KR101516716B1 - Biomaker RORC for diagnosing liver fibrosis - Google Patents

Abstract

The present invention relates to a biomarker for diagnosing liver fibrosis or liver hardening and its use. More specifically, the present invention relates to a composition and a kit for diagnosing liver fibrosis or liver cirrhosis, which comprises an agent capable of measuring the expression level of mRNA of RORC gene or a protein thereof. The present invention also relates to a method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from a patient's sample in order to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.

Description

Biomarkers for Diagnosis of Liver Fibrosis RORC {Biomaker RORC for diagnosing liver fibrosis}

The present invention relates to a biomarker for diagnosing liver fibrosis or liver hardening and its use. More particularly, the present invention relates to a composition and a kit for diagnosing liver fibrosis or liver cirrhosis, which comprises a preparation capable of measuring the expression level of mRNA of RAR-related orphan receptor C (RORC) gene or its protein. The present invention also relates to a method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from a patient's sample in order to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.

Liver disease can be caused by viruses, liver diseases caused by viruses, alcoholic liver diseases caused by drinking water, liver diseases caused by drug toxicity, autoimmune liver diseases caused by abnormalities of the human immune system, metabolic liver diseases caused by excessive accumulation of toxic substances, Other causes are unclear liver diseases. As such, liver damage can be caused by a variety of factors such as alcohol, hepatitis B or C virus, damage to the immune system, bile, drug addiction, age, parasitoids, When chronic liver damage occurs, hepatic stellate cells are activated by a chronic inflammatory mediator such as TGF-β and are differentiated into myofibroblasts. Differentiated myofibroblasts secrete extracellular matrix (ECM), such as collagen, to regenerate the liver structure and cause liver fibrosis. And eventually lead to liver fibrosis or liver cirrhosis, regardless of the cause. Liver fibrosis is known to progress to liver cirrhosis and further to liver cancer.

Liver fibrosis is a part of a biocompatible reaction involving toxic substances or various infectious, immunological, and metabolic diseases, and refers to a state in which damaged liver tissues are transformed into fibrous tissues such as collagen without being restored to normal hepatocytes. The major component of the accumulation is collagen, especially type I collagen (Olaso E et al., Molecular regulation of hepatic fibrogenesis, etc.), which is characterized by excessive accumulation of extracellular matrix collagen, fibronectin and laminin and proteoglycans, , ≪ / RTI > J Hepatol 29: 836-847-, 1998). This liver fibrosis is an inevitable hepatic pathologic consequence of chronic liver injury. It is a liver tissue that is replaced by a fibrous tissue that can not perform its inherent functions, such as biomass metabolism or bile secretion, ) Inevitably appears. Liver fibrosis is reversible, composed of thin fibrils and known to be free of nodule formation, and may be able to recover to normal if the cause of liver damage is lost. However, if the fibrosis process continues repeatedly, the exchange and binding between the ECMs may increase, leading to irreversible liver cirrhosis resulting in thick fibrils and regenerative nodules.

It has also been reported that liver fibrosis and liver cirrhosis are important risk factors for liver cancer, with about 80% of liver cancer occurring after progression to liver cirrhosis and a 6-fold higher incidence of cancer depending on fibrosis progression . Thus, hepatic fibrosis is the root cause of complications that frequently occur in hepatic dysfunction and end-stage liver disease, further increasing the risk of developing liver cancer.

Thus, diagnosis of liver fibrosis or liver cirrhosis is made according to the progress of hepatic fibrosis or liver cirrhosis in relation to liver damage, and it plays a very important role in the prevention of liver cancer. very important.

Recent reports suggest that liver fibrosis is induced by epithelial mesenchymal transition (EMT), a new mechanism of liver fibrosis. EMT is the conversion of epithelial cells into mesenchymal cell phenotypes that lose their phenotype and are highly mobile. When EMT occurs, markers such as N-cadherin, vimentin the number of markers increases, the number of markers such as E-cadherin decreases, and migration and invasion increase.

In addition, histological examination of liver biopsy specimens is performed as a standard method for diagnosing liver fibrosis or liver cirrhosis, which is disadvantageous in that it is invasive. There is a limit to the extent of biopsy in all patients with increasing hepatic fibrosis or liver cirrhosis. Liver biopsy has side effects from pain, hemorrhage and very rare deaths. Patients undergoing antiviral or antifibrotic treatment It is not appropriate to monitor liver fibrosis changes by liver biopsy.

Therefore, it is urgent to develop a tool or method capable of diagnosing liver fibrosis or liver cirrhosis as a reliable, organ-specific alternative to invasive liver biopsy.

Under these circumstances, the present inventors measured the expression level of RORC in mouse and liver cirrhosis-induced liver fibrosis through a high fat diet and found that the mRNA of RORC gene or its protein is non-invasively diagnosed as liver fibrosis or liver hardening It can be used as a biomarker, thereby completing the present invention.

It is an object of the present invention to provide a biomarker for noninvasive diagnosis of liver fibrosis or liver cirrhosis.

More specifically, the present invention provides a composition for diagnosing liver fibrosis or liver cirrhosis comprising an agent for measuring the expression level of mRNA of RORC gene or its protein.

It is another object of the present invention to provide a kit for liver fibrosis or liver cirrhosis diagnosis comprising the composition of the present invention.

It is another object of the present invention to provide a method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from a patient's sample in order to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.

In one aspect for accomplishing the above object, the present invention relates to a composition for diagnosing liver fibrosis or liver cirrhosis, which comprises an agent for measuring the expression level of mRNA of RORC gene or its protein.

Preferably, the agent that measures the RORC protein may be an antibody specific for the RORC protein.

More preferably, the antibody can be a monoclonal antibody or a polyclonal antibody specific for the RORC protein.

Preferably, the agent for measuring the mRNA expression level of the RORC gene may be an antisense oligonucleotide complementary to the mRNA of the RORC gene, a primer or a probe.

In another aspect, the present invention relates to a kit for liver fibrosis or liver cirrhosis diagnosis comprising the composition of the present invention.

In another aspect, the present invention relates to a method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from a patient's sample in order to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.

Preferably, the sample may be selected from the group consisting of the patient's tissues, cells, blood, serum, plasma, saliva, and urine.

Preferably, the method further comprises the step of measuring the expression level of mRNA of the RORC gene or a protein thereof from the patient sample, and determining the expression level of the mRNA of the RORC gene or the protein thereof in the normal control sample, With the degree of expression of the protein.

Also, preferably, the method for measuring the expression level of the mRNA of the RORC gene may be a reverse transcription polymerase chain reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, a Northern blotting or a DNA chip .

Preferably, the method for measuring the expression level of the RORC protein includes Western blotting, ELISA, radioimmunoassay, radioimmunoprecipitation, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assays, complement fixation Assay, FACS or protein chip.

In another aspect, the present invention relates to a method for screening a therapeutic agent for hepatic fibrosis or liver cirrhosis, comprising the step of treating a candidate agent for hepatic fibrosis or liver cirrhosis and then detecting a change in the expression level of mRNA of the RORC gene or a protein thereof .

Hereinafter, the present invention will be described in more detail.

The present invention relates to a composition, a kit and a method for diagnosing liver fibrosis or liver cirrhosis by measuring the expression level of mRNA of RORC gene or a protein thereof from a patient sample based on the overexpression of RORC in a liver fibrosis model and liver cirrhosis patients .

In a specific example of the present invention, FL83B cells, which are mouse normal hepatocyte cell lines, were injected with TGF-β1, which is an inflammatory mediator, to increase the expression level of mRNA and its protein of RORC gene in the liver fibrosis model. β1 was injected to induce liver fibrosis or liver cirrhosis through EMT. First, the morphological changes of hepatocyte, the expression level of epithelial E-cadherin, and the expression of N-cadherin and α-sma, mesenchymal markers, were measured by western blot The EMT model was established by confirming liver fibrosis or liver cirrhosis through EMT. In the established in vitro EMT model, the level of mRNA expression of the ELK gene was confirmed by RT-PCR (Reverse Transcription Polymerase Chain Reaction) and the expression level of RORC protein was confirmed by Western blotting.

In another embodiment of the present invention, liver fibrosis or liver cirrhosis was induced by intraperitoneal injection of carbon tetrachloride (CCl _{4 -} ), a specimen that causes liver toxicity to Balb / c mice. The expression level of E-cadherin and β-catenin, which are epithelial markers, and the expression level of α-sma, a mesenchymal marker, were measured to establish the in vivo liver fibrosis model by confirming liver fibrosis. In addition, Western blot analysis confirmed the expression of RORC protein in the established in vivo liver fibrosis model.

As a result, expression of E-cadherin and β-catenin was decreased and expression of N-cadherin and α-sma was increased in liver and fibroblast cell and mouse models. In addition, it was confirmed that the expression of mRNA and RORC protein of RORC gene was significantly increased in cells and mice in which hepatic fibrosis or liver hardening occurred (Fig. 2 to Fig. 4).

Further, in another embodiment of the present invention, it has been confirmed that a specific expression increase of RORC for liver fibrosis is also observed in clinical trials. Specifically, E-cadherin, an epithelial marker, was compared with normal liver tissue in patients with chronic hepatitis B and liver cirrhosis. E-cadherin was similar in liver tissues of chronic hepatitis B patients But the expression of E-cadherin was significantly reduced in liver liver tissue as compared with normal liver tissue (FIG. 5). Thus, chronic hepatitis B progressed and worsened and progressed to liver cirrhosis, confirming that chronic hepatitis B and liver cirrhosis can be distinguished by the degree of RORC expression. In addition, the degree of RORC expression of the present biomarker was compared with that of normal liver tissue. RORC was expressed in liver tissue of chronic hepatitis B patient compared to normal liver tissue, but RORC Expression was significantly increased (Fig. 5). These results suggest that RORC can be used as a biomarker to distinguish chronic hepatitis B from liver cirrhosis by confirming that the expression of RORC is increased when chronic hepatitis B proceeds and liver hardening progresses.

Therefore, the RORC gene or the RORC protein can be used as a biomarker to identify whether the RORC gene or the RORC protein can be used as a biomarker to diagnose liver fibrosis or liver cirrhosis, .

As used herein, the term "diagnosis " means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the diagnosis is to ascertain whether liver fibrosis or liver cirrhosis is present. Specifically, it can be confirmed that the RORC gene or the RORC protein is overexpressed in the patient's sample to confirm liver fibrosis or liver cirrhosis, and the RORC gene or the RORC protein is overexpressed in the sample of chronic hepatitis patients And whether or not liver fibrosis or liver hardening is progressing.

The RORC gene is a transcription factor that binds to DNA and is known as a gene for the RAR-related orphan receptor C protein, one of the nuclear hormone receptors. The RORC gene and its protein information can be found in the National Center for Biotechnology Information (NCBI). More specifically, the gene sequence of mouse RORC is registered as NM_011281 and the protein sequence is registered as NP_035411. The gene sequence of human RORC is registered as NM_005060 and the protein sequence as NP_005051. However, the function of the protein expressed by the RORC gene has not yet been elucidated. In particular, the relationship between RORC and hepatic fibrosis or liver cirrhosis is not known at all.

The degree of expression of RORC can be determined by confirming the expression level of the protein encoded by the mRNA or gene of the RORC gene.

In the present invention, "measurement of mRNA expression level of RORC gene" is a process of confirming the presence and expression level of mRNA of RORC gene in a biological sample in order to diagnose liver fibrosis or liver cirrhosis. have. RT-PCR (Real-time RT-PCR), RNase protection assay (RPA), and RNase protection assay (RT-PCR) ), Northern blotting, and DNA chips, but are not limited thereto.

The agent for measuring the degree of mRNA expression of the RORC gene refers to a substance that can be used to detect the mRNA of the RORC gene in a sample of a patient. For example, it may be a primer, a probe, an antisense oligonucleotide, or the like that can complementarily bind to the mRNA of the RORC gene. It is preferable that the antisense nucleotide, primer or probe specifically binds to the mRNA nucleotide sequence of the RORC gene and does not specifically bind to the nucleotide sequence of the other nucleic acid material.

Here, complementary binding means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively to the mRNA target of the RORC gene under a predetermined hybridization or annealing condition, preferably physiological conditions, Quot; means " including both substantially complementary and perfectly complementary, and is preferably completely complementary.

For example, the agent used to detect the mRNA biomarker of the RORC gene of the present invention may be an antisense oligonucleotide. The term "antisense oligonucleotide" means a nucleic acid-based molecule having a complementary sequence to the mRNA sequence of the target RORC gene and capable of forming a duplex with the mRNA of the RORC gene. The mRNA of the RORC gene of the present invention Can be used to detect the marker.

As another example, the agent used for detecting the mRNA biomarker of the RORC gene of the present invention is a primer pair or a probe, and the nucleotide sequence of the RORC gene is known. A primer or a probe that specifically amplifies a specific region can be designed.

The term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and functioning as a starting point for template strand copying. Lt; RTI ID = 0.0 > 50 < / RTI > Primers are usually synthesized but can also be used in naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but is sufficiently complementary that it can hybridize with the template. Primers are designed to initiate DNA synthesis in the presence of a polymerization reaction (i. E., A reagent for DNA polymerase or reverse transcriptase, and four different nucleoside triphosphates) at the appropriate buffer solution and temperature In the present invention, it is possible to diagnose liver fibrosis or liver cirrhosis by performing PCR amplification using a sense of RORC nucleotide sequence and an antisense primer. The PCR conditions, the lengths of the sense and antisense primers, The primer of the present invention can be a primer capable of amplifying the mRNA of the RORC gene.

In another example, the agent used to detect the mRNA biomarker of the RORC gene of the present invention may be a probe. The term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or a few hundred nucleotides that can specifically bind to mRNA, and is labeled to confirm the presence or absence of a specific mRNA . The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization is performed using a probe complementary to the RORC polynucleotide, and liver fibrosis or liver hardening can be diagnosed through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

The primers or probes of the present invention can be chemically synthesized using a phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may incorporate additional features that do not alter the basic properties. Examples of additional features that may be incorporated include, but are not limited to, methylation, capping, substitution of one or more nucleic acids with homologues, and modification between nucleic acids.

In the present invention, "measurement of protein expression level" is a process of confirming the presence and expression level of a protein expressed in a RORC gene in a biological sample in order to diagnose hepatic fibrosis or liver hardening. The amount of protein can be confirmed by using an antibody. Examples of the assay methods include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis But are not limited to, tissue immuno staining, immunoprecipitation assays, complement fixation assays, FACS and protein chips.

The agent for measuring the RORC protein level herein is preferably an antibody. "Antibody" means a specific protein molecule, as is known in the art, directed against an antigenic site. For the purpose of the present invention, the antibody refers to an antibody that specifically binds to the RORC protein, which is a marker of the present invention. Such an antibody may be obtained by cloning RORC gene into an expression vector according to a conventional method, To obtain a RORC protein encoded by the RORC protein, and can be prepared from the obtained RORC protein by a conventional method. Also included are partial peptides that can be made from the RORC protein, and the partial peptides of the invention include at least 7 amino acids, preferably 9 amino acids, more preferably 12 amino acids. The form of the antibody of the present invention is not particularly limited, and a polyclonal antibody, a monoclonal antibody or a part thereof having antigen binding ability is included in the antibody of the present invention and includes all immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies.

Antibodies used in the detection of liver fibrosis or liver cirrhosis diagnostic markers of the present invention are not limited to complete forms having two full length light chains and two full length heavy chains as well as functional fragments of antibody molecules . A functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

In addition, the present invention can be implemented in the form of a kit in the form of a composition for diagnosing liver fibrosis or liver cirrhosis, which comprises an agent for measuring the expression level of mRNA of RORC gene or its protein.

The kit of the present invention can confirm the expression level of mRNA or RORC protein of RORC gene which is a marker of hepatic fibrosis or liver cirrhosis. The kit of the present invention may further comprise one or more other component compositions suitable for the assay, as well as antibodies recognizing primers, probes, antisense oligonucleotides or optionally RORC proteins for measuring the degree of expression of the mRNA or RORC protein of the RORC gene , Solutions or devices.

As a specific example, the kit for measuring the degree of mRNA expression of the RORC gene in the present invention may be a kit containing essential elements necessary for conducting RT-PCR. The RT-PCR kit includes a test tube or other suitable container, reaction buffer (pH and magnesium concentration varying), deoxynucleotides (dNTPs), Taq-polymer Enzymes such as lyase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. It may also contain a primer pair specific to the gene used as a quantitative control. Also preferably, the kit of the present invention may be a diagnostic kit containing essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, a reagent for preparing a fluorescent-labeled probe, a preparation, an enzyme, and the like. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

As another specific example, the kit for measuring the degree of expression of the RORC protein in the present invention includes a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate, etc. for immunological detection of the antibody can do. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a slide glass made of glass, etc. The coloring enzyme may be peroxidase, Alkaline Phosphatase may be used as the fluorescent substance, FITC, RITC or the like may be used as the fluorescent substance, and ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) ) Or OPD (o-phenylenediamine), TMB (tetramethylbenzidine) can be used.

In another aspect, the present invention provides a method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from a sample of a patient to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.

More specifically, the degree of expression of the RORC gene can be detected at the mRNA level or the protein level, and the mRNA or protein can be separated from the patient sample using a known process.

The term "patient sample" in the present invention includes, but is not limited to, tissues, cells, blood, serum, plasma, saliva, urine or the like which are different in degree of expression of RORC as an liver fibrosis or hepatocyte marker gene .

Through the above detection methods, the degree of RORC expression in patients suspected to have liver fibrosis or liver cirrhosis can be compared with the level of RORC expression in the normal control group to diagnose the actual liver fibrosis or liver hardening of the patient. The expression of RORC in patients with liver fibrosis or liver cirrhosis was assessed and the degree of expression of RORC in normal controls was measured. The degree of expression of RORC was measured in liver fibrosis or liver cirrhosis More patients in presumptive patients may be diagnosed with liver fibrosis or liver cirrhosis if they are presumed to have liver fibrosis or liver cirrhosis.

Alternatively, in order to determine whether a patient with chronic hepatitis developed into hepatitis, the change in the degree of RORC expression from a sample of patients with chronic hepatitis was measured, and when a significant increase in RORC expression was measured, the corresponding chronic hepatitis patient developed liver cirrhosis .

The assay method for measuring the mRNA expression level of the RORC gene includes, but is not limited to, reverse transcriptase polymerase, competitive reverse transcriptase polymerase, real-time reverse transcriptase polymerase, RNase protection assay, northern blotting, It is not. Through the above detection methods, it is possible to compare the degree of mRNA expression of the RORC gene in the normal control group and the degree of mRNA expression of the RORC gene in patients suspected of having liver fibrosis or hepatitis, and whether the expression level of the RORC gene is significantly increased The liver fibrosis or liver cirrhosis of patients suspected to have liver fibrosis or liver cirrhosis can be diagnosed.

The measurement of the mRNA expression level of the RORC gene is preferably performed using a reverse transcriptase polymerase reaction method or a DNA chip using a primer specific to the mRNA of the RORC gene, which is an liver fibrosis or hepatocyte marker.

The reverse transcription polymerase chain reaction (RT-PCR) was followed by electrophoresis to identify the band pattern and band thickness of the RORC gene, and the mRNA expression and the degree of RORC gene expression were verified and compared with the control group. It is easy to diagnose.

Analysis methods for measuring protein levels include Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Oucheroton immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, complement fixation assay, FACS, Protein chips, and the like. Through these analytical methods, it is possible to compare the amount of antigen-antibody complex formed in the normal control group with the amount of antigen-antibody complex formed in patients with suspected liver fibrosis or hepatic cirrhosis, and whether the expression of RORC protein is significantly increased , It is possible to diagnose whether hepatic fibrosis or liver cirrhosis is actually suspected in patients with liver fibrosis or liver cirrhosis.

As used herein, the term "antigen-antibody complex" refers to a combination of the RORC protein, which is a hepatic fibrosis or hepatocyte marker, and an antibody specific thereto, and the amount of the antigen-antibody complex formed depends on the size of the signal of the detection label It is measurable quantitatively.

Such detection labels may be selected from the group consisting of enzymes, mimetics, ligands, emitters, microparticles, redox molecules, and radioisotopes, but are not necessarily limited thereto. When an enzyme is used as the detection label, available enzymes include? -Glucuronidase,? -D-glucosidase,? -D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholine Glucoamylase, terazo, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokutase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decar ≪ / RTI > beta-lactamase, and the like. The minerals include, but are not limited to, fluorescein, isothiocyanate, rhodamine, picoeriterine, picocyanin, allophycocyanin, o-phthaldehyde, fluororescamine and the like. Ligands include, but are not limited to, biotin derivatives. Emitters include, but are not limited to, acridinium esters, luciferin, luciferase, and the like. Fine particles include, but are not limited to, colloidal gold, colored latex, and the like. Redox molecules include ferrocene, ruthenium complex compounds, Biology hydrogen, quinone, Ti ions, Cs ions, diimide, 1,4-benzoquinone, _{hydroquinone, K 4 W (CN) 8} , [Os (bpy) 3] 2 + , [RU (bpy) ₃ ] 2 ⁺ , [MO (CN) ₈ ] 4 ^-, and the like. Radioisotope includes include ^{3 H, 14 C, 32 P} , 35 S, 36 Cl, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, 125 I, 131 I, 186 Re are not limited to .

In one embodiment, the degree of protein expression is measured by ELISA. ELISAs include direct ELISA using labeled antibodies that recognize the antigen attached to the solid support, indirect ELISA using labeled antibodies that recognize the capture antibody in a complex of antibodies recognizing the antigen attached to the solid support, A direct sandwich ELISA using another labeled antibody that recognizes an antigen in the complex of antibody and antigen, a method of reacting with another antibody recognizing an antigen in a complex of an antibody and an antigen attached to a solid support, Indirect sandwich ELISA using a secondary antibody, and various ELISA methods. More preferably, the antibody is attached to a solid support, the sample is reacted, and the labeled antibody recognizing the antigen of the antigen-antibody complex is adhered to produce an enzyme, or an antibody that recognizes the antigen of the antigen-antibody complex Is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and the enzyme is developed. Liver fibrosis or liver cirrhosis can be confirmed by confirming the degree of complex formation of RORC protein and antibody as a liver fibrosis or hepatocyte marker.

Preferably, Western blotting is used with one or more antibodies against the RORC protein. The whole protein is separated from the sample, and the protein is separated according to size by electrophoresis, and then transferred to the nitrocellulose membrane to react with the antibody. The amount of the RORC protein produced by the expression of the gene can be confirmed by confirming the amount of the generated antigen-antibody complex using the labeled antibody to confirm whether the liver fibrosis or liver hardening has occurred. This detection method is performed by examining the amount of RORC gene expression in the control group and the expression level of the RORC gene in a patient suspected of liver fibrosis or liver cirrhosis. The mRNA or protein level of the RORC gene can be expressed as the absolute (eg, ug / ml) or relative (eg, the relative intensity of the signal) difference of the RORC protein.

Also, preferably, one or more antibodies against the RORC protein is arranged at a predetermined position on the substrate to use a protein chip immobilized at a high density. A method of analyzing a sample using a protein chip is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, Liver fibrosis or liver cirrhosis.

In another embodiment, the present invention provides a method of treating liver fibrosis or liver cirrhosis, comprising measuring the degree of expression of the RORC gene or the degree of expression of the RORC protein encoded by the RORC gene after administration of a substance expected to treat liver fibrosis or liver cirrhosis, Or a method for screening a therapeutic agent for liver cirrhosis.

Specifically, it can be useful for screening therapeutic agents for hepatic fibrosis or liver cirrhosis by comparing the increase or decrease in the expression of RORC in the presence or absence of candidate agents for hepatic fibrosis or hepatocyte treatment. Substances that indirectly or directly reduce the concentration of RORC can be selected as therapeutic agents for liver fibrosis or liver cirrhosis. In other words, the degree of expression of RORC in liver fibrosis or hepatocyte cells in the absence of candidates for hepatic fibrosis or hepatic cirrhosis treatment is measured, and the degree of expression of the marker RORC of the present invention in the presence of a candidate agent for hepatic fibrosis or liver cirrhosis The results of this study were as follows: 1) The ratio of RORC expression in liver fibrosis or liver cirrhosis to liver fibrosis or liver cirrhosis was significantly higher than that of RORC It can be predicted as a remedy.

The present invention provides a technique for diagnosing liver fibrosis or liver cirrhosis using a non-invasive method by using the mRNA of the RORC gene or a protein thereof as a biomarker, and by using the same, it is possible to more easily and quickly and accurately diagnose liver fibrosis or liver cirrhosis Diagnosis is possible.

In the figure, "Control 48h" represents FL83B cells after 48 hours in the TGF-β1-untreated control group and "TGF-β 48h" represents FL83B cells after 48 hours of treatment with TGF-β1.
FIG. 1 shows the morphological changes of FL83B cells treated with TGF-β1.
FIG. 2 shows the expression of β-actin as an EMT-related marker, E-cadherin, N-cadherin, α-sma, RORC protein and control group by Western blotting by treating TGF-β1 with FL83B cells.
FIG. 3 shows the mRNA expression of the β-actin gene by RT-PCR (Reverse Transcription Polymerase Chain Reaction) as a control and mRNA of the RORC gene by treating TGF-β1 with FL83B cells.
FIG. 4 shows the expression of β-actin as an EMT-related marker E-cadherin, β-catenin, α-sma, RORC protein and control group in Western blot in CCl4 intraperitoneally injected mice. "Normal" denotes the mouse CCl ₄ are not injected intraperitoneally, "CCl ₄ 8wk" is a CCl4 intraperitoneal injection, and shows a mouse after 8 weeks.
FIG. 5 is a Western blot image showing protein expression of E-cadherin and RORC which are EMT-related markers in patients with chronic hepatitis B and liver cirrhosis. "CHB" refers to patients with chronic hepatitis B, and LC refers to patients with liver cirrhosis.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  One. In vitro EMT  Establishing the model

FL83B cells (mouse normal hepatocyte cell line) (CRL-2390, ATCC) Were cultured in F12K medium containing 10% FBS, 1% antibiotics (Antibiotic-Antimycotic, Gibco) containing 2 g / ml of insulin for 48 hours and then cultured with 2 g / ml insulin and 3 ng / Of TGF-β was treated with F12K medium containing 0.5% FBS and 1% antibiotic (Antibiotic-Antimycotic, Gibco) for 48 hours to construct an in vitro EMT model. Experimental groups were divided into two groups: (1) cultured in F12K medium containing 2 g / ml of insulin, 10% FBS and 1% antibiotic (Antibiotic-Antimycotic, Gibco) for 48 hours, (2) 2 g / ml insulin and 10% FBS, 1% fetal bovine serum, and (2) a control 48 h group cultured in media containing 0.5% FBS and 1% antibiotics (Antibiotic-Antimycotic, Gibco) After incubation for 48 hours in F12K medium containing antibiotic (Antibiotic-Antimycotic, Gibco), 2g / ㎖ of insulin and 3ng / ㎖ TGF-β were added with 0.5% FBS and 1% antibiotic (Antigenic Antimycotic, Gibco) And EMT 48h group cultured for 48 hours in one medium.

The antibiotic used (Antibiotic-Antimycotic, Gibco) consisted of penicillin 10,000 units / mL, streptomycin 10,000 μg / mL and Fungizone 25 μg / mL.

Example  2. Liver fibrosis In vivo  Establishing the model

5-week-old Balb / c mice (Oriental Bio) were intraperitoneally injected with 0.5 L of 10% CCl ₄ per g body weight every 3 days for 8 weeks to induce liver fibrosis or liver cirrhosis.

Example  3. Patient sample

Seven patients with chronic hepatitis B and liver cirrhosis were treated with liver biopsy at the Catholic University of Seoul, Korea.

Example  4. Total RNA  Extraction and Reverse Transcription Polymerase Chain  Reaction ( RT - PCR )

1 ml of TRIZOL reagent (Invitrogen, Carlsbad, Calif., USA) was added to EMT-induced cells, mixed and left at room temperature for 5 minutes. After adding 0.2 ml of chloroform, the mixture was allowed to stand at room temperature for 2 to 3 minutes. The mixture was centrifuged at 12,000 g for 15 minutes at 4 ° C, and the colorless supernatant was transferred to a new tube. 0.5 ml of isopropanol was added to the supernatant, and the mixture was allowed to stand at room temperature for 10 minutes, followed by centrifugation at 12,000 g for 10 minutes at 4 ° C to precipitate RNA and remove the upper layer. The precipitated RNA was mixed well with 1 ml of 75% ethanol and centrifuged at 12,000 g for 10 minutes at 4 ° C to remove the upper layer and then dried at room temperature for 10 minutes. 100 μl of distilled water was added to the dried RNA, and 1 μl of the RNA was dissolved. The absorbance was measured using a spectrometer, and the purity of the RNA was confirmed by performing electrophoresis on 1% agarose gel . 1 g of RNA was synthesized by using a polymerase chain reaction kit (Invitrogen), denatured at 95 ° C. for 5 minutes with primers of β-actin and RORC, and incubated at 95 ° C. for 1 minute , 55 ° C for 30 seconds, and 72 ° C for 1 minute, followed by amplification by reaction at 72 ° C for 10 minutes. The primer sequences used are shown below (Table 1).

SEQ ID NO: Gene name The base sequence (5 '- > 3') One β-actin Forward primer GGCACACACCTTCTACAATGA 2 β-actin Reverse primer CCCTCGTAGATGGGCACAGT 3 RORC Forward primer GGTACCATATGCCTCTCTGA 4 RORC Reverse primer CATTGACTTCCTCTGGTAGC

Example  5. Western Blot  analysis

EMT-induced cells and liver biopsy tissue of liver fibrosis mice or chronic hepatitis B and liver cirrhosis patients, which were disrupted from the mulch bowl, were extracted with lysis buffer , Electrophoresed on 10% SDS-PAGE gel, transferred to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) and blocked with blocking buffer for 30 minutes at room temperature . After blocking, the cells were washed with TBS-T 3 times for 10 minutes, and then reacted with the primary antibody. The primary antibodies were monoclonal mouse anti-α-sma (Sigma-Aldrich), polyclonal rabbit anti RORC (abCAM, UK), monoclonal rabbit E-cadherin antibody anti-rabbit E-cadherin (Cell Signaling Technology, Beverly, MA, USA), polyclonal anti-rabbit N-cadherin (Cell Signaling Technology), monoclonal mouse anti- -catenin (BD Tansduction Laboratories, CA, USA) was diluted 1: 1,000 in TBS buffer containing 1% BSA and reacted overnight at 4 ° C in cold room. The secondary antibody was then incubated with horseradish peroxidase , Anti-rabbit IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and anti mouse IgG (Santa Cruz Biotechnology Inc.) were reacted at room temperature for 2 hours. Each reaction was washed with TBS-T three times for 10 minutes to remove non-specific reaction and exposed to Las-4000 (Fujifilm corporation, Japan) using ECL solution (Amersham).

Experiment result

One. In vitro EMT  Cells in the model morphology  Change and EMT  relation marker And RORC Expression

FL83B cells were treated with TGF-β1 for 48 hours to induce an EMT model in vitro. The morphology of the cells was confirmed. The cells of the TGF-β1 48h group were more typical of polygonal hepatocytes than the Control 48h group (Mesenchymal morphology) (Fig. 1).

The expression of E-cadherin, an epithelial marker, was reduced in the TGF-β1 48h group compared to the Control 48h group, and the expression of E-cadherin, a mesenchymal marker, N -cadherin and α-sma were increased. These results demonstrate that the EMT model has been established by treating TGF-β1 for 48 hours.

In addition, the expression of RORC in the EMT model was observed, and the expression of RORC was increased in the TGF-β1 48h group as compared to the Control 48h group (FIG. 2). In addition, the expression of RORC in the EMT model was observed by Reverse Transcription Polymerase Chain Reaction (RT-PCR), indicating that RORC mRNA expression was increased in the TGF-β1 48h group compared to the Control 48h group (Fig. 3). These results indicate that the expression of RORC is increased in the EMT model.

2. In an animal model of liver fibrosis EMT  relation marker Wow RORC Manifestation of

The expression of E-cadherin and β-catenin, which are epithelial markers, decreased at 8 weeks after CCl ₄ treatment in the animal model of liver fibrosis induced by treatment with CCl ₄ in Balb / c mice. -sma expression was increased at 8 weeks compared to the normal control group, confirming that the animal model of liver fibrosis was implemented by molecular biology. In addition, the expression of RORC in the same tissues was found to be increased in the liver fibrosis-induced group as compared to the normal control group (Fig. 4). These results suggest that EMT - like tendency similar to EMT can be observed in liver fibrosis induced by EMT.

3. Chronic hepatitis B ( chronic hepatitis  B) and liver cirrhosis liver cirrhosis ) In patient liver tissue EMT  relation marker Wow RORC Confirmation of expression of

E-cadherin, an epithelial marker, was similarly expressed in hepatitis B hepatitis patients compared with normal liver tissues, but E-cadherin expression was decreased in liver liver tissues compared with normal liver tissues. The expression of RORC in hepatocyte hepatitis B patients was similar to that of normal hepatocytes but the expression of RORC was increased in liver liver tissues compared with normal liver tissues (FIG. 5). As chronic hepatitis B progressed progressively, liver RORC expression was increased.

<110> CATHOLIC UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Biomaker RORC for diagnosing liver fibrosis <130> DPP20132867 <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Beta-actin Forward primer <400> 1 ggcaccacac cttctacaat ga 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Beta-actin Reverse primer <400> 2 ccctcgtaga tgggcacagt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RORC Forward primer <400> 3 ggtaccatat gcctctctga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RORC Reverse primer <400> 4 cattgacttc ctctggtagc 20

Claims (11)

A composition for diagnosing liver fibrosis or liver cirrhosis comprising an agent for measuring the expression level of mRNA of RAR-related orphan receptor C (RORC) gene or its protein.
2. The composition of claim 1, wherein the agent that measures the RORC protein is an antibody specific for the RORC protein.
3. The composition of claim 2, wherein said antibody is a monoclonal antibody or polyclonal antibody specific for RORC protein.
The composition according to claim 1, wherein the agent for measuring the mRNA expression level of the RORC gene is an antisense oligonucleotide complementary to the mRNA of the RORC gene, a primer or a probe.
A kit for the diagnosis of liver fibrosis or liver cirrhosis comprising the composition of any one of claims 1 to 4.
A method for detecting liver fibrosis or liver cirrhosis diagnostic marker RORC from liver tissue samples of a patient to provide information necessary for diagnosis of liver fibrosis or liver cirrhosis.
delete The method according to claim 6,
Comparing the expression level of the RORC gene mRNA or its protein from the liver tissue sample of the patient and comparing the expression level of the RORC gene mRNA or its protein with that of the RORC gene mRNA or its protein in the normal control sample &Lt; / RTI &gt;
[9] The method according to claim 8, wherein the expression level of the mRNA of the RORC gene is measured by a reverse transcriptase polymerase, a competitive reverse transcriptase polymerase, a real-time reverse transcriptase polymerase, an RNase protection assay, a Northern blotting, Lt; / RTI &gt;
9. The method according to claim 8, wherein the expression level of the RORC protein is measured by Western blotting, ELISA, radioimmunoassay, radioimmunoprecipitation, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, Complement fixation assay, FACS or protein chip.
A method for screening a therapeutic agent for hepatic fibrosis or liver cirrhosis comprising the step of detecting a change in the expression level of mRNA of the RORC gene or a protein thereof after treating a candidate agent for hepatic fibrosis or liver cure.

Images