atcggtaggatttctggtagc (서열번호 26) atcggtaggatttctggtagc (SEQ ID NO 26) LGALS1LGALS1 gacgctaagagcttcgtgct (서열번호 27) gacgctaagagcttcgtgct (SEQ ID NO: 27) gtagttgatggcctccaggt (서열번호 28) gtagttgatggcctccaggt (SEQ ID NO 28) PEA15PEA15 ctgcaagacctgaccaacaa(서열번호 29) ctgcaagacctgaccaacaa (SEQ ID NO: 29) acttcttggcactggggata (서열번호 30) acttcttggcactggggata (SEQ ID NO: 30) FLJ34386FLJ34386 tcactcttctccaaaaacctga(서열번호 31) tcactcttctccaaaaacctga (SEQ ID NO: 31) agtgaggcaggaggaattga (서열번호 32) agtgaggcaggaggaattga (SEQ ID NO: 32) SEC61A1SEC61A1 ctcccaaatgctctcagctc (서열번호 33) ctcccaaatgctctcagctc (SEQ ID NO: 33) caacctcgctttgctcctta (서열번호 34) caacctcgctttgctcctta (SEQ ID NO: 34) MT2AMT2A atggatcccaactgctcct (서열번호 35) atggatcccaactgctcct (SEQ ID NO: 35) ctttgcagatgcagccttg (서열번호 36) ctttgcagatgcagccttg (SEQ ID NO: 36) MAGED2MAGED2 agcaccttagagcccactga (서열번호 37) agcaccttagagcccactga (SEQ ID NO: 37) gggctttggctttagcttct (서열번호 38) gggctttggctttagcttct (SEQ ID NO: 38) NPDC1NPDC1 gcccagactggaagatgaga (서열번호 39) gcccagactggaagatgaga (SEQ ID NO: 39) tccttgggtggctctttatg (서열번호 40) tccttgggtggctctttatg (SEQ ID NO: 40) CXX1CXX1 ggaggaggacgaggacttct (서열번호 41) ggaggaggacgaggacttct (SEQ ID NO: 41) tgggcagaatgatgtagtcg (서열번호 42) tgggcagaatgatgtagtcg (SEQ ID NO: 42)

③ 경쟁적 PCR을 이용한 발현량 확인 ③ Confirmation of expression level using competitive PCR

PCR 반응에 의해 증폭된 PCR 산물을 확인하기 위하여, PCR 반응액을 2%의 아가로스 젤에 100V로 30분간 전기영동하였다. In order to confirm the PCR product amplified by the PCR reaction, the PCR reaction solution was electrophoresed for 30 minutes at 100V on 2% agarose gel.

그 결과를 도 1에 나타내었다. 12종의 위암 고발현 유전자의 발현량은 정상 위 세포주 Hs 677.St보다 위암 세포주인 SNU-1, SNU-16, SNU-216, SNU-484, SNU-601, SNU-638, SNU-668 및 SNU-719에서 발현량이 높았으며, 8종의 위암 저발현 유전자의 발현량은 정상 위 세포주보다 위암 세포주에서 낮은 발현량을 보였다. 즉, 12종의 위암 후보 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16은 위암 마커로서 유용함이 확인되었고 8종의 위암 저발현 유전자 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1는 위암 억제 마커로 사용 가능한 것이 확인되었다.The results are shown in FIG. The expression levels of 12 gastric cancer high expression genes were higher than those of normal gastric cell line Hs 677.St. The expression level of SNU-719 was high, and the expression level of 8 gastric low expression genes was lower in gastric cancer cell line than in normal gastric cell line. That is, 12 kinds of gastric cancer candidate genes, CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16, were found to be useful as gastric cancer markers, and 8 kinds of gastric cancer low expression genes LGALS1, PEA15 , FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 were found to be usable as gastric cancer suppression markers.

실시예 3: 임상 시료에서 위암 고발현 유전자와 저발현 유전자의 발현량 확인Example 3 Confirmation of Expression of High and Low Gastric Cancer Genes in Clinical Samples

본 실험에서는 충남대 의과대학교에서 제공한 25명의 위암 환자로부터 직접 채취한 정상 위 조직과 위암 조직의 쌍으로 총 50개의 임상 시료에서, 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자의 발현량을 경쟁적 RT-PCR법을 사용하여 수행하였다.In this experiment, 12 gastric and 8 gastric low expression genes were expressed in 50 clinical samples from a pair of normal gastric and gastric cancer tissues directly collected from 25 gastric cancer patients provided by Chungnam National University School of Medicine. The amount was performed using the competitive RT-PCR method.

(1) 총 RNA 분리 및 역전사 효소 반응 (1) Total RNA Isolation and Reverse Transcriptase Reaction

상기 실시예 1에서와 같은 방법으로 50개의 임상시료로 부터 총 RNA를 분리하고, 상기 실시예 2-1)에서와 같이 각 시료의 총 RNA 5 ㎍을 사용하여 42 ℃, 60 분간 역전사 반응을 수행함으로써 총 50종의 1st cDNA를 합성하였다. 그 후, 70 ℃ 가열 블럭에서 15분간 반응함으로써 cDNA 합성을 종료시켰다.Total RNA was isolated from 50 clinical samples in the same manner as in Example 1, and reverse transcription was performed at 42 ° C. for 60 minutes using 5 μg of total RNA of each sample as in Example 2-1). As a result, a total of 50 1 st cDNAs were synthesized. Then, cDNA synthesis was terminated by reacting for 15 minutes in a 70 degreeC heating block.

(2) 경쟁적 PCR을 이용한 각 유전자의 발현량 확인 (2) Confirmation of expression level of each gene using competitive PCR

경쟁적 PCR을 위한 주형의 농도 보정은 상기 실시예 2-2)-①에서와 동일한 방법으로 PCR에 사용되는 각 주형의 농도가 동일하게 되도록 시료의 농도를 보정하였다. 보정한 시료의 역전사 반응액을 2 ㎕씩 주형으로 이용하여 각 유전자의 정방향 프라이머 및 역방향 프라이머를 함유한 총 15 ㎕의 PCR 반응액에서 증폭시켰다. 이때 PCR 반응은 94 ℃ 30초, 55 ℃ 1분, 72 ℃ 1분을 25회씩 수행하였다. 사용된 프라이머는 상기 표 6에서 표시된 것과 같다. 증폭된 PCR 산물을 확인하기 위하여, PCR 반응액 전부를 2%의 아가로스 젤에 100V로 30분으로 전기영동한 후, PCR 산물을 상기 ①에서와 같이 ToltalLab v1.0 프로그램(NonLinear Dynamix Ltd.)을 이용하여 정량화하였다. Concentration correction of the template for the competitive PCR was corrected so that the concentration of each template used in the PCR in the same manner as in Example 2-2) -① the concentration of the sample to be the same. A total of 15 μl of PCR containing the forward and reverse primers of each gene was used as the template for reverse transcription of the corrected sample. Amplified in the reaction solution. At this time, the PCR reaction was performed 25 times at 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute each. The primers used are as indicated in Table 6 above. In order to confirm the amplified PCR product, the entire PCR reaction solution was electrophoresed at 100V for 30 minutes on 2% agarose gel, and the PCR product was subjected to the ToltalLab v1.0 program (NonLinear Dynamix Ltd.) as in ① above. Quantification using

그 결과를 도 2에 나타내었다. X축은 위암 진행단계(IA, IB, II, IIIA/B, IV)별의 정상 위 조직(하얀색 막대 그래프)과 위암 조직(검은색 막대 그래프)을 나타내며, Y축은 각종 시료에서 발현되는 표적 유전자의 발현량을 베타-엑틴의 발현량으로 나눈 값을 표기하였다. 위암 고발현 유전자인 FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16 유전자의 경쟁적 RT-PCR 산물량은 동일 환자에서 채취한 정상 위 조직에서보다 위암 조직에서 높은 경우가 더 많았으며, 위암 저발현 유전자인 MT2A와 CXX1 유전자의 경쟁적 RT-PCR 산물량은 위암조직에서 보다 정상 위 조직에서 더 높게 나타나는 경향이 확인되었다. 하지만, 나머지 8종의 유전자는 자체 발현량이 적어서 발현여부를 확인할 수 없었다.The results are shown in FIG. The X axis represents normal gastric tissue (white bar graph) and gastric cancer tissue (black bar graph) by gastric cancer progression stages (IA, IB, II, IIIA / B, IV), and the Y axis represents target genes expressed in various samples. The value divided by the expression amount of beta-actin is indicated. Competitive RT-PCR products of the gastric cancer high-expression genes FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9, and RPS16 were higher in gastric cancer tissue than in normal gastric tissue from the same patient. Competitive RT-PCR of MT2A and CXX1 genes, which are low expression of gastric cancer, was higher in normal gastric tissue than in gastric cancer tissue. However, the remaining eight genes were not able to confirm their expression due to their small amount of expression.

실시예 4: 정상 위 세포주와 위암 세포주에서의 웨스턴 블랏팅법에 의한 위암 고발현 유전자의 발현량 확인Example 4 Expression of Gastric High Expression Genes by Western Blotting in Normal and Gastric Cancer Cell Lines

본 실험에서는 RT-PCR방법에 의해 확인된 총 20종의 위암 진단마커 유전자 중, 현재 시판되고 있는 2종의 CDC20과 SKB1 단백질에 대한 항체를 이용하여 정상 위 세포주와 위암 세포주에서 CDC20과 SKB1의 단백질 발현량을 분석하였다.In this experiment, among 20 kinds of gastric cancer diagnostic marker genes identified by RT-PCR method, the proteins of CDC20 and SKB1 were detected in normal gastric and gastric cancer cell lines using antibodies against two currently available CDC20 and SKB1 proteins. Expression levels were analyzed.

실시예 1-(1)에서와 같이 세포주를 배양, 집균한 후, 세포주들의 세포파쇄액을 얻기 위하여 파쇄 완충액(lysis buffer; 50 mM TrisㆍHCl[pH 7.6], 150 mM NaCl, 1% NP-40, 1 mM aprotinin, 1 mM PMSF)에 세포들을 현탁시켰다. 이를 4 ℃에서 1시간 동안 방치하고 12,000 rpm에서 30분간 원심분리하여 세포 내 단백질들을 상등액으로 회수하였다. 회수된 각각의 상등액을 브래드포드 시약[Bio-Rad, USA]으로 정량하여 동일한 양(50 ㎍)의 세포파쇄액을 10% SDS-PAGE에서 전기영동한 후, 나이론 막 필터[Millipore Corporation, USA]에 단백질들을 옮겼다. 이를 위암 고발현 유전자에 해당하는 CDC20의 모노클로날 1차 항체[Santa Cruz Biotechnology, Inc, USA], SKB1의 폴리클로날 1차 항체[Cell Signaling Technology, Inc, USA] 및 표준 단백질인 ACTIN의 모노클로날 1차 항체[Sigma, USA]과 각각 1:1000, 1:1000 및 1:50000으로 반응시켰다. 반응이 끝난 후 TBST 용액(Tris-buffered saline, with 0.05% Tween20)으로 3회 세척한 후에, 2차 항체인 peroxidase-conjugated goat anti-rabbit IgG[Jackson ImmunoResearch, USA]와 horseradish peroxidase-conjuated goat anti-mouse antibody[Promega, USA]으로 반응을 하였다. 반응이 끝난 후, TBST 용액으로 3회 세척한 후에 ECL kit[Amersham Pharmacia, USA]로 immuno-reactive signal을 확인하였다. 그 결과 도 4에서 보는 바와 같이 위암 고발현 유전자로 발굴된 CDC20의 경우, CDC20 단백질의 발현량도 정상세포주인 Hs 677.St 보다 위암 세포주들에서 전반적으로 높음이 확인되었고, SKB1의 경우에도 위암 세포주에서 특히, SNU-1, SNU-16, SNU-216, 및 SNU-638에서 단백질 발현량이 높은 것이 확인되었다. After culturing and collecting the cell lines as in Example 1- (1), lysis buffer (50 mM Tris-HCl [pH 7.6], 150 mM NaCl, 1% NP-) was obtained to obtain cell lysate of the cell lines. Cells were suspended in 40, 1 mM aprotinin, 1 mM PMSF). It was left for 1 hour at 4 ℃ and centrifuged for 30 minutes at 12,000 rpm to recover the intracellular proteins as a supernatant. Each recovered supernatant was quantified with Bradford reagent [Bio-Rad, USA], and the same amount (50 μg) of cell lysate was electrophoresed in 10% SDS-PAGE, followed by a nylon membrane filter [Millipore Corporation, USA] The proteins were transferred to. The monoclonal primary antibody of CDC20 corresponding to the gastric cancer high expression gene [Santa Cruz Biotechnology, Inc, USA], the polyclonal primary antibody of SKB1 [Cell Signaling Technology, Inc, USA] and the monoclonal protein of the ACTIN standard protein Reactions with Ronald primary antibodies [Sigma, USA] at 1: 1000, 1: 1000 and 1: 50000, respectively. After the reaction, the cells were washed three times with TBST solution (Tris-buffered saline, with 0.05% Tween20), followed by the secondary antibody peroxidase-conjugated goat anti-rabbit IgG [Jackson ImmunoResearch, USA] and horseradish peroxidase-conjuated goat anti- Reaction with mouse antibody [Promega, USA]. After the reaction was completed, washed three times with TBST solution and confirmed the immuno-reactive signal by ECL kit [Amersham Pharmacia, USA]. As a result, as shown in FIG. 4, in the case of CDC20 discovered as a high expression of gastric cancer, the expression level of CDC20 protein was also higher in gastric cancer cell lines than in Hs 677.St, which is a normal cell line. In particular, it was confirmed that the amount of protein expression in SNU-1, SNU-16, SNU-216, and SNU-638 was high.

실시예 5: 면역조직화학 염색법을 이용한 위암 조직 시료에서의 위암 고발현 유전자의 단백질 발현량 확인Example 5 Verification of Protein Expression of Gastric High Expression Genes in Gastric Cancer Tissue Samples Using Immunohistochemical Staining

본 실험에서는 RT-PCR방법에 의해 확인된 총 20종의 위암 진단마커 유전자 중, 현재 시판되고 있는 2종의 CDC20와 SKB1 단백질에 대한 항체를 이용하여 을지의과대학교에서 제공된 위암 환자로부터 적출한 정상 위 조직과 위암 조직에서 CDC20과 SKB1의 단백질 발현량을 분석하였다.In this experiment, among the 20 stomach cancer diagnostic marker genes identified by RT-PCR method, normal stomachs were extracted from gastric cancer patients provided by Eulji University of Medicine using two commercially available antibodies against CDC20 and SKB1 proteins. Protein expression levels of CDC20 and SKB1 were analyzed in tissues and gastric cancer tissues.

종양 환자로부터 적출한 조직을 10% 중성 포르말린(formalin) 완충용액으로 고정한 후, 녹아 있는 상태의 파라핀에 포매하였다. 파라핀으로 포매시킨 조직을 마이크로톰(microtome)으로 얇게 박절한 후 상기 절편을 유리 슬라이드 위에 고정하여 자일렌(xylene)과 히스토클리어(histoclear) 용매로 파리핀을 제거하였다. 상기 절편을 1 M 트리스 완충용액으로 세척한 후, 1차 항체로 1 M 트리스 완충용액으로 200배 희석한 위암 고발현 유전자인 CDC20과 SKB1의 단백질에 대한 항체와 40 ℃에서 20분 동안 처리하였다. 반응하지 않은 항체를 1 M 트리스 완충용액으로 완전히 세척하여 제거한 후, 2차 항체로 바이오틴(biotin)이 결합된 아비딘-양고추냉이 퍼옥시다아제(avidin-horseradish peroxidase) 용액[Immunotech사]을 40 ℃에서 10분 동안 처리하였다. 반응하지 않은 2차 항체를 완전히 세척하여 제거한 후 상기 절편을 퍼옥시다아제 기질용액인 0.05% H2O2를 포함한 3-아민-9-에틸카바졸(3-amine-9-ethylcarbazole) 용액에 반응시켜 메이어 헤마톡실린(Meyer's hematoxylin)으로 상호 염색시키고 슬라이드를 봉합한 뒤 광학 현미경으로 확인하였다[도 4].Tissues extracted from tumor patients were fixed in 10% neutral formalin buffer and embedded in dissolved paraffin. Paraffin-embedded tissue was thinly sliced with a microtome and the sections were then fixed on a glass slide to remove paraffin with xylene and histoclear solvents. The fragments were washed with 1 M Tris buffer, and then treated with antibodies against the proteins of CDC20 and SKB1, which are gastric high expression genes, diluted 200-fold with 1 M Tris buffer as the primary antibody for 20 minutes at 40 ° C. After the unreacted antibody was completely washed with 1 M Tris buffer solution, the biotin-bound avidin-horseradish peroxidase solution [Immunotech Co., Ltd.] at 40 ° C. was removed. Treatment was for 10 minutes. After washing and removing the unreacted secondary antibody, the fragments were reacted with 3-amine-9-ethylcarbazole solution containing 0.05% H 2 O 2 , a peroxidase substrate solution. Cross-staining with Meyer's hematoxylin and the slides were sutured and confirmed by light microscopy [FIG. 4].

도 4에서는 a와 d는 정상 위 조직을 나타내고, b와 e는 중등도 분화된(moderately-differentiated) 위암 조직을 나타내고, c와 f는 하등도 분화된(poorly-differentiaed) 위암 조직을 나타낸다. 도 4의 a, b, c는 CDC20 단백질의 발현을 위암 조직 시료에서 확인한 것으로, 정상 위 조직 시료에 비해 위암 조직 시료에서 CDC20 단백질의 발현량이 높음이 확인되었으며, 분화가 덜된 위암 조직시료에서 CDC20 단백질의 발현량이 더 높음이 확인되었다. 또한, 위암의 분화 정도에 따라 CDC20 단백질의 존재 위치가 변하는 것(localization change)이 관찰된다. 즉, 정상 위조직에서는 CDC20 단백질이 세포질(cytosol)에 넓게 존재하는 반면에, 위암의 진행 정도가 높은 하등도 분화(poorly-differentiaed) 위암 조직에서는 핵주변(perinuclear region)에 많이 존재하였다. 도 4의 d, e, f는 SKB1 단백질의 발현을 위암 조직 시료에서 확인한 것으로 정상 조직 시료에서보다 위암조직 시료에서 많이 발현됨이 확인되었고, 또한 핵부분(nuclear region)으로의 SKB1 단백질의 위치이동이 관찰되었다. 이와 같이, 위암 고발현 유전자로 선별된 CDC20과 SKB1 유전자가 코딩하는 CDC20 단백질과 SKB1 단백질의 발현량도 위 정상 조직에 비해 위암 세포주와 위암 조직 임상시료에서 많이 발현됨이 확인되었고, 이와 더불어 이들 단백질의 존재 위치 변화도 관찰되었다.In FIG. 4, a and d represent normal gastric tissue, b and e represent moderately-differentiated gastric cancer tissues, and c and f represent poorly-differentiaed gastric cancer tissues. 4, a, b, and c show the expression of the CDC20 protein in the gastric cancer tissue sample, and the expression level of the CDC20 protein in the gastric cancer tissue sample was confirmed to be higher than that of the normal gastric tissue sample, and the CDC20 protein in the gastric cancer tissue sample with less differentiation It was confirmed that the expression level of is higher. In addition, a localization change of the presence of CDC20 protein is observed according to the degree of differentiation of gastric cancer. That is, in normal gastric tissue, CDC20 protein is widely present in cytosol, whereas in gastric cancer tissue, which is a high degree of progression of gastric cancer, periuclear region is present in many perinuclear regions. In Figure 4 d, e, f is confirmed that the expression of the SKB1 protein in the gastric cancer tissue sample was confirmed that is expressed more in the gastric cancer tissue sample than in the normal tissue sample, and also the position shift of the SKB1 protein to the nuclear region (nuclear region) This was observed. As described above, the expression levels of the CDC20 and SKB1 proteins encoded by the CDC20 and SKB1 genes, which were selected as high gastric cancer genes, were also expressed in clinical samples of gastric cancer cell lines and gastric cancer tissues compared to those of normal stomach tissues. A change in the position of the presence of was also observed.

이상에서 설명한 바와 같이, 본 발명은 위암 진단에 유용한 마커로 12종의 위암 고발현 유전자와 8종의 위암 저발현 유전자를 제공하며, 상기 종양 마커 유전자들은 환자 조직에서 신속하고 민감하게 정량하여 위암을 효과적으로 진단하는데 사용될 수 있다. As described above, the present invention provides 12 kinds of gastric cancer high expression genes and 8 kinds of gastric cancer low expression genes, which are useful markers for the diagnosis of gastric cancer, and the tumor marker genes are rapidly and sensitively quantified in patient tissues. It can be used to diagnose effectively.

<110> Korea Research Institutes of Bioscience and Biotechnology <120> DETECTION KIT FOR GASTRIC CARCINOMA BY MEASURING THE EXPRESSION OF GASTRIC CARCINOMA-RELATED GENES USING cDNA MICROARRAY <160> 42 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 1 caagagatgg ccacggctgc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 2 tccttctgca tcctgtcggc a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CKS1B <400> 3 acgacgacga ggagtttgag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CKS1B <400> 4 ccgcaagtca ccacacatac 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying D1S155E <400> 5 gcaacaaagt cagtgcaga 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying D1S155E <400> 6 cctcatctcc tgcctgtagc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying FKBP4 <400> 7 caccaaatgc tgagctgaaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying FKBP4 <400> 8 ggctttgttg ttggggtaga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying SKB1 <400> 9 caagttggag gtgcagttca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying SKB1 <400> 10 gcccactcat accacacctt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying NT5C3 <400> 11 tgatgccaga attccagaaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying NT5C3 <400> 12 caacattggc cactccatct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ucleic acid used as forward primer of PCR for amplifying p30 <400> 13 cttctcgctt caagctcctg 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying p30 <400> 14 tgttcttgat ggtcttgtgc tc 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying GPI <400> 15 tcacggacgt catcaacatt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying GPI <400> 16 aagaagttgg ccaggaggat 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying PRO2000 <400> 17 aatgagaccg gaaacacagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying PRO2000 <400> 18 ttgcgatgcc gataaataca 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CDC20 <400> 19 gtacctgtgg agtgcaagc 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CDC20 <400> 20 gtaatgggga gaccagagg 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying FEN1 <400> 21 catggactgc ctcaccttc 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying FEN1 <400> 22 cggtcacctt gaagaaatc 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying ZNF9 <400> 23 ttcaagtgtg gacgatctgg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying ZNF9 <400> 24 ttgctgcagt tgatggctac 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying RPS16 <400> 25 tgcagtctgt gcaggtcttc 20 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying RPS16 <400> 26 atcggtagga tttctggtag c 21 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying LGALS1 <400> 27 gacgctaaga gcttcgtgct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying LGALS1 <400> 28 gtagttgatg gcctccaggt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying PEA15 <400> 29 ctgcaagacc tgaccaacaa 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying PEA15 <400> 30 acttcttggc actggggata 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying FLJ34386 <400> 31 tcactcttct ccaaaaacct ga 22 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying FLJ34386 <400> 32 agtgaggcag gaggaattga 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying SEC61A1 <400> 33 ctcccaaatg ctctcagctc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying SEC61A1 <400> 34 caacctcgct ttgctcctta 20 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying MT2A <400> 35 atggatccca actgctcct 19 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying MT2A <400> 36 ctttgcagat gcagccttg 19 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying MAGED2 <400> 37 agcaccttag agcccactga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying MAGED2 <400> 38 gggctttggc tttagcttct 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying NPDC1 <400> 39 gcccagactg gaagatgaga 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying NPDC1 <400> 40 tccttgggtg gctctttatg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CXX1 <400> 41 ggaggaggac gaggacttct 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CXX1 <400> 42 tgggcagaat gatgtagtcg 20 <110> Korea Research Institutes of Bioscience and Biotechnology <120> DETECTION KIT FOR GASTRIC CARCINOMA BY MEASURING THE EXPRESSION          OF GASTRIC CARCINOMA-RELATED GENES USING cDNA MICROARRAY <160> 42 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 1 caagagatgg ccacggctgc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 2 tccttctgca tcctgtcggc a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CKS1B <400> 3 acgacgacga ggagtttgag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CKS1B <400> 4 ccgcaagtca ccacacatac 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying D1S155E <400> 5 gcaacaaagt cagtgcaga 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying D1S155E <400> 6 cctcatctcc tgcctgtagc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying FKBP4 <400> 7 caccaaatgc tgagctgaaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying FKBP4 <400> 8 ggctttgttg ttggggtaga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying SKB1 <400> 9 caagttggag gtgcagttca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying SKB1 <400> 10 gcccactcat accacacctt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying NT5C3 <400> 11 tgatgccaga attccagaaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying NT5C3 <400> 12 caacattggc cactccatct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ucleic acid used as forward primer of PCR for amplifying p30 <400> 13 cttctcgctt caagctcctg 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying p30 <400> 14 tgttcttgat ggtcttgtgc tc 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying GPI <400> 15 tcacggacgt catcaacatt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying GPI <400> 16 aagaagttgg ccaggaggat 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying PRO2000 <400> 17 aatgagaccg gaaacacagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying PRO2000 <400> 18 ttgcgatgcc gataaataca 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CDC20 <400> 19 gtacctgtgg agtgcaagc 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CDC20 <400> 20 gtaatgggga gaccagagg 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying FEN1 <400> 21 catggactgc ctcaccttc 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying FEN1 <400> 22 cggtcacctt gaagaaatc 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying ZNF9 <400> 23 ttcaagtgtg gacgatctgg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying ZNF9 <400> 24 ttgctgcagt tgatggctac 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying RPS16 <400> 25 tgcagtctgt gcaggtcttc 20 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying RPS16 <400> 26 atcggtagga tttctggtag c 21 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying LGALS 1 <400> 27 gacgctaaga gcttcgtgct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying LGALS 1 <400> 28 gtagttgatg gcctccaggt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying PEA15 <400> 29 ctgcaagacc tgaccaacaa 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying PEA15 <400> 30 acttcttggc actggggata 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying          FLJ34386 <400> 31 tcactcttct ccaaaaacct ga 22 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying          FLJ34386 <400> 32 agtgaggcag gaggaattga 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying SEC61A1 <400> 33 ctcccaaatg ctctcagctc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying SEC61A1 <400> 34 caacctcgct ttgctcctta 20 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying MT2A <400> 35 atggatccca actgctcct 19 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying MT2A <400> 36 ctttgcagat gcagccttg 19 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying MAGED2 <400> 37 agcaccttag agcccactga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying MAGED2 <400> 38 gggctttggc tttagcttct 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying NPDC1 <400> 39 gcccagactg gaagatgaga 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying NPDC1 <400> 40 tccttgggtg gctctttatg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer of PCR for amplifying CXX1 <400> 41 ggaggaggac gaggacttct 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer of PCR for amplifying CXX1 <400> 42 tgggcagaat gatgtagtcg 20  

Claims (9)

(a) 시험 위암 조직에서 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 이루어진 군 중에서 선택된 하나 이상의 위암 고발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계;(a) measuring the expression level or protein amount of one or more gastric cancer high expression genes selected from the group consisting of CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 in test gastric cancer tissue Making; (b) 대조 정상 위 조직에서 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 이루어진 군 중에서 선택된 하나 이상의 위암 고발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계;(b) the expression level or protein amount of one or more gastric cancer high expression genes selected from the group consisting of CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 in control normal gastric tissue. Measuring; (c) 시험 위암 조직에서 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 이루어진 군 중에서 선택된 하나 이상의 위암 저발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계; (c) measuring the expression level or protein amount of one or more gastric cancer low expression genes selected from the group consisting of LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 in the test gastric cancer tissue; (d) 대조 정상 위 조직에서 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 이루어진 군 중에서 선택된 하나 이상의 위암 저발현 유전자의 발현량 또는 단백질의 양을 측정하는 단계; 및(d) measuring the expression level or protein amount of one or more gastric cancer low expression genes selected from the group consisting of LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 in control normal gastric tissue; And (e) 상기 (a)에 의해 얻어진 측정값을 상기 (b)에서 얻어진 측정값과 비교하고 상기 (c)에 의해 얻어진 측정값을 상기 (d)에서 얻어진 측정값과 비교하여 위암 여부를 판정하는 단계(e) comparing the measured value obtained by (a) with the measured value obtained by (b) and comparing the measured value obtained by (c) with the measured value obtained by (d) to determine whether gastric cancer step 를 포함하는 것을 특징으로 하는 위암의 진단방법. Gastric cancer diagnostic method comprising a. 제 1 항에 있어서, 상기 유전자의 발현량을 경쟁적 RT-PCR로 측정하는 것을 특징으로 하는 진단방법.The method of claim 1, wherein the expression level of the gene is measured by competitive RT-PCR. 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 대한 발현 정도의 측정을 통하여 위암을 진단하는 것을 특징으로 하는 위암 진단킷트.One or more genes selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16, and LGALS1 which is gastric cancer specific low expression gene Gastric cancer diagnostic kit, characterized in that gastric cancer diagnosis by measuring the expression level of at least one gene selected from the group consisting of, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1. 제 3 항에 있어서, 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자의 정방향 프라이머 및 역방향 프라이머와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자의 정방향 프라이머 및 역방향 프라이머를 포함하는 것을 특징으로 하는 위암 진단킷트.The forward primer of at least one gene according to claim 3, which is selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16; Gastric cancer, characterized in that it comprises a reverse primer and a forward primer and reverse primer of one or more genes selected from the group consisting of gastric cancer specific low expression genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1 Diagnostic Kit. 제 4 항에 있어서, 상기 프라이머가 15 bp 이상의 DNA인 것을 특징으로 하는 위암 진단킷트. The gastric cancer diagnostic kit according to claim 4, wherein the primer is DNA of 15 bp or more. 제 3 항에 있어서, 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 상보적인 프로브와 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 상보적인 프로브를 포함하는 것을 특징으로 하는 위암 진단킷트.4. The probe of claim 3, which is complementary to at least one gene selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 Gastric cancer diagnostic kit comprising a probe complementary to one or more genes selected from the group consisting of LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1. 제 6 항에 있어서, 상기 프로브가 200 ∼ 1000 bp인 것을 특징으로 하는 위암 진단킷트.The gastric cancer diagnostic kit according to claim 6, wherein the probe is 200 to 1000 bp. 제 3 항에 있어서, 위암 특이적 고발현 유전자인 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질을 인식하는 항체와, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질을 인식하는 항체를 포함하는 것을 특징으로 하는 위암 진단킷트. 4. The method according to claim 3, which is encoded by at least one gene selected from the group consisting of gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16. Antibodies that recognize proteins and antibodies that recognize proteins encoded by one or more genes selected from the group consisting of gastric cancer specific low expression genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1, and CXX1 Gastric cancer diagnostic kit, characterized in that. 위암 특이적 고발현 유전자 CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 및 RPS16으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질과, 위암 특이적 저발현 유전자인 LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 및 CXX1으로 구성되는 군 중에서 선택되는 하나 이상의 유전자에 의하여 코드되는 단백질에 시험 화합물을 결합시키고, 시험 화합물이 상기 단백질의 작용을 촉진 또는 억제하는지를 확인하는 것을 특징으로 하는 위암 억제제의 스크리닝 방법.Gastric cancer specific high expression genes CKS1B, D1S155E, FKBP4, SKB1, NT5C3, p30, GPI, PRO2000, CDC20, FEN1, ZNF9 and RPS16 protein encoded by one or more genes selected from the group consisting of, and gastric cancer specific low A test compound is bound to a protein encoded by one or more genes selected from the group consisting of the expression genes LGALS1, PEA15, FLJ34386, SEC61A1, MT2A, MAGED2, NPDC1 and CXX1, and the test compound promotes the action of the protein or The screening method of the gastric cancer inhibitor, characterized by checking whether it inhibits.
KR1020040062475A 2004-08-09 2004-08-09 Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes KR100645979B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020040062475A KR100645979B1 (en) 2004-08-09 2004-08-09 Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020040062475A KR100645979B1 (en) 2004-08-09 2004-08-09 Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes

Publications (2)

Publication Number Publication Date
KR20060013868A true KR20060013868A (en) 2006-02-14
KR100645979B1 KR100645979B1 (en) 2006-11-15

Family

ID=37123023

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020040062475A KR100645979B1 (en) 2004-08-09 2004-08-09 Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes

Country Status (1)

Country Link
KR (1) KR100645979B1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100679173B1 (en) * 2006-02-28 2007-02-06 주식회사 바이오인프라 Protein markers for diagnosing stomach cancer and the diagnostic kit using them
KR100715558B1 (en) * 2005-06-17 2007-05-08 연세대학교 산학협력단 Method for Selecting Gastric Cancer Specific Predictor Genes and Use Thereof
KR100861465B1 (en) * 2007-08-06 2008-10-02 한국생명공학연구원 A gastric carcinoma gene znf312b, a protein translated from the gene and a diagnostic kit using the same
WO2009020346A2 (en) * 2007-08-06 2009-02-12 Korea Research Institute Of Bioscience And Biotechnology A gastric carcinoma gene znf312b, a protein translated from the gene, and a diagnostic kit and a screening method for anticancer agents using the same

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI971124A0 (en) * 1997-03-18 1997-03-18 Locus Genex Oy Method Foer diagnosis av magcancer
KR20030011982A (en) * 2001-07-25 2003-02-12 주식회사 인투젠 Target gene for diagnosis of gastric cancer and development of anticancer drugs identified by cDNA microarray analysis and solid support for microarray analysis arrayed the same
KR100588471B1 (en) * 2003-11-25 2006-06-09 한국생명공학연구원 Detection kit for metastatic gastric cancer by measuring the expression of metastasis-related genes
KR100643046B1 (en) * 2003-06-12 2006-11-10 한국생명공학연구원 Detection kit for stomach cancer by measuring the expression of stomach cancer marker genes

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100715558B1 (en) * 2005-06-17 2007-05-08 연세대학교 산학협력단 Method for Selecting Gastric Cancer Specific Predictor Genes and Use Thereof
KR100679173B1 (en) * 2006-02-28 2007-02-06 주식회사 바이오인프라 Protein markers for diagnosing stomach cancer and the diagnostic kit using them
KR100861465B1 (en) * 2007-08-06 2008-10-02 한국생명공학연구원 A gastric carcinoma gene znf312b, a protein translated from the gene and a diagnostic kit using the same
WO2009020346A2 (en) * 2007-08-06 2009-02-12 Korea Research Institute Of Bioscience And Biotechnology A gastric carcinoma gene znf312b, a protein translated from the gene, and a diagnostic kit and a screening method for anticancer agents using the same
WO2009020346A3 (en) * 2007-08-06 2009-04-16 Korea Res Inst Of Bioscience A gastric carcinoma gene znf312b, a protein translated from the gene, and a diagnostic kit and a screening method for anticancer agents using the same
US8278285B2 (en) 2007-08-06 2012-10-02 Korea Research Institute Of Bioscience And Biotechnology Gastric carcinoma gene ZNF312b, a protein translated from the gene, and a diagnostic kit and a screening method for anticancer agents using the same
CN101688207B (en) * 2007-08-06 2013-06-12 韩国生命工学研究院 A gastric carcinoma gene ZNF312b, a protein translated from the gene, and a diagnostic kit and a screening method for anticancer agents using the same

Also Published As

Publication number Publication date
KR100645979B1 (en) 2006-11-15

Similar Documents

Publication Publication Date Title
KR101801980B1 (en) A composition for diagnosis of primary central nervous system lymphoma and a diagnosing kit comprising the same
KR20130017525A (en) Biomarker for early diagnosis of colorectal cancer, breast cancer, renal cell carcinoma or thyroid cancer and uses thereof
KR20180037462A (en) Composition for treatment and diagnosis of pancreatic neuroendocrine tumors
KR20090053222A (en) Characterization of cxcl-16 as a tumor associated marker of colorectal cancer
KR100645979B1 (en) Detection kit for gastric carcinoma by measuring the expression of gastric carcinoma-related genes
KR101995189B1 (en) Biomarker for non-invasive in vitro diagnosis of a Hepatocellular carcinoma and biokit for diagnosis thereof comprising the same
KR20120004286A (en) Pellino 1 as a marker for the diagnosis or prognosis of lymphoma
JP7150018B2 (en) Novel CIP2A variants and uses thereof
KR101058753B1 (en) Characterization of ESM-1 as a tumor associated marker of colorectal cancer
KR101200194B1 (en) Use of SOCS6 as a hepatocellular carcinomar diagnostic marker
KR101054952B1 (en) UCCR, a marker for diagnosing liver cancer and predicting patient survival, a kit including the same, and prediction of liver cancer patient survival using the marker
KR100948808B1 (en) Lipocalin 2 as a tumor associated marker of hepatocellular carcinoma and a hepatocellular carcinoma diagnostic kit using thereof
KR101560706B1 (en) Composition for diagnosing obesity
KR101346955B1 (en) Composition for predicting the recurrence possibility and survival prognosis of brain tumor and kit comprising the same
KR100552494B1 (en) Detection kit for liver cancer by measuring the expression of hepatic cancer-related genes
US20060134622A1 (en) Amplified cancer target genes useful in diagnosis and thereapeutic screening
KR20230029059A (en) Novel biomarker for predicting of resistance against Trastuzumab and uses thereof
Lin et al. Differential expression of Wnt pathway genes in sporadic hepatocellular carcinomas infected with hepatitis B virus identified with OligoGE arrays
US20150011411A1 (en) Biomarkers of cancer
KR101515210B1 (en) Biomaker ELK3 for diagnosing liver fibrosis
KR101054953B1 (en) SNP 14, a molecule for diagnosing and treating liver cancer, and a kit comprising the same
US20120100144A1 (en) Biomarker and Treatment for Cancer
US9988687B2 (en) Companion diagnostics for cancer and screening methods to identify companion diagnostics for cancer based on splicing variants
KR20190037071A (en) Biomarker for Diagnosis of Anticancer drug Resistance of Colon Cancer and Uses thereof
KR101516716B1 (en) Biomaker RORC for diagnosing liver fibrosis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20121108

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20131105

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20141110

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20151105

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20151209

Year of fee payment: 18