KR20120061010A - Method for Diagnosis of Gastric Cancer - Google Patents

Method for Diagnosis of Gastric Cancer Download PDF

Info

Publication number
KR20120061010A
KR20120061010A KR1020100108357A KR20100108357A KR20120061010A KR 20120061010 A KR20120061010 A KR 20120061010A KR 1020100108357 A KR1020100108357 A KR 1020100108357A KR 20100108357 A KR20100108357 A KR 20100108357A KR 20120061010 A KR20120061010 A KR 20120061010A
Authority
KR
South Korea
Prior art keywords
met
gastric cancer
additive
protein
seq
Prior art date
Application number
KR1020100108357A
Other languages
Korean (ko)
Inventor
박수경
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020100108357A priority Critical patent/KR20120061010A/en
Priority to PCT/KR2011/008314 priority patent/WO2012060636A2/en
Publication of KR20120061010A publication Critical patent/KR20120061010A/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57446Specifically defined cancers of stomach or intestine
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

PURPOSE: A method for diagnosing gastric cancer using soluble truncated c-Met is provided to simply and efficiently diagnose gastric cancer. CONSTITUTION: A method for diagnosing gastric cancer comprises: a step of measuring soluble truncated c-Met protein level in a biological sample; and a step of comparing protein level of the biological sample with the protein level of a normal individual. The biological sample is blood or plasma. The method additionally comprises a step of identifying genetic risk score of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC. A composition for diagnosing gastric cancer contains an agent for measuring soluble truncated c-Met protein level.

Description

위암 진단 방법{Method for Diagnosis of Gastric Cancer}Method for Diagnosing Gastric Cancer {Method for Diagnosis of Gastric Cancer}

본 발명은 가용성 불완전(soluble truncated) c-Met 단백질을 이용한 위암 진단 방법에 관한 것이다.
The present invention relates to a method for diagnosing gastric cancer using soluble truncated c-Met protein.

헬리코박터파이로리균은 전 세계 인류의 50% 가량에서 발견되는 균으로 위궤양 및 심할 경우 위암을 유발할 수 있고, 최근 연구결과 헬리코박터균에 감염된 사람들 중 세포독성단백질(CagA)을 생성하는 균에 감염된 경우가 그렇지 않은 경우에 비해 위암 발생 위험이 3.7배 가량 높게 나타난다고 밝혀졌다. Helicobacter pylori is a bacterium found in about 50% of the world's humans. It can cause gastric ulcers and severe gastric cancer, and recent studies have shown that those infected with Helicobacter bacillus are producing cytotoxic proteins (CagA). It was found that the risk of gastric cancer was 3.7 times higher than in the other cases.

따라서 CagA와 상호작용하는 단백질이 위암 발생에 연관되어 있다고 예측할 수 있으며, 현재 그 중 간세포생장인자(hepatocyte growth factor, HGF) 수용체인 c-Met 단백질에 대한 연구가 활발히 이루어지고 있다. Therefore, it can be predicted that the protein interacting with CagA is involved in the development of gastric cancer, and among them, c-Met protein, a hepatocyte growth factor (HGF) receptor, has been actively studied.

c-Met단백질은 막관통 단백질(transmembrane protein)로, 원발암유전자(proto-oncogene)으로부터 전사된다. 성숙한 c-Met 단백질은 이황화결합으로 연결된 헤테로다이머 α (50-kDa) 및 β (145-KDa) 체인이다 (Giordano S et al ., 1988). β-체인은 세포막 외부의 HGF 결합 도메인과 세포내부의 티로신-키나아제 활성 도메인을 연결한다 (Bottaro DP et al ., 1991, Dean M et al., 1985). c-Met protein is a transmembrane protein that is transcribed from the proto-oncogene. Mature c-Met proteins are heterodimer α (50-kDa) and β (145-KDa) chains linked by disulfide bonds (Giordano S et al . , 1988). β-chains link HGF binding domains outside the cell membrane with intracellular tyrosine-kinase active domains (Bottaro DP et al . , 1991, Dean M et al. , 1985).

단백질 가수분해가 이루어지면, 전체 c-Met 단백질은 내피세포막에서부터 분리되어 가용성 불완전(soluble truncated) c-Met 단백질을 형성한다. 가용성 불완전(soluble truncated) c-Met 단백질은 막 도메인 중 전체 세포 외부 부분으로 구성되어 있고, 전체 c-Met 단백질과 경쟁적으로 HGF와 결합한다 (Wajih N et al., 2002). 이러한 가용성 불완전(soluble truncated) c-Met 단백질의 선택적인 결합은 암 발생을 저해하기 위한 반대 세포 신호전달의 형성 가능성을 시사한다. Upon proteolysis, the entire c-Met protein is separated from the endothelial cell membrane to form a soluble truncated c-Met protein. The soluble truncated c-Met protein consists of the whole cell outer part of the membrane domain and binds HGF competitively with the whole c-Met protein (Wajih N et al., 2002). The selective binding of these soluble truncated c-Met proteins suggests the possibility of forming opposite cell signaling to inhibit cancer development.

전체 c-Met 단백질은 조직 또는 세포에서만 발현 정도를 확인 할 수 있는데 반해, 가용성 불완전 c-Met 단백질은 혈액을 통해 그의 농도를 확인할 수 있다. 따라서 상기 가용성 불완전 c-Met을 바이오 마커로 사용한다면 간편하고 효율적으로 질병의 가능성을 판단할 수 있는 바, 이를 바이오 마커로 사용하기 위한 많은 연구가 이루어지고 있다.
While the total c-Met protein can be expressed only in tissues or cells, the soluble incomplete c-Met protein can check its concentration in the blood. Therefore, if the soluble incomplete c-Met is used as a biomarker, the possibility of disease can be easily and efficiently determined, and many studies have been made to use it as a biomarker.

따라서 본 발명은 가용성 불완전(soluble truncated) c-Met 단백질을 위암 진단의 표지 물질로 사용하여 위암을 간편하고 효율적으로 진단하는 방법을 제공하고자 한다.
Accordingly, the present invention is to provide a method for easily and efficiently diagnosing gastric cancer by using a soluble truncated c-Met protein as a marker for gastric cancer diagnosis.

본 발명은 상기 과제의 해결을 위하여, 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질의 수준을 측정하는 단계; 및 상기 단백질 수준을 정상 개체의 단백질 수준과 비교하는 단계를 포함하는 위암 진단 방법을 제공한다. The present invention to solve the above problem, measuring the level of soluble truncated c-Met protein in a biological sample; And comparing the protein level with that of a normal individual.

또한 본 발명은 가용성 불완전(soluble truncated) c-Met 단백질 수준을 측정하는 제제를 포함하는 위암 진단용 조성물을 제공한다.
In another aspect, the present invention provides a composition for diagnosing gastric cancer comprising an agent for measuring the level of soluble truncated c-Met protein.

본 발명에 의하면, 혈액에서 손쉽게 채취할 수 있는 가용성 불완전(soluble truncated) c-Met 단백질을 마커로 사용하는 바, 위암을 간편하고 효율적으로 진단할 수 있다.
According to the present invention, soluble truncated c-Met protein, which can be easily collected from blood, is used as a marker, and thus gastric cancer can be diagnosed easily and efficiently.

도 1은 실시예 6의 ROC curve이다. 1 is a ROC curve of Example 6.

본 발명은 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질의 수준을 측정하는 단계; 및 상기 단백질 수준을 정상 개체의 단백질 수준과 비교하는 단계를 포함하는 위암 진단 방법을 제공한다. The present invention comprises the steps of measuring the level of soluble truncated c-Met protein in a biological sample; And comparing the protein level with that of a normal individual.

본 발명의 발명자들은 가용성 불완전(soluble truncated) c-Met 단백질을 질병을 진단하기 위한 표지인자로 사용하기 위한 연구를 계속하던 중, 위암 환자에게서는 위암 진단 시점이 가까워지면 혈액내 가용성 불완전(soluble truncated) c-Met 단백질 농도가 감소한다는 점을 발견하고, 본 발명을 완성하게 되었다. The inventors of the present invention continue to use the soluble truncated c-Met protein as a marker for diagnosing a disease, and in patients with gastric cancer, soluble truncated in the blood when gastric cancer is neared. The present inventors have found that the c-Met protein concentration is reduced, thus completing the present invention.

본 발명의 한 구체예에서, 상기 생물학적 시료는 이제 제한되는 것은 아니나, 구체적으로 조직, 세포, 혈액 또는 혈장을 사용할 수 있으며, 바람직하게는 혈액 또는 혈장을 사용할 수 있다. 본 발명은, 채취가 용이한 혈액에서 검출되는 단백질을 마커로 사용한다는 점에서 유용하다. 혈액은 예를 들면, 정맥, 동맥 또는 모세관으로부터 선행 기술에 공지된 방법에 의해 채취할 수 있으며, 보다 구체적으로 혈액은 주사기를 통해 피검체의 팔로부터 정맥 혈액을 채취하여 수득될 수 있으나, 이에 제한되는 것은 아니다.
In one embodiment of the invention, the biological sample is not limited now, but may specifically use tissue, cells, blood or plasma, preferably blood or plasma. The present invention is useful in that a protein that is easily detected in blood is used as a marker. Blood may be taken, for example, from veins, arteries or capillaries by methods known in the art, and more specifically, blood may be obtained by taking venous blood from the subject's arm via a syringe, but not limited thereto. It doesn't happen.

본 발명의 다른 구체예에서, 상기 가용성 불완전(soluble truncated) c-Met 단백질의 수준의 측정은 상기 단백질에 특이적으로 인지하는 항체를 시료에 접촉하여 이의 항원-항체 복합체 형성을 측정하는 방법으로 수행될 수 있다. 상기 항원-항체 복합체의 형성량은 검출 라벨의 시그널의 크기를 통해서 정량적으로 측정 가능하며, 이러한 검출 라벨은 구체적으로 이에 제한되는 것은 아니나, 효소, 형광물, 리간드, 발광물, 미소입자(microparticle), 레독스 분자 및 방사선 동위원소로 이루어진 군 중에서 하나 이상을 선택하여 사용할 수 있다.
In another embodiment of the present invention, the measurement of the level of the soluble truncated c-Met protein is performed by a method of contacting a sample with an antibody that specifically recognizes the protein and measuring its antigen-antibody complex formation. Can be. The amount of the antigen-antibody complex formed can be quantitatively measured through the size of a signal of a detection label, and the detection label is not particularly limited thereto, but may be an enzyme, a fluorescent substance, a ligand, a luminescent substance, or a microparticle. At least one selected from the group consisting of redox molecules and radioisotopes may be used.

단백질 수준을 측정하기 위한 방법으로는, 웨스턴 블롯, ELISA, 방사선면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 면역침전 분석법, 보체 고정 분석법, 프리시피틴 반응, 겔 확산 프리시피틴 반응, 응집 분석법, 형광 면역분석법, 단백질 A 면역분석법, FACS, 단백질 칩 등과 같은 경쟁 또는 비경쟁 공지된 분석 방법을 이용할 수 있으나, 이에 제한되는 것은 아니며, 임의의 방법에 의해 수행될 수 있다.Methods for measuring protein levels include Western blot, ELISA, radioimmunoassay, radioimmunoassay, oukteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, pricipitin Competitive or non-competitive known analytical methods such as reactions, gel diffusion prispicin response, aggregation assays, fluorescence immunoassays, Protein A immunoassays, FACS, protein chips, and the like can be used, but are not limited thereto. Can be performed.

상기 ELISA는 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 표지된 또 다른 항체를 이용하는 직접적 샌드위치 ELISA, 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 또 다른 항체와 반응시킨 후 이 항체를 인지하는 표지된 2차 항체를 이용하는 간접적 샌드위치 ELISA 등의 다양한 ELISA 방법을 포함한다.
The ELISA is a direct sandwich ELISA using another labeled antibody that recognizes the antigen in a complex of the antibody and the antigen attached to the solid support, and reacted with another antibody that recognizes the antigen in the complex of the antibody and antigen attached to the solid support. And various ELISA methods such as indirect sandwich ELISA using a labeled secondary antibody which then recognizes this antibody.

본 발명의 또 다른 구체예에서, 상기 진단 방법은 서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열의 존재를 확인하는 단계를 추가로 포함할 수 있다. In another embodiment of the present invention, the diagnostic method comprises 10 to 50 consecutive DNA sequences comprising a 27th base (polymorphic site) in one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 3 or Identifying the presence of a complementary sequence.

본 발명의 발명자들은, c-Met 단백질의 유전자에 존재하는 유전자 다형성을 추가적으로 조사한 결과, 서열번호 1 내지 서열번호 3으로 나타나는 SNP가 위암과 유의하다는 것을 밝혀내고, 이를 가용성 불완전(soluble truncated) c-Met 단백질의 수준에 대한 정보와 함께 분석하면 위암 진단의 정확성이 더욱 높아진다는 점을 발견하였다The inventors of the present invention further examined the gene polymorphism present in the gene of c-Met protein, and found that the SNP represented by SEQ ID NO: 1 to SEQ ID NO: 3 is significant with gastric cancer, and it is soluble in truncated c- Analysis with information on the level of Met protein found that the accuracy of gastric cancer diagnosis was higher.

본 발명의 또 다른 구체예에서, 상기 서열번호 1 내지 3의 SNP의 구체적인 염기서열은 아래 표 1과 같다. In another embodiment of the present invention, specific nucleotide sequences of the SNPs of SEQ ID NOs: 1 to 3 are shown in Table 1 below.

서열번호SEQ ID NO: rs 번호 (ncbi gene bank)rs number (ncbi gene bank) 5'-부터의 염기서열Base sequence from 5'- 1One rs41739rs41739 TATGTTAAGCAAAACATACTTTAGAA[A/G]CAAATGAAAAAGGCAATTGAAAATCTATGTTAAGCAAAACATACTTTAGAA [A / G] CAAATGAAAAAGGCAATTGAAAATC 22 rs6566rs6566 TTGTTCTGATAAATCATGCAATTAAA[A/G]TAAAGTGATGCAACATCTTGTATACTTGTTCTGATAAATCATGCAATTAAA [A / G] TAAAGTGATGCAACATCTTGTATAC 33 rs41738rs41738 GCTACTCTGATCTAATGAATGTGAAC[A/G]TGTAGATGTTTTGTGTGTATTTTTTGCTACTCTGATCTAATGAATGTGAAC [A / G] TGTAGATGTTTTGTGTGTATTTTTT

상기 각각의 폴리뉴클레오티드에서 SNP의 위치는 27번째 염기로서, 주로 나타날 수 있는 대립유전자형을 괄호 안에 나타내었다.
The position of the SNP in each of the polynucleotides is the 27th base, and the allelic types that may appear are shown in parentheses.

상기 서열의 존재는 검체로부터 핵산 시료를 얻는 단계; 및 상기 시료에서 상기 서열의 존재를 검출하는 단계를 포함하는 방법으로 확인될 수 있다. The presence of the sequence may be obtained by obtaining a nucleic acid sample from a sample; And detecting the presence of the sequence in the sample.

본 발명의 또 다른 구체예에서, 상기 서열은 서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열이며, 27번째 염기는 서열번호 1의 경우 G; 서열번호 2의 경우 A; 서열번호 3의 경우 G일 수 있다.
In another embodiment of the present invention, the sequence is 10 to 50 consecutive DNA sequences including the 27th base (polymorphic region) in one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 3 or complement thereof And the 27th base is G for SEQ ID NO: 1; A for SEQ ID NO: 2; In case of SEQ ID NO: 3, it may be G.

검체로부터 핵산 시료를 얻는 단계에서, 핵산은 진단 대상의 혈액, 피부세포, 점막 세포 및 모발 등 모든 세포로부터 분리될 수 있다. 상기 핵산은 DNA 또는 RNA일 수 있으며, 바람직하게는 DNA일 수 있다. 해당 세포로부터 핵산을 추출하는 방법은 특별히 한정되지 않으며, 당업계에 공지된 기술 또는 시판되고 있는 핵산 추출용 키트를 사용할 수 있다. 예를 들면, 페놀/클로로포름 추출법 및 프로테아제 K 처리방법을 사용할 수 있다.In the step of obtaining a nucleic acid sample from the sample, the nucleic acid can be isolated from all cells, such as blood, skin cells, mucosal cells and hair of the diagnostic object. The nucleic acid may be DNA or RNA, preferably DNA. The method of extracting nucleic acid from the cell is not particularly limited, and techniques known in the art or commercially available kits for extracting nucleic acids can be used. For example, phenol / chloroform extraction and protease K treatment can be used.

DNA 또는 RNA 추출용 키트는 Qiagen, Inc, 및 Stratagene에서 구입할 수 있다. 상기에서 RNA를 추출하여 사용하는 경우에는 역전사를 통해 cDNA를 제조하여 사용할 수 있다.Kits for DNA or RNA extraction are available from Qiagen, Inc, and Stratagene. In the case of extracting and using RNA from the above, cDNA may be prepared and used through reverse transcription.

시료에서 위암 발병 위험을 나타내는 유전자 서열의 존재를 검출하는 단계에서는, 유전자 서열 분석이 수행될 수 있다. 서열분석은 당업계에 공지된 방법을 모두 이용할 수 있으며, 구체적으로는 이에 제한되는 것은 아니나, 자동염기서열분석기를 사용하거나, 파이로시퀀싱(pyrosequencing), PCR-RELP법(restriction fragment length polymorphism), PCRSSCP법(single strand conformation polymorphism), PCR-SSO법(specific sequence oligonucleotide), PCR-SSO법과 도트 하이브리드화법을 조합한 ASO(allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA법(rolling circle amplification), HRM(high resolution melting)법, 프라이머 신장법, 서던 블롯 하이브리드화법 및 도트 하이브리드화법 등의 공지의 방법 중 선택된 어느 하나 이상을 사용할 수 있다.
In the step of detecting the presence of a gene sequence indicative of the risk of developing gastric cancer in a sample, gene sequence analysis may be performed. Sequencing may use any method known in the art, and the present invention is not limited thereto, but may include, but is not limited to, an autobase sequencer, pyrosequencing, PCR-RELP (restriction fragment length polymorphism), PCRSSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), PCR-SSO and dot hybridization combined ASO (allele specific oligonucleotide) hybridization, TaqMan-PCR, MALDI-TOF / MS, Any one or more selected from known methods such as RCA method (rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method and dot hybridization method can be used.

본 발명의 또 다른 구체예에서, 상기 진단 방법은 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score의 값을 확인하는 단계를 추가로 포함할 수 있다. In another embodiment of the invention, the diagnostic method may further comprise the step of confirming the value of the genetic risk score of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC.

본 발명의 발명자들은, c-Met 단백질과 같이 CagA에 결합하는 7개의 단백질 유전자에 존재하는 유전자 다형성을 추가적으로 조사하였고, CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 7개 유전자에 존재하는 112개의 SNP에 대한 통계 분석을 통해 각각의 베타(β)값을 구하였다. 이를 통해 당업계에 알려진 통상의 방법으로 genetic risk score 값을 계산하였고, 이를 가용성 불완전(soluble truncated) c-Met 단백질의 수준에 대한 정보와 함께 분석하면 위암 진단의 정확성이 더욱 높아진다는 점을 발견하였다
The inventors of the present invention further examined gene polymorphisms present in seven protein genes that bind CagA, such as c-Met protein, and present in seven genes of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC. Each beta (β) value was obtained through statistical analysis on 112 SNPs. Through this, the genetic risk score value was calculated by conventional methods known in the art, and it was found that analyzing the information with the level of soluble truncated c-Met protein increases the accuracy of gastric cancer diagnosis.

상기 7개 유전자에 존재하는 112개의 SNP와 그의 베타값은 아래 표 2와 같다. 112 SNPs present in the seven genes and their beta values are shown in Table 2 below.

GeneGene CHRCHR SNPSNP CHRCHR positionposition MinorMinor AlleleAllele TESTTEST NMISSNMISS BETABETA CRKCRK 1717 rs1083rs1083 12720471272047 CC ADDITIVEADDITIVE 398398 -0.1679-0.1679 CRKCRK 1717 rs11655449rs11655449 12744651274465 AA ADDITIVEADDITIVE 396396 0.052130.05213 CRKCRK 1717 rs11657524rs11657524 13048731304873 GG ADDITIVEADDITIVE 393393 0.018030.01803 CRKCRK 1717 rs16946807rs16946807 13033291303329 AA ADDITIVEADDITIVE 394394 0.014110.01411 CRKCRK 1717 rs2063187rs2063187 12957391295739 CC ADDITIVEADDITIVE 396396 -0.2427-0.2427 CRKCRK 1717 rs7208768rs7208768 12994511299451 AA ADDITIVEADDITIVE 397397 0.02480.0248 CRKCRK 1717 rs8073032rs8073032 12831571283157 CC ADDITIVEADDITIVE 398398 -0.1679-0.1679 CRKLCRKL 22 rs1043235rs1043235 1963640019636400 AA ADDITIVEADDITIVE 398398 0.140.14 CRKLCRKL 2222 rs1043242rs1043242 1963674319636743 AA ADDITIVEADDITIVE 398398 0.140.14 CRKLCRKL 2222 rs17819409rs17819409 1963232019632320 CC ADDITIVEADDITIVE 395395 0.27340.2734 CRKLCRKL 2222 rs2266953rs2266953 1963292519632925 CC ADDITIVEADDITIVE 391391 0.093950.09395 CRKLCRKL 2222 rs2285547rs2285547 1963705819637058 CC ADDITIVEADDITIVE 398398 0.0074090.007409 CRKLCRKL 2222 rs3827296rs3827296 1961046319610463 GG ADDITIVEADDITIVE 398398 0.0074090.007409 CRKLCRKL 2222 rs5761368rs5761368 1960747119607471 AA ADDITIVEADDITIVE 398398 -0.006822-0.006822 CRKLCRKL 2222 rs5761386rs5761386 1961584619615846 TT ADDITIVEADDITIVE 398398 0.065820.06582 CRKLCRKL 2222 rs5761424rs5761424 1962320119623201 AA ADDITIVEADDITIVE 398398 -0.5296-0.5296 CRKLCRKL 2222 rs737895rs737895 1963823519638235 GG ADDITIVEADDITIVE 398398 0.050920.05092 CSKCSK 1515 rs12439525rs12439525 7287445872874458 TT ADDITIVEADDITIVE 387387 -0.1131-0.1131 CSKCSK 1515 rs12442901rs12442901 7287096572870965 AA ADDITIVEADDITIVE 396396 0.12230.1223 CSKCSK 1515 rs12595627rs12595627 4930439249304392 TT ADDITIVEADDITIVE 395395 -0.2389-0.2389 CSKCSK 1515 rs1378938rs1378938 7288349672883496 AA ADDITIVEADDITIVE 397397 0.17560.1756 CSKCSK 1515 rs1378940rs1378940 7287054772870547 TT ADDITIVEADDITIVE 393393 0.16310.1631 CSKCSK 1515 rs1378941rs1378941 7286720372867203 TT ADDITIVEADDITIVE 392392 0.13370.1337 CSKCSK 1515 rs1378942rs1378942 7286442072864420 TT ADDITIVEADDITIVE 397397 0.12220.1222 CSKCSK 1515 rs16972620rs16972620 7286689372866893 TT ADDITIVEADDITIVE 397397 -0.1674-0.1674 CSKCSK 1515 rs16972628rs16972628 7286750972867509 GG ADDITIVEADDITIVE 398398 -0.1639-0.1639 CSKCSK 1515 rs16972714rs16972714 7287507672875076 CC ADDITIVEADDITIVE 396396 -0.08764-0.08764 CSKCSK 1515 rs4886409rs4886409 7287493272874932 TT ADDITIVEADDITIVE 396396 -0.1631-0.1631 CSKCSK 1515 rs8039046rs8039046 7288340572883405 GG ADDITIVEADDITIVE 398398 -0.1507-0.1507 GRB2GRB2 1717 rs7219rs7219 7082696370826963 GG ADDITIVEADDITIVE 398398 -0.04521-0.04521 GRB2GRB2 1717 rs8079197rs8079197 7082827470828274 GG ADDITIVEADDITIVE 398398 -0.02198-0.02198 GRB2GRB2 1717 rs4542691rs4542691 7083856070838560 TT ADDITIVEADDITIVE 398398 -0.02198-0.02198 GRB2GRB2 1717 rs4789182rs4789182 7088654070886540 GG ADDITIVEADDITIVE 398398 -0.02198-0.02198 GRB2GRB2 1717 rs7207618rs7207618 7083328270833282 TT ADDITIVEADDITIVE 396396 0.012120.01212 METMET 77 rs10234854rs10234854 116131947116131947 AA ADDITIVEADDITIVE 394394 -0.07646-0.07646 METMET 77 rs10243024rs10243024 116133839116133839 AA ADDITIVEADDITIVE 386386 0.011730.01173 METMET 77 rs10246585rs10246585 116131334116131334 CC ADDITIVEADDITIVE 395395 -0.07926-0.07926 METMET 77 rs10248537rs10248537 116129863116129863 TT ADDITIVEADDITIVE 398398 -0.08046-0.08046 METMET 77 rs10271561rs10271561 116102441116102441 CC ADDITIVEADDITIVE 398398 0.049250.04925 METMET 77 rs10435378rs10435378 116212729116212729 AA ADDITIVEADDITIVE 398398 -0.4099-0.4099 METMET 77 rs11767567rs11767567 116102104116102104 AA ADDITIVEADDITIVE 398398 0.031490.03149 METMET 77 rs12539654rs12539654 116117219116117219 TT ADDITIVEADDITIVE 398398 -0.07206-0.07206 METMET 77 rs13223756rs13223756 116184808116184808 GG ADDITIVEADDITIVE 398398 -0.08172-0.08172 METMET 77 rs1621rs1621 116224842116224842 GG ADDITIVEADDITIVE 397397 -0.4557-0.4557 METMET 77 rs16945rs16945 116225890116225890 CC ADDITIVEADDITIVE 397397 0.43490.4349 METMET 77 rs17138937rs17138937 116127818116127818 CC ADDITIVEADDITIVE 397397 -0.0695-0.0695 METMET 77 rs17138943rs17138943 116129516116129516 AA ADDITIVEADDITIVE 398398 -0.07206-0.07206 METMET 77 rs17138948rs17138948 116131546116131546 TT ADDITIVEADDITIVE 398398 -0.07206-0.07206 METMET 77 rs17138978rs17138978 116185999116185999 TT ADDITIVEADDITIVE 397397 -0.4302-0.4302 METMET 77 rs17138983rs17138983 116189969116189969 GG ADDITIVEADDITIVE 394394 -0.3971-0.3971 METMET 77 rs183642rs183642 116220866116220866 AA ADDITIVEADDITIVE 398398 0.40540.4054 METMET 77 rs193686rs193686 116218663116218663 CC ADDITIVEADDITIVE 391391 -0.7782-0.7782 METMET 77 rs2023748rs2023748 116223258116223258 AA ADDITIVEADDITIVE 398398 0.40110.4011 METMET 77 rs2073560rs2073560 116210397116210397 AA ADDITIVEADDITIVE 398398 -0.07385-0.07385 METMET 77 rs2237708rs2237708 116124116116124116 CC ADDITIVEADDITIVE 398398 -0.101-0.101 METMET 77 rs2237709rs2237709 116124380116124380 AA ADDITIVEADDITIVE 393393 -0.00813-0.00813 METMET 77 rs2237710rs2237710 116124588116124588 GG ADDITIVEADDITIVE 395395 -0.1668-0.1668 METMET 77 rs2237711rs2237711 116125233116125233 AA ADDITIVEADDITIVE 398398 -0.4524-0.4524 METMET 77 rs2237713rs2237713 116130376116130376 AA ADDITIVEADDITIVE 398398 -0.4541-0.4541 METMET 77 rs2237717rs2237717 116192623116192623 TT ADDITIVEADDITIVE 397397 0.37340.3734 METMET 77 rs2283053rs2283053 116214255116214255 GG ADDITIVEADDITIVE 394394 -0.05964-0.05964 METMET 77 rs2299433rs2299433 116118114116118114 TT ADDITIVEADDITIVE 397397 -0.1387-0.1387 METMET 77 rs2299435rs2299435 116128557116128557 CC ADDITIVEADDITIVE 398398 -0.07206-0.07206 METMET 77 rs2299436rs2299436 116128619116128619 GG ADDITIVEADDITIVE 397397 -0.0695-0.0695 METMET 77 rs2299437rs2299437 116128724116128724 AA ADDITIVEADDITIVE 398398 -0.08764-0.08764 METMET 77 rs2299438rs2299438 116128990116128990 GG ADDITIVEADDITIVE 394394 -0.09215-0.09215 METMET 77 rs2299440rs2299440 116203563116203563 TT ADDITIVEADDITIVE 396396 -0.06456-0.06456 METMET 77 rs2402118rs2402118 116215809116215809 AA ADDITIVEADDITIVE 398398 0.52370.5237 METMET 77 rs2896191rs2896191 116121280116121280 TT ADDITIVEADDITIVE 398398 -0.07206-0.07206 METMET 77 rs3807996rs3807996 116164043116164043 TT ADDITIVEADDITIVE 398398 -0.4053-0.4053 METMET 77 rs3807997rs3807997 116207794116207794 AA ADDITIVEADDITIVE 398398 -0.07385-0.07385 METMET 77 rs38841rs38841 116107162116107162 GG ADDITIVEADDITIVE 397397 -0.2667-0.2667 METMET 77 rs38842rs38842 116107641116107641 AA ADDITIVEADDITIVE 398398 -0.2142-0.2142 METMET 77 rs38845rs38845 116109038116109038 AA ADDITIVEADDITIVE 390390 0.048790.04879 METMET 77 rs38849rs38849 116119775116119775 CC ADDITIVEADDITIVE 395395 -0.3744-0.3744 METMET 77 rs38851rs38851 116130574116130574 CC ADDITIVEADDITIVE 397397 0.350.35 METMET 77 rs38852rs38852 116141761116141761 TT ADDITIVEADDITIVE 378378 -0.2334-0.2334 METMET 77 rs38854rs38854 116144447116144447 TT ADDITIVEADDITIVE 398398 0.35150.3515 METMET 77 rs38855rs38855 116145280116145280 AA ADDITIVEADDITIVE 396396 -0.2586-0.2586 METMET 77 rs38857rs38857 116152649116152649 TT ADDITIVEADDITIVE 398398 -0.4357-0.4357 METMET 77 rs38858rs38858 116157523116157523 GG ADDITIVEADDITIVE 392392 -0.2282-0.2282 METMET 77 rs38859rs38859 116166330116166330 CC ADDITIVEADDITIVE 396396 -0.3689-0.3689 METMET 77 rs39747rs39747 116108275116108275 CC ADDITIVEADDITIVE 393393 0.16780.1678 METMET 77 rs39748rs39748 116114666116114666 GG ADDITIVEADDITIVE 396396 0.34310.3431 METMET 77 rs40238rs40238 116101563116101563 AA ADDITIVEADDITIVE 398398 0.49130.4913 METMET 77 rs40239rs40239 116105113116105113 GG ADDITIVEADDITIVE 397397 0.35350.3535 METMET 77 rs41735rs41735 116222652116222652 AA ADDITIVEADDITIVE 398398 0.40110.4011 METMET 77 rs41736rs41736 116223004116223004 TT ADDITIVEADDITIVE 398398 0.40110.4011 METMET 77 rs41737rs41737 116223333116223333 AA ADDITIVEADDITIVE 394394 0.40210.4021 METMET 77 rs41738rs41738 116224442116224442 GG ADDITIVEADDITIVE 398398 0.43140.4314 METMET 77 rs41739rs41739 116224740116224740 GG ADDITIVEADDITIVE 395395 0.46930.4693 METMET 77 rs41741rs41741 116225747116225747 GG ADDITIVEADDITIVE 397397 -0.3802-0.3802 METMET 77 rs6566rs6566 116225654116225654 AA ADDITIVEADDITIVE 397397 0.43070.4307 METMET 77 rs6951311rs6951311 116221574116221574 AA ADDITIVEADDITIVE 392392 0.4170.417 METMET 77 rs714180rs714180 116106238116106238 AA ADDITIVEADDITIVE 395395 -0.02992-0.02992 METMET 77 rs9641562rs9641562 116110027116110027 CC ADDITIVEADDITIVE 398398 0.073750.07375 PTPN11PTPN11 1212 rs4767860rs4767860 111426736111426736 GG ADDITIVEADDITIVE 389389 0.040790.04079 PTPN11PTPN11 22 rs7132778rs7132778 111425737111425737 CC ADDITIVEADDITIVE 391391 -0.024-0.024 PTPN11PTPN11 1212 rs7958372rs7958372 111419936111419936 CC ADDITIVEADDITIVE 398398 0.014380.01438 PTPN11PTPN11 1212 rs2301756rs2301756 111375159111375159 TT ADDITIVEADDITIVE 398398 -0.01422-0.01422 PTPN11PTPN11 1212 rs11066322rs11066322 111406912111406912 GG ADDITIVEADDITIVE 397397 -0.0135-0.0135 PTPN11PTPN11 1212 rs12229892rs12229892 111407776111407776 AA ADDITIVEADDITIVE 394394 0.00035140.0003514 SRCSRC 2020 rs12106024rs12106024 3541276235412762 GG ADDITIVEADDITIVE 397397 0.16040.1604 SRCSRC 2020 rs12329503rs12329503 3544054535440545 CC ADDITIVEADDITIVE 378378 0.34480.3448 SRCSRC 2020 rs1570209rs1570209 3546224535462245 CC ADDITIVEADDITIVE 396396 0.21770.2177 SRCSRC 2020 rs3790150rs3790150 3544851335448513 GG ADDITIVEADDITIVE 389389 0.39450.3945 SRCSRC 2020 rs6018027rs6018027 3542420635424206 CC ADDITIVEADDITIVE 394394 0.051260.05126 SRCSRC 2020 rs6018088rs6018088 3543203935432039 AA ADDITIVEADDITIVE 396396 0.25430.2543 SRCSRC 2020 rs6018199rs6018199 3544307135443071 GG ADDITIVEADDITIVE 398398 0.37630.3763 SRCSRC 2020 rs6018257rs6018257 3545595335455953 CC ADDITIVEADDITIVE 395395 0.28370.2837 SRCSRC 2020 rs6094509rs6094509 3543868935438689 GG ADDITIVEADDITIVE 396396 0.37310.3731 SRCSRC 2020 rs6122566rs6122566 3546802135468021 GG ADDITIVEADDITIVE 398398 0.18450.1845 SRCSRC 2020 rs6124914rs6124914 3544965735449657 CC ADDITIVEADDITIVE 397397 0.38150.3815 SRCSRC 2020 rs6124933rs6124933 3545334035453340 CC ADDITIVEADDITIVE 397397 0.32210.3221 SRCSRC 2020 rs747182rs747182 3541630335416303 CC ADDITIVEADDITIVE 398398 0.21610.2161 SRCSRC 2020 rs8126089rs8126089 3543266835432668 TT ADDITIVEADDITIVE 398398 0.30940.3094

본 발명의 또 다른 구체예에서, 단백질 수준을 정상 개체의 단백질 수준과 비교하는 단계에서는 정상인의 시료를 대조군으로 사용하여 위암 의심 환자의 생물학적 시료에서의 단백질 수준과 절대적, 상대적으로 비교할 수 있다. In another embodiment of the present invention, the step of comparing the protein level with the protein level of the normal individual can be used to compare the protein level in the biological sample of the suspected gastric cancer patient, absolute and relative using a sample of a normal person as a control.

상대적 비교 결과, 검체의 가용성 불완전(soluble truncated) c-Met 단백질의 농도가 정상인의 농도보다 낮은 경우, 검체를 위암으로 진단할 수 있다. As a result of relative comparison, when the concentration of the soluble truncated c-Met protein of the sample is lower than that of the normal person, the sample can be diagnosed as gastric cancer.

절대적 비교 결과, 검체의 가용성 불완전(soluble truncated) c-Met 단백질의 농도가 14 내지 15 ng/ml, 14.5 내지 15 ng/ml, 14.6 내지 14.8 ng/ml , 또는 14.7ng/ml 미만이라면 검체를 위암으로 진단할 수 있다.
Absolute comparisons indicate that if the concentration of the soluble truncated c-Met protein in the sample is less than 14-15 ng / ml, 14.5-15 ng / ml, 14.6-14.8 ng / ml, or 14.7 ng / ml It can be diagnosed with

상기 결과에 추가적으로 상기 서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열의 존재를 확인한 결과, 다형성부위의 염기가 서열번호 1의 경우 G; 서열번호 2의 경우 A; 서열번호 3의 경우 G인 경우 상기 검체의 위암 가능성은 더욱 높아진다.
In addition to the above results, the presence of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic region) or one or more complementary sequences thereof in the sequence selected from the group consisting of SEQ ID NOs: 1 to 3 , If the base of the polymorphic site is SEQ ID NO: 1; A for SEQ ID NO: 2; In the case of SEQ ID NO: 3, the probability of gastric cancer of the sample is further increased.

또한 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score값이 정상 개체의 값보다 높은 경우 상기 검체의 위암 가능성은 더욱 높아진다. genetic risk score 값은 각각의 유전자별로 나온 값을 평균하여 구할 수 있으며, 위험 형질 동형접합인 경우 2, 이형접합인 경우 1, 비위험 형질 동형접합인 경우 0으로 코딩된다. 절대적으로는 genetic risk score 가 25 이상인 경우, 바람직하게는 26 이상인 경우 위암으로 진단할 수 있다.
In addition, when the genetic risk scores of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC are higher than those of normal individuals, the probability of gastric cancer of the sample is increased. Genetic risk score values can be obtained by averaging the values of each gene, and are coded as 2 for risk-transformation, 1 for heterozygosity, and 0 for non-risk-transformation. Absolutely, if the genetic risk score is 25 or more, preferably 26 or more can be diagnosed as gastric cancer.

또한 본 발명은 가용성 불완전(soluble truncated) c-Met 단백질 수준을 측정하는 제제를 포함하는 위암 진단용 조성물을 제공한다. In another aspect, the present invention provides a composition for diagnosing gastric cancer comprising an agent for measuring the level of soluble truncated c-Met protein.

본 발명의 한 구체예에서, 상기 단백질 수준을 측정하는 제제는 상기 가용성 불완전(soluble truncated) c-Met 단백질에 특이적인 항체일 수 있다. In one embodiment of the invention, the agent measuring the protein level may be an antibody specific for the soluble truncated c-Met protein.

상기 항체는 가용성 불완전(soluble truncated) c-Met 단백질에 특이적으로 결합하는 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다. 또한 본 발명의 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태 및 항체 분자의 기능적인 단편, 예를 들어, Fab, F(ab'), F(ab')2 및 Fv의 형태도 포함한다.The antibody includes all polyclonal antibodies, monoclonal antibodies and recombinant antibodies that specifically bind to soluble truncated c-Met proteins. Antibodies of the invention also comprise functional fragments of the complete form and antibody molecules having two full length light chains and two full length heavy chains such as Fab, F (ab '), F (ab') 2 and It also includes the form of Fv.

상기 가용성 불완전(soluble truncated) c-Met 단백질에 특이적으로 결합하는 항체는 기존의 항체뿐만 아니라 공지된 방법으로 제조될 수 있는 항체를 모두 포함한다. 구체적으로, 상기 가용성 불완전(soluble truncated) c-Met 단백질을 동물에 주사하고, 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 당업계에 널리 공지된 방법으로 가용성 불완전(soluble truncated) c-Met 단백질 특이적 다클론 항체를 제조할 수 있다. 또한, 하이브리도마 방법 또는 파지 항체 라이브러리 기술을 이용하여 가용성 불완전(soluble truncated) c-Met 단백질 특이적 단클론 항체를 제조할 수 있다.
Antibodies that specifically bind to the soluble truncated c-Met protein include both conventional antibodies as well as antibodies that can be prepared by known methods. Specifically, the soluble truncated c-Met protein is injected into the animal, and the soluble truncated c-Met protein is well known in the art, which is a method well known in the art to obtain a serum containing an antibody by collecting blood from the animal. Specific polyclonal antibodies can be prepared. In addition, soluble truncated c-Met protein specific monoclonal antibodies can be prepared using hybridoma methods or phage antibody library techniques.

본 발명의 다른 구체예에서, 상기 위암 진단용 조성물은 서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드의 검출을 위한 프로브를 추가로 포함할 수 있다. In another embodiment of the present invention, the gastric cancer diagnostic composition is 10 to 50 consecutive DNA sequences including the 27th base (polymorphic region) in one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 3 or It may further comprise a probe for the detection of a polynucleotide consisting of a complementary sequence or a complementary polynucleotide thereof.

상기 프로브는 mRNA와 특정 뉴클레오타이드 서열에 혼성화될 수 있으며 라벨링 되어 있어서 특정 뉴클레오타이드의 존재 유무를 확인할 수 있는 RNA 또는 DNA 등의 자연 또는 변형된 핵산 단편을 의미한다. 혼성화에 사용되는 프로브는 올리고뉴클로타이드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 혼성화에 적합한 조건은 온도, 이온세기 (완충액 농도) 및 유기 용매와 같은 화합물의 존재 등을 조절하여 결정될 수 있다. 이러한 엄격한 조건은 혼성화되는 서열에 의존하여 다르게 결정될 수 있다.The probe refers to a natural or modified nucleic acid fragment such as RNA or DNA that can be hybridized to mRNA and a specific nucleotide sequence and labeled to confirm the presence or absence of a specific nucleotide. Probes used for hybridization may be prepared in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, and the like. Conditions suitable for hybridization can be determined by adjusting the temperature, ionic strength (buffer concentration), the presence of compounds such as organic solvents, and the like. Such stringent conditions can be determined differently depending on the sequence being hybridized.

당업자는, 공지된 본 발명의 마커 유전자 핵산 서열로부터 상기 유전자의 특정 영역을 특이적으로 증폭하는 프라이머 쌍 또는 상기 유전자의 특정 영역을 특이적으로 인지하는 프로브를 디자인할 수 있고 당업계에 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 또한, 검출 가능한 시그날을 직접적으로 또는 간접적으로 제공할 수 있도록 방사성 동위원소, 형광성 분자, 바이오틴 등의 표지를 이용하여 변형시킬 수 있다.
Those skilled in the art can design primer pairs that specifically amplify a specific region of the gene or probes that specifically recognize a specific region of the gene from known marker gene nucleic acid sequences of the present invention and are known in the art. It can be synthesized chemically. In addition, modifications can be made using labels such as radioisotopes, fluorescent molecules, biotin, and the like to provide detectable signals directly or indirectly.

본 발명의 또 다른 구체예에서, 본 발명의 위암 진단용 조성물은 각 유형별 키트에 적합한 구성 성분, 검출 시약 또는 장치를 추가로 포함하는 다양한 종류의 위암 진단용 키트로 제작될 수 있다.In another embodiment of the present invention, the composition for diagnosing gastric cancer of the present invention may be prepared as various types of gastric cancer diagnostic kits further including components, detection reagents, or devices suitable for each type of kit.

구체적으로 가용성 불완전(soluble truncated) c-Met 단백질 수준을 측정하는 제제 및 서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드의 검출을 위한 프로브 외에 추가적으로 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 등을 포함하는 위암 진단용 키트를 제공한다.
Specifically, 10 to 50 containing a 27th base (polymorphic site) in an agent for measuring the level of soluble truncated c-Met protein and at least one selected from the group consisting of SEQ ID NOs: 1 to 3. In addition to a probe for detecting a polynucleotide consisting of a contiguous DNA sequence or its complementary sequence or a complementary polynucleotide thereof, a kit for diagnosing gastric cancer further includes a test tube or other suitable container, a reaction buffer, and the like.

본 발명은 또한 가용성 불완전(soluble truncated) c-Met 단백질에 대한 특이적인 항체 및, 추가적으로, 결합된 항체를 검출할 수 있는 시약, 예를 들면, 표지된 2차 항체, 발색단(chromophores), 효소 및 그의 기질을 포함하는 ELISA 용 키트를 제공한다.The invention also relates to antibodies specific for soluble truncated c-Met proteins, and additionally to reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes and Provided is a kit for ELISA comprising a substrate thereof.

또 다른 예로서, 본 발명의 마커 단백질에 특이적인 항체가 기판 위의 정해진 위치에 배열되어 고밀도로 고정화되어 있는 단백질 칩용 키트를 제공한다. 단백질 칩용 키트는 혼성화에 사용되는 완충용액, 표식시약, 세척 완충용액 등을 포함할 수 있다.As another example, there is provided a kit for a protein chip in which an antibody specific for the marker protein of the present invention is arranged at a predetermined position on a substrate and immobilized at a high density. Kits for protein chips may include buffers, labeling reagents, wash buffers, and the like, used for hybridization.

상기 예시한 키트 외에도, 본 발명의 마커를 검출할 수 있는 래피드 진단 키트로 제작되는 여러 형태의 진단 키트를 포함한다.
In addition to the kits exemplified above, it includes several types of diagnostic kits that are made of a rapid diagnostic kit capable of detecting the marker of the present invention.

[실시예][Example]

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

<< 실험예Experimental Example >>

하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.
The following experimental examples are intended to provide experimental examples that are commonly applied to each embodiment according to the present invention.

1. 실험 대상1. Experimental subject

한국인 다기관 암 코호트(Korean Muti-Center Cancer Cohort, KMCC) 내에서 환자-대조군 연구를 수행하였다. 1993년부터 2004년까지, 한국 각지에서 총 19,688 지원자가 모집되었다. 지원자의 동의를 거친 후 개별 면접을 통해 지원자들의 정보를 수집하였다. 혈액과 소변 샘플 또한 채취되었다. A patient-control study was performed within the Korean Muti-Center Cancer Cohort (KMCC). From 1993 to 2004, a total of 19,688 applicants were recruited from all over Korea. After the applicant's consent, the applicants' information was collected through individual interviews. Blood and urine samples were also taken.

모든 지원자의 위암 발병, 사망 및 추가 진단 정보는 국가 사망신고와 건강보험기록 데이터베이스, 또는 국가 암 레지스트리를 통해 수집되었다. Gastric cancer incidence, death and additional diagnostic information for all volunteers were collected through the National Death Reports and Health Insurance Records Database or the National Cancer Registry.

CagA와 상호작용하는 단백질을 인코딩하는 유전자 또는 CagA에 의해 활성화되는 하부 신호전달경로와 관련된 유전자를 분석하기 위해, 180명의 위암 환자와 그들의 대조군을 사용하였고, 그 중 118 환자와 그들의 대조군을 대상으로 단백질 실험을 수행하였다.
To analyze genes encoding proteins that interact with CagA or genes associated with lower signaling pathways activated by CagA, 180 gastric cancer patients and their controls were used, of which 118 patients and their controls The experiment was performed.

2. 가용성 c-2. Availability c- MetMet 단백질 발현에 대한  For protein expression InIn vitroin vitro 연구  Research

가용성 c-Met 단백질의 혈장 농도는 사람 c-Met(가용성) ELISA 키트를 사용하여 통상의 방법으로 수행되었다(Invitrogen Corporation, USA). 5μl의 각 혈장 샘플이 495μl의 Standard Diluent Buffer를 사용하여 희석된 후 분석에 사용되었다. 모든 샘플은 두번씩 분석되었다. 표준곡선이 각각의 분석마다 이용되었으며, 이는 정제된 마우스 골수종-표현 재조합 단백질 50ng/ml 스탠다드의 희석액으로 제작되었다. 샘플의 농도는 microplate reader로 450nm 파장에서 스탠다드와 샘플의 흡광도를 측정하는 방법으로 결정되었다. Plasma concentrations of soluble c-Met protein were performed by conventional methods using human c-Met (soluble) ELISA kits (Invitrogen Corporation, USA). 5 μl each plasma sample is 495 μl Standard Diluent Diluted with Buffer and used for analysis. All samples were analyzed twice. A standard curve was used for each assay, which was made with a dilution of 50ng / ml standard of purified mouse myeloma-expressing recombinant protein. The concentration of the sample was determined by measuring the absorbance of the standard and the sample at 450 nm with a microplate reader.

민감도에 있어서, 최소한의 검출가능한 양은 < 0.5 ng/ml이었다. 이는 평균 두개의 표준편차를 제로 스탠다드가 30번 분석되어 얻어진 평균 O.D. 값에 더하고 그에 상응하는 농도를 계산함으로써 얻어진다. 더욱이, 상기 ELISA 키트는 4,000 내지 50,000 pg/ml의 농도 및 다른 종과 교차 반응성이 없었다. For sensitivity, the minimum detectable amount was <0.5 ng / ml. This is obtained by adding the average two standard deviations to the average OD value obtained by analyzing the zero standard 30 times and calculating the corresponding concentration. Moreover, the ELISA The kit was at a concentration of 4,000 to 50,000 pg / ml and was not cross reactive with other species.

분석 절차는 다음과 같다. The analysis procedure is as follows.

혈장 샘플은 기초 평가 후 ?70°C로 분석 전까지 보관한다. 495μl 의 Standard Diluent Buffer가 각 5μl의 혈장을 담은 튜브에 추가된다. 2시간 동안 상온에서 배양 후, 플레이트를 Wash buffer로 4회 세척한다. 100μl의 바이오틴-결합된 안티-Hu c-Met 용액을 웰에 가한다. 상기 플레이트를 상온에서 1시간동안 천천히 흔들어준다. 플레이트를 4회 세척한 후, 100μl의 스트렙트아비딘이 결합된 HRP Working Solution을 웰에 가한다. 플레이트를 30분간 상온에서 배양한 후 4회 세척한다. 100μl의 안정화된 색원체(Stabilized Chromogen)을 각각의 웰에 더한 후 30분간 어두운 상온에서 배양한다. 100μl의 Stop Solution을 각 웰에 더한 후 30분간 배양하고, 효소면역측정법(enzyme linked immunosorbent assay, ELISA)은 microplate reader로 450nm 파장을 사용하여 측정되었다.
Plasma samples are stored at −70 ° C. after analysis of the baseline until analysis. 495μl Standard Diluent Buffer is added to a tube containing 5 μl of each plasma. After incubation at room temperature for 2 hours, wash the plate Wash 4 times with buffer . 100 μl of biotin-bound anti-Hu c-Met solution is added to the wells. Shake the plate slowly at room temperature for 1 hour. After washing the plate four times, 100 μl of streptavidin bound HRP Working Solution is added to the wells. The plate is incubated at room temperature for 30 minutes and then washed four times. 100 μl of Stabilized Chromogen is added to each well and incubated for 30 min at room temperature. 100 μl of Stop Solution was added to each well and incubated for 30 minutes, and enzyme linked immunosorbent assay (ELISA) was measured using a 450 nm wavelength with a microplate reader.

3. 3. H. H. pyloripylori 감염 및  Infection and CagACagA 혈청반응 Serum reaction

H. pylori 감염 및 CagA 혈청반응은 이뮤노블랏 분석(immunoblot assay)인 Helico Blot 2.1TM (MP Biomedicals Asia Pacific, Singapore)을 통해 측정되었다. Helico Blot 2.1TM키트는 높은 민감성과 정확성을 가지고 있다고 보고되었다 H. pylori Infection and CagA sera were analyzed using Helico Blot 2.1 , an immunooblot assay. (MP Biomedicals Asia Pacific, Singapore). Helico Blot 2.1 TM kits have been reported to have high sensitivity and accuracy

분석 절차는 다음과 같다. The analysis procedure is as follows.

니트로셀룰로오스 스트립(Nitrocellulose strip) 을 2ml의 Diluted wash buffer를 사용하여 희석한 후 5분간 상온의 rocking platform에서 배양하였다. 혈장 샘플은 기초 평가 후 ?70°C로 분석 전까지 보관되었다. 2ml의 Blotting buffer 을 2 μl의 환자 혈청 또는 양/음성 대조군을 포함하고 있는 각각의 웰에 가하였다. 1시간 동안 상온의 rocking platform에서 배양한 후, 플레이트는 3회 2 ml의 Diluted wash buffer를 사용하여 세척되었고, 각 세척 공정 사이에 5분간 rocking platform에 담그는 과정이 수반되었다. 2ml의 Working conjugate solution 을 웰에 가하고 1시간동안 상온에서 배양하였다. 컨쥬게이트를 흡입한 후 3회 세척하였고, 2ml의 Substrate solution을 가하였다. 플레이트를 상온에서 15분간 흔들어준 후 상기와 같이 3회 세척하였다. 각각의 스트립(strip)은 당업자에게 알려진 통상의 기준과 방법으로 해석되었다.
Diluted 2 ml of Nitrocellulose strip wash After diluting with the buffer , the mixture was incubated on a rocking platform at room temperature for 5 minutes. Plasma samples were stored at −70 ° C. after baseline and before analysis. 2ml Blotting Buffer was added to each well containing 2 μl of patient serum or positive / negative control. After incubation on a rocking platform at room temperature for 1 hour, the plates were diluted 3 ml 2 times wash Washing was performed using a buffer , followed by soaking in the rocking platform for 5 minutes between each wash process. 2 ml of Working conjugate solution was added to the wells and incubated at room temperature for 1 hour. The conjugate was inhaled and washed three times, followed by 2 ml of substrate. solution was added. The plate was shaken at room temperature for 15 minutes and washed three times as above. Each strip has been interpreted by conventional standards and methods known to those skilled in the art.

4. 통계학적 분석4. Statistical Analysis

흡연여부, H. pylori 감염여부 및 CagA 혈청반응을 위암 관련 위험 인자로 한 분산 및 공분산 분석 방법(analysis of variance and covariance, ANCOVA)을 사용하여, 가용성 c-Met 혈장 수준에 대한 환자 및 대조균의 기하 평균을 비교하였다. 코호트에 등록된 사람들에 대한 위암 진단과 가까워지는 시간에 따른, 또는 다른 변수들의 변화에 따른 c-Met 단백질 농도의 변화를 측정하기 위해서 선형 회귀분석법이 수행되었다. 흡연여부, H. pylori 감염여부 및 CagA 혈청반응에 맞추어진 조건 또는 무조건의 로지스틱 회귀 분석 모델을 사용하여, 위암과 단일 c-Met 단백질 수준과의 연관성 또는 위암과 c-Met 유전자형과 단백질 표현형의 연관성을 측정하기 위해 교차비(odds ratio, OR)와 95% 신뢰구간(confidence interval, CI)이 측정되었다. Analysis of patients and controls against soluble c-Met plasma levels using analysis of variance and covariance (ANCOVA) with smoking, H. pylori infection, and CagA serologic risk factors as gastric cancer-related risk factors. The geometric mean was compared. Linear regression analysis was performed to measure changes in c-Met protein concentration over time or with changes in other variables for gastric cancer diagnosis in those enrolled in the cohort. Association of gastric cancer with a single c-Met protein level or association of gastric cancer with c-Met genotype and protein phenotype, using a conditional or unconditional logistic regression model tailored to smoking, H. pylori infection, and CagA serum response The odds ratio (OR) and 95% confidence interval (CI) were measured to determine.

상기 로지스틱 회귀 모델로부터 c-statistic으로 계산된 ROC(Receiver Operation Characteristic) 곡선에 기초하여, 위암 진단용 바이오 마커로서 가용성 c-Met 단백질 최적 컷-오프 레벨이 결정되었다. 민감도, 특이도, 양성 예측값(positive predictive values, PPV) 및 음성 예측값 (negative predictive values, NPV)또한 다양한 컷-오프 레벨에 따라 계산되었다. Based on the ROC (Receiver Operation Characteristic) curve calculated c-statistically from the logistic regression model, the soluble c-Met protein optimum cut-off level was determined as a biomarker for gastric cancer diagnosis. Sensitivity, specificity, positive predictive values (PPV) and negative predictive values (NPV) were also calculated according to various cut-off levels.

민감도 및 특이도는 1-특이도(false-positive rate)에 대한 민감도(true-positive rate) ROC곡선에 의해 도시되었다. 0.90 내지 1.0의 AUC-ROC 값은 가장 우수, 0.80 내지 0.89는 우수, 0.70 내지 0.79는 보통, 0.60 내지 0.69는 나쁨, 0.50 내지 0.59는 사용불가능을 나타낸다(Greiner M et al ., 2000). Sensitivity and specificity are shown by true-positive rate ROC curves for false-positive rate. AUC-ROC values of 0.90 to 1.0 are the best, 0.80 to 0.89 are good, 0.70 to 0.79 is normal, 0.60 to 0.69 is bad, and 0.50 to 0.59 are unavailable (Greiner M et al . , 2000).

모든 통계분석은 SAS software version 9.2(SAS Institute, Cary, North Carolina)를 통해 수행되었다.
All statistical analyzes were performed using SAS software version 9.2 (SAS Institute, Cary, North Carolina).

<< 실시예Example 1> 19,688명의 한국인 다기관 암  1> 19,688 Korean manifold cancers 코호트의Cohort 기초 특징 Basic feature

236명의 연구 대상이 가용성 c-Met 단백질 실험에 참여하였다. 환자 및 대조군간에 나이, H. pylori 감염, CagA/VacA 혈청반응, 흡연/음주 여부 및 위궤양 병력 등이 비교되었는데, 상기 변수에 따른 어떤 특별한 차이점이 관측되지 아니하였다. 236 study subjects participated in soluble c-Met protein experiments. Age, H. pylori infection, CagA / VacA serometry, smoking / drinking status, and gastric ulcer history were compared between patients and controls. No particular differences were observed according to these variables.

19,688명의 한국인 다기관 암 코호트의 기초 특징  Basic Features of 19,688 Korean Multicenter Cancer Cohorts CaseCase
(N=118) (N = 118)
ControlControl
(N=118)(N = 118)
OROR (95%  (95% CICI ) )
나이age Mean(SD)Mean (SD) 64.2 (±8.4)64.2 (± 8.4) 64.0 (±8.2)64.0 (± 8.2) NSNS 성별gender Female Female 37 (31.4)37 (31.4) 37 (31.4)37 (31.4) 1.0 (0.6-1.7)1.0 (0.6-1.7) H. pylori H. pylori infection Positive (+)Positive (+) 89 (85.6)89 (85.6) 88 (84.6)88 (84.6) 1.1 (0.5-2.3)1.1 (0.5-2.3) CagACagA Positive (+)Positive (+) 59 (56.7)59 (56.7) 59 (56.7)59 (56.7) 1.0 (0.6-1.7)1.0 (0.6-1.7) VacAVacA Positive (+)Positive (+) 64 (61.5)64 (61.5) 64 (61.5)64 (61.5) 1.0 (0.6-1.7)1.0 (0.6-1.7) 흡연여부Smoking bb Ever smokersEver smokers 81 (68.6)81 (68.6) 68 (57.6)68 (57.6) 1.6 (0.9-2.7)1.6 (0.9-2.7) 음주여부Drinking alcohol c c Ever drinkersEver drinkers 72 (61.0)72 (61.0) 72 (61.5)72 (61.5) 1.0 (0.6-1.7)1.0 (0.6-1.7) 궤양 병력 Stomach ulcer history Ever smokersEver smokers 17 (14.8)17 (14.8) 16 (14.0)16 (14.0) 1.1 (0.5-2.2)1.1 (0.5-2.2)

* p<0.05, ** p<0.01* p <0.05, ** p <0.01

a. 중간 나이는 63.5세. 범위는 40.0 내지 83.0세 a. The median age is 63.5 years old. Range is 40.0 to 83.0 years old

b. 과거 흡연자는 현재 흡연자로 정의됨.b. Past smokers are defined as current smokers.

c. 과거 음주자는 현재 음주자로 정의됨.
c. Past drinkers are defined as current drinkers.

118명의 위암 환자중, 106명의 환자가 위암 발병 전에 한국인 다기관 암 코호트에 등록되었고, 이들은 발생 케이스(incidence case)로 구분되었다. 12명의 환자는 한국인 다기관 암 코호트 등록 이전에 위암 진단을 받았던 적이 있는 환자로, 유병 케이스(prevalence case)로 구분되었다. 118 위암 환자들의 상세한 암 병력은 다음 표 4에 나타난 바와 같다.
Of the 118 gastric cancer patients, 106 patients were enrolled in the Korean multi-center cancer cohort prior to the onset of gastric cancer, which were classified as incidence cases. Twelve patients had been diagnosed with gastric cancer prior to enrollment in the Korean multicenter cancer cohort, which was classified as a prevalence case. The detailed cancer history of 118 gastric cancer patients is shown in Table 4 below.

[표 4] 118명의 위암 환자에 대한 상세 위암 정보 [Table 4] Detailed Gastric Cancer Information for 118 Gastric Cancer Patients

Figure pat00001

Figure pat00001

< 실시예 2> 혈장내 가용성 c-Met 단백질 수준 측정 <Example 2> Plasma soluble c-Met protein levels measured

Figure pat00002
Figure pat00002

a. 흡연여부(유/무), H. pylori 감염여부(양성/음성) 및 CagA 혈청반응(양성/음성)에 맞추어진 ANCOVA 모델로 측정된 값.a. Values measured with an ANCOVA model fitted to smoking (yes / no), H. pylori infection (positive / negative), and CagA serum response (positive / negative).

b. 236 환자-대조군 세트 b. 236 patient-control set

c. 106 유발군 및 그 대조군 세트를 대상으로 한 제한 분석
c. Limit analysis of 106 challenge groups and their control sets

표 5는 위암에 대한 상기 주요 위험 인자에 따른 혈장내 가용성 c-Met 단백질의 수준을 나타낸다. 가용성 c-Met 단백질의 총 중간 혈장 농도는 대조군에 비해 위암 환자군에서 유의적으로 감소했다(총 환자군 평균 12.4 ng/ml, 대조군 13.7 ng/ml, p=0.0294). 106명의 발생 케이스(incidence case)와 그의 대조군을 대상으로 한 제한 분석에서는, 보다 높은 유의도를 보였다(발생 케이스 12.4 ng/ml, 대조군 13.8 ng/ml, p=0.0224).
Table 5 shows the levels of soluble c-Met protein in plasma according to the above major risk factors for gastric cancer. The total median plasma concentration of soluble c-Met protein was significantly reduced in the gastric cancer patient group compared to the control group (12.4 ng / ml mean total group, 13.7 ng / ml control group, p = 0.0294). A restriction analysis of 106 incidence cases and their controls showed higher significance (12.4 ng / ml incidence cases, 13.8 ng / ml in controls, p = 0.0224).

표 6을 참조하면 위암 발생에 관여하는 것으로 알려진 연령, 성별, H. pylori 감염, CagA 혈청반응 및 흡연 여부에 따라 층화하여 분석하였을 때, 상기 변수에도 불구하고 가용성 c-Met 단백질 수준은 환자군에서 일관되게 낮게 나타났다. Referring to Table 6, soluble c-Met protein levels were consistent in the patient group despite stratification according to age, sex, H. pylori infection, CagA serum response, and smoking status, which are known to be involved in gastric cancer. Appeared very low.

흥미롭게도, 위암 관련 위험 인자를 가지는 위암 환자(고연령, 남성, H. pylori 양성, CagA 혈청반응 양성 및 흡연자)의 가용성 c-Met 단백질 수준이 정상 대조군에 비해 유의(p value 가 0.05 미만)하게 낮은 것으로 나타났다.
Interestingly, soluble c-Met protein levels in gastric cancer patients (old age, male, H. pylori positive, CagA seropositive, and smokers) with gastric cancer-related risk factors were significantly lower (p value less than 0.05) compared to normal controls. Appeared.

[표 6] 위암 관련 위험 인자에 따른 층화 분석 [Table 6] Stratification analysis according to risk factors related to gastric cancer

Figure pat00003
Figure pat00003

a. 흡연여부(유/무), H. pylori 감염여부(양성/음성) 및 CagA 혈청반응(양성/음성)에 맞추어진 ANCOVA 모델로 측정된 값.a. Values measured with an ANCOVA model fitted to smoking (yes / no), H. pylori infection (positive / negative), and CagA serum response (positive / negative).

b. 환자군 및 대조군의 나이 중간값은 64.0 세이고, 범위는 35.0 내지 83.0 세이다.
b. The median age of patients and controls is 64.0 years and ranges from 35.0 to 83.0 years.

<< 실시예Example 3> 위암 발병에 따른 c- 3> c- following onset of gastric cancer MetMet 단백질 수준 측정 Protein level measurement

가용성 c-Met 단백질 수준이 잠재적인 위암 진단의 바이오마커로 사용될 수 있다면, c-Met 단백질의 농도 변화도 위암의 진행과 연관이 있다는 가정 하에, 위암 발생 시기 전후에 따른 c-Met 단백질 수준을 측정하였다. If soluble c-Met protein levels can be used as a biomarker for potential gastric cancer diagnosis, c-Met protein levels are measured before and after the onset of gastric cancer, assuming that changes in the concentration of c-Met protein are also associated with gastric cancer progression. It was.

[표 7] 위암 발생 시기 전후에 따른 c-Met 단백질 수준 측정[Table 7] c-Met protein levels measured before and after gastric cancer

Figure pat00004
Figure pat00004

a. 흡연여부(유/무), H. pylori 감염여부(양성/음성) 및 CagA 혈청반응(양성/음성)에 맞추어진 ANCOVA 모델로 측정된 값.a. Values measured with an ANCOVA model fitted to smoking (yes / no), H. pylori infection (positive / negative), and CagA serum response (positive / negative).

b. 선형회귀분석모델을 사용하여 계산됨.b. Calculated using linear regression model.

c. 236 환자-대조군 세트 c. 236 patient-control set

d. 106 유발군 및 그 대조군 세트를 대상으로 한 제한 분석
d. Limit analysis of 106 challenge groups and their control sets

표 7을 참조하면, 위암 발병 시점에 가까워질수록 가용성 c-Met 단백질 수준은 지속적으로 감소하였다(경향에 따른 p 값= 0.0033). 발생 케이스 또는 유병 케이스의 위암 진단 1년 전/후의 가용성 c-Met 단백질 평균 농도는 11.3 ng/ml으로 최소값을 보였다. 반면, 위암 진단 5년 전/후의 가용성 c-Met 단백질 평균 농도는 대조군과 비슷하거나 조금 낮게 나타났다(13.6 ng/ml vs.13.7 ng/ml). Referring to Table 7, soluble c-Met protein levels continued to decrease near the time of onset of gastric cancer (p value = 0.0033 according to trend). The mean concentration of soluble c-Met protein at 1 year before and after diagnosis of gastric cancer in developmental or diseased cases was 11.3 ng / ml, which was the minimum. In contrast, the mean concentration of soluble c-Met protein 5 years before and after the diagnosis of gastric cancer was similar or slightly lower than that of the control group (13.6 ng / ml vs. 13.7 ng / ml).

106명의 발생 케이스 및 그들의 대조군만을 대상으로 한 제한 분석에서는 상기와 같이 위암 진단이 가까워질수록 가용성 c-Met 단백질의 혈장 내 농도가 감소함을 알 수 있었고, 위암 진단 1년 전/후의 가용성 c-Met 단백질 농도는 가장 낮은 10.9 ng/ml로 나타났다. 또한 위암 진단 5년 전/후의 가용성 c-Met 단백질 농도는 대조군의 c-Met 단백질 농도와 거의 동일하게 나타났다(13.6 ng/mL vs . 13.8 ng/ml).
A limited analysis of 106 cases and their control group showed that the plasma concentration of soluble c-Met protein decreased as the diagnosis of gastric cancer became closer. Soluble c- before and after 1 year of gastric cancer diagnosis Met protein concentration was the lowest 10.9 ng / ml. In addition, soluble c-Met protein concentration of 5 years ago / after gastric cancer diagnosis were almost the same as c-Met protein levels in the control group (13.6 ng / mL vs. 13.8 ng / ml).

<< 실시예Example 4> 유전형-표현형 연관 검토 4> Genotype-phenotype association review

c-Met 유전자형과 단백질 표현형 조합은 위암 위험도에 영향을 미칠 수 있다. 따라서 permutated p-value가 0.2 미만인 유의한 3개의 c-Met 유전자의 SNP를 대상으로 분석을 수행하였다. 각각의 SNP는 우성 유전자형 코딩에 따라 두개의 카테고리(위험형 vs 비-위험 유전자형)으로 나누어졌다. 표 8을 참조하면 가장 위험도가 높은 조합은 위험 유전자형인 rs41739(다형성 부위에 G)와 14.7ng/ml 미만의 가용성 c-Met 단백질 농도로(14.7 ng/ml 은 ROC 분석의 최적 컷-오프 레벨로부터 결정되었다) 이러한 경우 위암의 위험이 9배 높게 나타났다(OR=9.2, 95% CI 2.3-36.9). 유사하게, 위험 유전자형인 rs6566(다형성 부위에 A) 또는 rs41738(다형성 부위에 G)와 14.7ng/ml 미만의 가용성 c-Met 단백질 농도인 경우에는 10배의 증가된 교차비(odd ratio. OR)값(각각 OR=10.2, 95% CI=1.6-14.0 및 OR=10.2, 95% CI=2.5-14.2)을 보이며 위암과 유의한 연관성을 보였다. 경향에 대한 p 값은 0.0001 미만인 바, SNP 유형에도 불구하고 가용성 c-Met 단백질 농도에 따라 위암 발생 위험도가 유의하게 선형적으로 증가함을 알 수 있었다. Combination of c-Met genotype and protein phenotype may affect gastric cancer risk. Therefore, we analyzed SNPs of three significant c-Met genes with a permutated p-value of less than 0.2. Each SNP was divided into two categories (risk vs. non-risk genotype) according to dominant genotype coding. Referring to Table 8, the highest risk combinations were the risk genotype rs41739 (G at the polymorphic site) and a soluble c-Met protein concentration of less than 14.7 ng / ml (14.7 ng / ml from the optimal cut-off level of the ROC assay). In this case, the risk of gastric cancer was nine times higher (OR = 9.2, 95% CI 2.3-36.9). Similarly, a 10-fold increased odds ratio (OR) for the risk genotype rs6566 (A at the polymorphic site) or rs41738 (G at the polymorphic site) and a soluble c-Met protein concentration of less than 14.7 ng / ml. (OR = 10.2, 95% CI = 1.6-14.0 and OR = 10.2, 95% CI = 2.5-14.2, respectively) and showed a significant association with gastric cancer. The p-value for the trend was less than 0.0001, indicating that the risk of gastric cancer increased linearly with soluble c-Met protein concentration despite the SNP type.

[표 8] c-Met유전형a-표현형 연관 검토TABLE 8 c-Met genotype a -phenotype association review

Figure pat00005
Figure pat00005

a. 처음 유전자 분석에서 일곱개 CagA 결합 유전자 중 permutated p value<0.2 인 유의한 SNP.a. A significant SNP with a permutated p value <0.2 of the seven CagA binding genes in the initial genetic analysis.

b. 흡연여부(유/무), H. pylori 감염여부(양성/음성) 및 CagA 혈청반응(양성/음성)에 맞추어진 ANCOVA 모델로 측정된 값.b. Values measured with an ANCOVA model fitted to smoking (yes / no), H. pylori infection (positive / negative), and CagA serum response (positive / negative).

c. 최적 컷-오프 레벨은 ROC 분석으로 결정됨.
c. Optimal cut-off levels were determined by ROC analysis.

<< 실시예Example 5> 유전형-표현형 연관 검토 5> Genotype-phenotype association review

유전자형과 단백질 표현형 조합은 위암 위험도에 영향을 미칠 수 있음을 알아보기 위해 CagA 결합 단백질인 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score와 위암 위험도에 관해 분석을 수행하였다. To determine the combination of genotype and protein phenotype, we analyzed the genetic risk score and gastric cancer risk of CagA binding proteins CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC.

결과는 아래 표 9에 나타내었다. The results are shown in Table 9 below.

MET 유전자 자체에 대한 genetic risk score가 5.75 이상이고 가용성 c-Met 단백질 농도가 14.7 ng/ml 이하인 경우에는 11.8배의 증가된 교차비(odd ratio. OR)값(OR=11.8, 95% CI=3.4-41.1)을 보이며 위암과 유의한 연관성을 보였다. 또한, 양자간 관련 유의도도 경계역선에서 유의하게 나타났다 (P interaction 값= 0.0662).If the genetic risk score for the MET gene itself is greater than 5.75 and the soluble c-Met protein concentration is less than 14.7 ng / ml, an increased odds ratio (OR) of 11.8 times (OR = 11.8, 95% CI = 3.4- 41.1) showed significant association with gastric cancer. In addition, bilateral relations were also significant at the boundary line (P interaction value = 0.0662).

또한 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score의 중앙값이 25.31 이상이고, 가용성 c-Met 단백질 농도가 14.7 ng/ml 이하인 경우에는 14.4배의 증가된 교차비(odd ratio. OR)값(OR=14.4, 95% CI=3.7-55.7)을 보이며 위암과 유의한 연관성을 보였다. 또한, 양자간 관련 유의도도 경계역선에서 유의하게 나타났다 (P interaction 값= 0.0581).Also, an increase in odds ratio (OR) of 14.4-fold for median genetic risk scores of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC of 25.31 or higher and soluble c-Met protein concentration of 14.7 ng / ml or lower ) (OR = 14.4, 95% CI = 3.7-55.7), and significantly correlated with gastric cancer. In addition, bilateral relations were also significant at the borderline (P interaction value = 0.0581).

Figure pat00006
Figure pat00006

<< 실시예Example 6> 유전형-표현형 연관 검토 6> Genotype-phenotype association review

표 10은 가용성 c-Met 단백질 수준이 모든 연구 대상(236)명의 위암 진단용 바이오마커로 쓰이는 경우 예상값을 나타낸다.
Table 10 shows the expected values when soluble c-Met protein levels are used as biomarkers for gastric cancer diagnostics in all (236) subjects.

SensitivitySensitivity
(%)(%)
SpecificitySpecificity
(%)(%)
PPVPPV aa NPVNPV b b AUCAUC -- ROCROC cc AUCAUC -- ROCROC ff
6.3 6.3 ngng /Of mlml 2.5 2.5 96.696.6 42.942.9 49.849.8 0.50 (0.48-0.53)0.50 (0.48-0.53) 0.76 (0.67-0.85)*** 0.76 (0.67-0.85) *** 7.1 ng/ml7.1 ng / ml 4.2 4.2 94.994.9 45.545.5 49.849.8 0.50 (0.48-0.53)0.50 (0.48-0.53) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 8.3 ng/ml8.3 ng / ml 11.011.0 89.889.8 52.052.0 50.250.2 0.50 (0.47-0.54)0.50 (0.47-0.54) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 9.1 ng/ml9.1 ng / ml 16.116.1 84.784.7 51.451.4 50.350.3 0.50 (0.46-0.55)0.50 (0.46-0.55) 0.77 (0.69-0.86) *** 0.77 (0.69-0.86) *** 9.9 ng/ml9.9 ng / ml 24.624.6 79.779.7 54.754.7 51.451.4 0.52 (0.47-0.58)0.52 (0.47-0.58) 0.78 (0.70-0.87) *** 0.78 (0.70-0.87) *** 11.1 ng/ml11.1 ng / ml 34.734.7 71.171.1 54.754.7 52.252.2 0.53 (0.47-0.59)0.53 (0.47-0.59) 0.78 (0.69-0.86) *** 0.78 (0.69-0.86) *** 11.5 ng/ml11.5 ng / ml 39.039.0 69.569.5 56.156.1 53.253.2 0.54 (0.48-0.60)0.54 (0.48-0.60) 0.78 (0.70-0.87) *** 0.78 (0.70-0.87) *** 11.9 ng/ml11.9 ng / ml 43.243.2 62.762.7 53.753.7 46.346.3 0.53 (0.47-0.59)0.53 (0.47-0.59) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 12.3 ng/ml12.3 ng / ml 44.944.9 61.961.9 54.154.1 52.952.9 0.53 (0.47-0.60)0.53 (0.47-0.60) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 12.7 ng/ml12.7 ng / ml 50.850.8 59.359.3 55.655.6 54.754.7 0.55 (0.49-0.61)0.55 (0.49-0.61) 0.77 (0.68-0.86) *** 0.77 (0.68-0.86) *** 13.1 ng/ml 13.1 ng / ml 55.955.9 45.245.2 55.055.0 55.255.2 0.55 (0.49-0.62)0.55 (0.49-0.62) 0.77 (0.68-0.86) *** 0.77 (0.68-0.86) *** 13.5 ng/ml13.5 ng / ml 60.260.2 53.453.4 56.356.3 57.357.3 0.57 (0.51-0.63)* 0.57 (0.51-0.63) * 0.78 (0.69-0.87) *** 0.78 (0.69-0.87) *** 13.9 ng/ml13.9 ng / ml 64.464.4 50.850.8 56.756.7 58.858.8 0.58 (0.51-0.64)* 0.58 (0.51-0.64) * 0.78 (0.69-0.87) *** 0.78 (0.69-0.87) *** 14.3 ng/ml14.3 ng / ml 67.867.8 50.050.0 57.657.6 60.860.8 0.59 (0.53-0.65)** 0.59 (0.53-0.65) ** 0.78 (0.70-0.87) *** 0.78 (0.70-0.87) *** 14.7 14.7 ngng /Of mlml 72.972.9 49.349.3 58.558.5 64.164.1 0.61 (0.55-0.67)0.61 (0.55-0.67) **** 0.80 (0.71-0.88)0.80 (0.71-0.88) *** *** 15.1 ng/ml15.1 ng / ml 74.674.6 45.845.8 57.957.9 64.364.3 0.60 (0.54-0.66) ** 0.60 (0.54-0.66) ** 0.79 (0.71-0.87) *** 0.79 (0.71-0.87) *** 15.5 ng/ml15.5 ng / ml 75.475.4 44.944.9 57.857.8 64.664.6 0.60 (0.54-0.66) ** 0.60 (0.54-0.66) ** 0.79 (0.71-0.87) *** 0.79 (0.71-0.87) *** 15.9 ng/ml15.9 ng / ml 77.177.1 42.442.4 57.257.2 64.964.9 0.60 (0.54-0.66) ** 0.60 (0.54-0.66) ** 0.79 (0.71-0.85) *** 0.79 (0.71-0.85) *** 16.3 ng/ml16.3 ng / ml 77.177.1 39.039.0 55.855.8 63.063.0 0.58 (0.52-0.64) ** 0.58 (0.52-0.64) ** 0.79 (0.70-0.87) *** 0.79 (0.70-0.87) *** 16.7 ng/ml16.7 ng / ml 78.878.8 33.933.9 54.454.4 61.561.5 0.56 (0.51-0.62)* 0.56 (0.51-0.62) * 0.78 (0.70-0.87) *** 0.78 (0.70-0.87) *** 17.1 ng/ml17.1 ng / ml 81.481.4 29.729.7 53.653.6 61.461.4 0.56 (0.50-0.61)* 0.56 (0.50-0.61) * 0.78 (0.70-0.87) *** 0.78 (0.70-0.87) *** 17.5 ng/ml17.5 ng / ml 82.282.2 25.425.4 52.452.4 58.858.8 0.54 (0.49-0.59)0.54 (0.49-0.59) 0.77 (0.69-0.86) *** 0.77 (0.69-0.86) *** 17.9 ng/ml17.9 ng / ml 83.983.9 24.624.6 52.752.7 60.460.4 0.54 (0.49-0.59)0.54 (0.49-0.59) 0.77 (0.69-0.86) *** 0.77 (0.69-0.86) *** 18.3 ng/ml18.3 ng / ml 84.884.8 21.121.1 51.851.8 58.158.1 0.53 (0.48-0.58)0.53 (0.48-0.58) 0.77 (0.68-0.86) *** 0.77 (0.68-0.86) *** 18.7 ng/ml18.7 ng / ml 87.387.3 16.916.9 51.251.2 57.157.1 0.52 (0.48-0.57)0.52 (0.48-0.57) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 19.3 ng/ml19.3 ng / ml 89.889.8 16.116.1 51.751.7 61.361.3 0.53 (0.49-0.58)0.53 (0.49-0.58) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 19.7 ng/ml19.7 ng / ml 94.194.1 13.613.6 52.152.1 69.669.6 0.54 (0.50-0.58)* 0.54 (0.50-0.58) * 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 20.9 ng/ml20.9 ng / ml 94.194.1 12.712.7 51.951.9 68.268.2 0.53 (0.50-0.57)0.53 (0.50-0.57) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 21.7 ng/ml21.7 ng / ml 94.994.9 12.712.7 52.152.1 71.471.4 0.54 (0.50-0.57)0.54 (0.50-0.57) 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) *** 22.5 22.5 ngng /Of mlml 95.895.8 11.011.0 51.851.8 72.272.2 0.53 (0.50-0.57)* 0.53 (0.50-0.57) * 0.76 (0.67-0.85) *** 0.76 (0.67-0.85) ***

* 0.01= p<0.05, ** 0.0001= p<0.01, *** p<0.0001* 0.01 = p <0.05, ** 0.0001 = p <0.01, *** p <0.0001

a. Positive predictive value = True positive valuea. Positive predictive value = True positive value

b. Negative predictive value = True negative valueb. Negative predictive value = True negative value

c. AUC-ROC (Area under curve- Receive operating characteristics) Model : c-Met proteinc. AUC-ROC (Area under curve- Receive operating characteristics) Model: c-Met protein

d. AUC-ROC Model: c-Met protein, CagA positivity, H. pylori infection, smoking status and total genetic score of seven CagA binding genes
d. AUC-ROC Model: c-Met protein, CagA positivity, H. pylori infection, smoking status and total genetic score of seven CagA binding genes

최적 컷-오프 값은 로지스틱 모델에서 계산된 최대 AUC값과 함께 민감도, 특이도, 양성 예측값(positive predictive values, PPV) 및 음성 예측값 (negative predictive values, NPV) 등을 모두 고려하여 결정되었다. 14.7ng/ml 가용성 c-Met 단백질 수준이 최적 컷-오프 레벨로 결정되었고, 가용성 c-Met 단백질만이 변수로 고려된 경우, 민감도, 특이도, 양성 예측값, 및 음성 예측값은 각각 2.9%, 49.3%, 58.5% 및 64.1%이었다. AUC-ROC 값이 0.61인 바, 민감도 및 특이도가 우수하지 않게 측정되었다.The optimal cut-off values were determined by considering both the sensitivity, specificity, positive predictive values (PPV), and negative predictive values (NPV) together with the maximum AUC values calculated in the logistic model. When the 14.7 ng / ml soluble c-Met protein level was determined as the optimal cut-off level and only soluble c-Met protein was considered as a variable, the sensitivity, specificity, positive predictive value, and negative predictive value were 2.9% and 49.3, respectively. %, 58.5% and 64.1%. As the AUC-ROC value was 0.61, the sensitivity and specificity were measured poorly.

그러나 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score값을 변수로 추가하고, H. pylori 감염, CagA, 흡연여부를 고려한 결과 AUC-ROC 값이 0.80으로 우수하게 나타났으며, 이때의 ROC curve는 도 1과 같다.
However, when the genetic risk scores of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC were added as variables, and H. pylori infection, CagA and smoking were considered, the AUC-ROC value was 0.80. ROC curve at this time is as shown in FIG.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Seoul National University R&D Foundation <120> Method for Diagnosis of Gastric Cancer <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <400> 1 tatgttaagc aaaacatact ttagaawcaa atgaaaaagg caattgaaaa tc 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <400> 2 ttgttctgat aaatcatgca attaaawtaa agtgatgcaa catcttgtat ac 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <400> 3 gctactctga tctaatgaat gtgaacwtgt agatgttttg tgtgtatttt tt 52 <110> Seoul National University R & D Foundation <120> Method for Diagnosis of Gastric Cancer <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <400> 1 tatgttaagc aaaacatact ttagaawcaa atgaaaaagg caattgaaaa tc 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <400> 2 ttgttctgat aaatcatgca attaaawtaa agtgatgcaa catcttgtat ac 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <400> 3 gctactctga tctaatgaat gtgaacwtgt agatgttttg tgtgtatttt tt 52

Claims (10)

생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질의 수준을 측정하는 단계; 및 상기 단백질 수준을 정상 개체의 단백질 수준과 비교하는 단계를 포함하는 위암 진단 방법.
Measuring the level of soluble truncated c-Met protein in the biological sample; And comparing the protein level with that of a normal individual.
제1항에 있어서,
상기 생물학적 시료는 혈액 또는 혈장인 위암 진단 방법.
The method of claim 1,
Said biological sample is blood or plasma gastric cancer diagnostic method.
제1항에 있어서,
서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열의 존재를 확인하는 단계를 추가로 포함하는 위암 진단 방법.
The method of claim 1,
Further comprising the step of identifying the presence of 10 to 50 contiguous DNA sequences comprising the 27th base (polymorphic site) or complementary sequences thereof, in a sequence selected from the group consisting of SEQ ID NOs: 1-3 How to diagnose stomach cancer.
제1항 내지 제3항 중 어느 한 항에 있어서, CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score의 값을 확인하는 단계를 추가로 포함하는 위암 진단 방법.
The method of any one of claims 1 to 3, further comprising the step of identifying the values of the genetic risk scores of CRK, CRKL, CSK, GRB2, MET, PTPN11, and SRC.
제1항에 있어서, 상기 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질 수준이 정상 개체의 단백질 수준보다 낮은 경우 위암 환자로 판단하는 단계를 추가로 포함하는 위암 진단 방법.
The method of claim 1, further comprising determining a gastric cancer patient when the level of soluble truncated c-Met protein in the biological sample is lower than that of a normal individual.
제3항에 있어서, 상기 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질 수준이 정상 개체의 단백질 수준보다 낮고, 다형성부위의 염기가 서열번호 1의 경우 G; 서열번호 2의 경우 A; 서열번호 3의 경우 G인 경우 위암 환자로 판단하는 단계를 추가로 포함하는 위암 진단 방법.
4. The method of claim 3, wherein the level of soluble truncated c-Met protein in the biological sample is lower than that of a normal individual, and the base of the polymorphic site is SEQ ID NO: 1; A for SEQ ID NO: 2; In case of SEQ ID NO: 3, the method for diagnosing gastric cancer further comprises determining that the gastric cancer patient is present.
제4항에 있어서, 상기 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질 수준이 정상 개체의 단백질 수준보다 낮고 CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score의 값이 정상 개체의 값보다 높은 경우; 또는 상기 생물학적 시료내 가용성 불완전(soluble truncated) c-Met 단백질 수준이 정상 개체의 단백질 수준보다 낮고 다형성부위의 염기가 서열번호 1의 경우 G; 서열번호 2의 경우 A; 서열번호 3의 경우 G이며, CRK, CRKL, CSK, GRB2, MET, PTPN11 및 SRC의 genetic risk score의 값이 정상 개체의 값보다 높은 경우 위암 환자로 판단하는 단계를 추가로 포함하는 위암 진단 방법.
5. The method of claim 4, wherein the level of soluble truncated c-Met protein in the biological sample is lower than that of normal individuals and the values of genetic risk scores of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC are normal. Higher than the value of the object; Or G if the level of the soluble truncated c-Met protein in the biological sample is lower than that of a normal individual and the base of the polymorphic region is SEQ ID NO: 1; A for SEQ ID NO: 2; In the case of SEQ ID NO: 3, and the value of the genetic risk score of CRK, CRKL, CSK, GRB2, MET, PTPN11 and SRC is higher than the value of the normal individual gastric cancer diagnostic method further comprising the step of judging.
가용성 불완전(soluble truncated) c-Met 단백질 수준을 측정하는 제제를 포함하는 위암 진단용 조성물.
Gastric cancer diagnostic composition comprising an agent for measuring the level of soluble truncated c-Met protein.
제8항에 있어서,
단백질 수준을 측정하는 제제가 상기 상기 가용성 불완전(soluble truncated) c-Met 단백질에 특이적인 항체인 위암 진단용 조성물.
The method of claim 8,
A composition for diagnosing gastric cancer, wherein the agent for measuring protein level is an antibody specific for the soluble truncated c-Met protein.
제8항 또는 제9항에 있어서,
서열번호 1 내지 3으로 구성되는 군으로부터 1종 이상 선택되는 서열에서, 27번째 염기(다형성부위)를 포함하는 10 내지 50개의 연속 DNA 서열 또는 그의 상보적 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드의 검출을 위한 프로브를 추가로 포함하는 위암 진단용 조성물.
The method according to claim 8 or 9,
A polynucleotide consisting of 10 to 50 consecutive DNA sequences comprising the 27th base (polymorphic region) or a complementary sequence thereof, or a complementary poly-nucleotide thereof, in a sequence selected from the group consisting of SEQ ID NOs: 1 to 3 Gastric cancer diagnostic composition further comprising a probe for the detection of nucleotides.
KR1020100108357A 2010-11-02 2010-11-02 Method for Diagnosis of Gastric Cancer KR20120061010A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020100108357A KR20120061010A (en) 2010-11-02 2010-11-02 Method for Diagnosis of Gastric Cancer
PCT/KR2011/008314 WO2012060636A2 (en) 2010-11-02 2011-11-02 Method for diagnosing stomach cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100108357A KR20120061010A (en) 2010-11-02 2010-11-02 Method for Diagnosis of Gastric Cancer

Publications (1)

Publication Number Publication Date
KR20120061010A true KR20120061010A (en) 2012-06-12

Family

ID=46024956

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100108357A KR20120061010A (en) 2010-11-02 2010-11-02 Method for Diagnosis of Gastric Cancer

Country Status (2)

Country Link
KR (1) KR20120061010A (en)
WO (1) WO2012060636A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014163445A1 (en) * 2013-04-05 2014-10-09 연세대학교 산학협력단 Method for manufacturing gastric cancer prognosis prediction model
KR101504818B1 (en) * 2013-04-05 2015-03-24 연세대학교 산학협력단 Novel system for predicting prognosis of gastric cancer
KR20190124188A (en) * 2019-10-25 2019-11-04 박선민 Method for providing disease susceptibility and nutrition information based on personalized single nucleotide polymorphism

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014163445A1 (en) * 2013-04-05 2014-10-09 연세대학교 산학협력단 Method for manufacturing gastric cancer prognosis prediction model
KR101501826B1 (en) * 2013-04-05 2015-03-13 연세대학교 산학협력단 Method for preparing prognosis prediction model of gastric cancer
KR101504818B1 (en) * 2013-04-05 2015-03-24 연세대학교 산학협력단 Novel system for predicting prognosis of gastric cancer
JP2016515390A (en) * 2013-04-05 2016-05-30 ユニバーシティ−インダストリー・ファンデーション・ヨンセイ・ユニバーシティ Method for producing prognostic model for gastric cancer
KR20190124188A (en) * 2019-10-25 2019-11-04 박선민 Method for providing disease susceptibility and nutrition information based on personalized single nucleotide polymorphism

Also Published As

Publication number Publication date
WO2012060636A3 (en) 2012-08-02
WO2012060636A2 (en) 2012-05-10

Similar Documents

Publication Publication Date Title
JP6114035B2 (en) Salivary biomarker for lung cancer detection
US20230063827A1 (en) Methods and Compositions for the Diagnosis of Ovarian Cancer
WO2022063156A1 (en) Biomarker in breast cancer and application thereof
EP3710831A1 (en) Markers for the diagnosis and treatment of non-alcoholic steatohepatitis (nash) and advanced liver fibrosis
CN104039962A (en) Breast cancer diagnosis and indication marker
JP2011507509A (en) Distinguishing between IBD and IBS, methods and kits for use in further discrimination between IBD disease types
US20230408520A1 (en) Arteriosclerosis and cancer detection method using deoxyhypusine synthase gene as indicator
WO2012009382A2 (en) Molecular indicators of bladder cancer prognosis and prediction of treatment response
US11360093B2 (en) Colorectal cancer diagnostic composition, and method for detecting diagnostic marker
CN113718031B (en) Establishment of ovarian cancer early diagnosis composition
KR20130017525A (en) Biomarker for early diagnosis of colorectal cancer, breast cancer, renal cell carcinoma or thyroid cancer and uses thereof
KR101388711B1 (en) Complement C9 as markers for the diagnosis of cancer
KR20120061010A (en) Method for Diagnosis of Gastric Cancer
US8124331B2 (en) In vitro method to detect bladder transitional cell carcinoma
KR20190035539A (en) Composition or kit comprising PHD3 measuring agent for diagnosis of renal cell carcinoma and method for diagnosis using the same
KR101289454B1 (en) Complement C9 as markers for the diagnosis of small cell lung cancer and non-small cell lung cancer
CN115372616A (en) Gastric cancer related biomarker and application thereof
KR20220129816A (en) Diagnostic Biomarker For Prognosis of Diffuse Type Gastric Cancer
KR102018209B1 (en) Diagnosis composition of gastric cancer and diagnosis method of gastric cancer using the same
KR101815253B1 (en) CXCL14 Biomarker for Diagnosing Liver Fibrosis
US20150011411A1 (en) Biomarkers of cancer
KR101516716B1 (en) Biomaker RORC for diagnosing liver fibrosis
WO2019212364A1 (en) Test for heart failure
KR102136747B1 (en) Diagnostic Biomarker For Prognosis of Intestinal Type Gastric Cancer
KR102560831B1 (en) Biomarker for predicting probability for onset of gastric cancer and Use thereof

Legal Events

Date Code Title Description
A201 Request for examination
E601 Decision to refuse application