KR20230029059A - Novel biomarker for predicting of resistance against Trastuzumab and uses thereof - Google Patents

Abstract

The present invention relates to a novel biomarker and a use thereof capable of predicting resistance for trastuzumab which is a targeted anticancer drug which selectively attacks HER2, and more specifically, to a composition for predicting resistance for trastuzumab of a cancer cell, a kit, and a method for providing information to predict resistance for trastuzumab of a cancer cell. Since the present invention provides the novel biomarker for predicting the resistance of the trastuzumab of cancer cell, the present invention rapidly and accurately determines an individual having the resistance of the trastuzumab in advance.

Description

Novel biomarker for predicting of resistance against Trastuzumab and uses thereof {Novel biomarker for predicting of resistance against Trastuzumab and uses thereof}

The present invention relates to a novel biomarker for predicting resistance to trastuzumab, a target anticancer drug that selectively attacks HER2, and its use, and more specifically, to a composition and kit for predicting trastuzumab resistance in cancer cells, and It relates to a method for providing information for predicting trastuzumab resistance of cancer cells.

The human epidermal growth factor receptor (HER) is a membrane protein expressed on the cell surface and induces cell division by binding to epidermal growth factor (EGF) present outside the cell. It consists of These HER proteins are abnormally highly expressed on the surface of many types of cancer cells, which leads to rapid division and proliferation of cancer cells. Thus, HER overexpressing or benign cancers can be treated by inhibiting or blocking HER signaling.

According to what has been reported to date, about 15 to 20% of all breast cancers overexpress HER2 protein on the surface of cancer cells, and are known to have a worse prognosis than cases where HER2 protein is not overexpressed. A representative drug that inhibits HER2 protein overexpression is Trastuzumab (trade name: Herceptin), a HER2 monoclonal antibody. Trastuzumab has been reported to be effective in prolonging survival of breast cancer patients with HER2 overexpression and to reduce recurrence and death in early-stage breast cancer patients with increased HER2 gene amplification or HER2 protein overexpression. However, in some HER2-positive cancer patients, even though the breast cancer was cured by the prescription of trastuzumab, the cancer recurred or metastasized after a certain period of time, which is considered to be that the cancer cells have acquired resistance to trastuzumab. Therefore, for effective and accurate anticancer treatment, it is important to determine whether or not cancer cells are drug resistant in the early stage of treatment.

Recently, studies on biomarkers capable of determining whether or not trastuzumab resistance is present in cancer patients have been actively conducted. However, there is no commercially available technology or diagnostic kit using the same, and currently developed prototypes of diagnostic kits have a problem in that they do not have high reliability, so commercialization is delayed. Therefore, there is an urgent need to develop a biomarker capable of accurately and reliably predicting trastuzumab resistance of cancer cells and a diagnostic kit using the same.

Korean Patent Registration No. 10-1875935

An object of the present invention is to provide a composition for predicting Trastuzumab resistance in cancer cells capable of detecting a novel biomarker capable of predicting Trastuzumab resistance.

In addition, an object of the present invention is to provide a kit for predicting trastuzumab resistance of cancer cells comprising the above composition.

In addition, an object of the present invention is to provide a method for providing information for predicting trastuzumab resistance in cancer cells by measuring the expression level of a novel biomarker capable of predicting trastuzumab resistance.

The present inventors confirmed that HMGCR gene expression was significantly lower in trastuzumab-resistant HER2-positive breast cancer cell lines or breast cancer mouse models introduced therein than in breast cancer cells without drug resistance, thereby injecting HMGCR gene or protein into trastuzumab resistance of cancer cells. is presented as a biomarker for predicting or discriminating, and a composition and kit for predicting trastuzumab resistance of cancer cells using these biomarkers, and a method of providing information for predicting trastuzumab resistance of cancer cells using the same are provided. The invention was completed.

One aspect of the present invention provides a composition for predicting trastuzumab resistance of cancer cells, including an agent for measuring the expression level of HMGCR gene or protein.

Trastuzumab is a monoclonal antibody that recognizes the extracellular portion of HER2 present on the cell surface as an epitope, and is used to treat tumors caused by overexpression of the HER2 gene or its gene product involved in cell growth and proliferation. It is a targeted therapy. Trastuzumab selectively binds to HER2 and neutralizes the operation of HER2, thereby blocking cell growth signals and inhibiting the proliferation of cancer cells. administered in combination with However, in some patients, the effect of trastuzumab treatment is weakened, resulting in recurrence or metastasis of cancer, and in these cases, trastuzumab is resistant and the prognosis is poor.

"Prediction of Trastuzumab resistance" used in the present invention refers to a case in which the growth and proliferation of cancer cells are not inhibited even when a cancer patient is treated with Trastuzumab and thus does not show the therapeutic effect by Trastuzumab. It is said that there is resistance, and it means to determine whether or not the patient is resistant to trastuzumab before prescribing treatment drugs to cancer patients.

According to one embodiment of the present invention, the cancer cells may be HER2 positive.

More specifically, the cancer cells may be HER2-positive solid cancer or metastatic cancer.

According to one embodiment of the present invention, the cancer cell is one or more cancer-derived cells selected from the group consisting of ovarian cancer, peritoneal cancer, fallopian tube cancer, breast cancer, non-small cell lung cancer, squamous cell cancer, prostate cancer, gastric cancer, and colorectal cancer. it could be

According to one embodiment of the present invention, the expression level of the HMGCR gene or protein may be measured in cancer cells or tissues containing the same.

As used in the present invention, "biomarker" is a substance that is generally detectable in biological samples, and organic biomolecules such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, glycoproteins, sugars, etc. All inclusive. In the present invention, HMGCR gene or protein can be used as a biomarker.

The HMGCR (3-Hydroxy-3-Methylglutaryl-CoA Reductase or HMG-CoA Reductase) is an enzyme that promotes the conversion of HMG-CoA to mevalonic acid using NADPH during cholesterol biosynthesis, and is encoded in the HMGCR gene. It is possible to maintain intracellular cholesterol homeostasis according to the transcriptional regulation of .

According to one embodiment of the present invention, it was confirmed that the expression level of the HMGCR gene among genes involved in the cholesterol biosynthetic pathway was significantly reduced in breast cancer cells having trastuzumab resistance compared to breast cancer cells without resistance. Therefore, the HMGCR gene or the HMGCR protein expressed therefrom is a biomarker for predicting trastuzumab resistance in cancer cells, and in order to predict trastuzumab resistance in cancer cells, it is preferable to observe the expression level of the HMGCR gene or protein in cancer cells. do.

According to one embodiment of the present invention, the agent may be one capable of measuring the presence and expression level of the gene or protein by specifically binding to the HMGCR gene or protein, respectively.

According to one embodiment of the present invention, the agent may be at least one selected from the group consisting of primers, probes, antibodies, aptamers, oligopeptides, and PNAs that bind specifically to genes or proteins of HMGCR.

More specifically, the agent may be a primer or probe that specifically binds to the HMGCR gene.

As used herein, “specifically binding” means that the binding ability to a target substance is superior to other substances to the extent that the presence or absence of the target substance can be detected by binding.

As used herein, "primer" refers to a primer capable of acting as a starting point for template-directed DNA synthesis under suitable conditions (i.e., four different nucleoside triphosphates and polymerases) at a suitable temperature and buffer. It refers to a single stranded oligonucleotide. The suitable length of a primer varies depending on various factors, such as temperature and use of the primer, but typically consists of 15 to 30 nucleotides.

As used herein, “probe” refers to a linear oligomer of natural or modified monomers or linkages, comprising deoxyribonucleotides and ribonucleotides, and specifically hybridizing to a target nucleotide sequence It can exist naturally, or it can be artificially synthesized.

In one embodiment of the present invention, in order to measure the expression level of HMGCR gene in trastuzumab-resistant breast cancer cells, a primer set consisting of a forward primer and a reverse primer that bind complementary to the HMGCR gene is used. used

Further, more specifically, the agent may include at least one selected from the group consisting of an antibody, an aptamer, an oligopeptide, and a peptide nucleic acid (PNA) that binds specifically to HMGCR protein.

As used herein, "antibody" refers to a specific protein molecule directed against an antigenic site. In the present invention, it refers to an antibody that specifically binds to HMGCR protein, and includes all of monoclonal antibodies, polyclonal antibodies, and recombinant antibodies. In addition, the antibody includes functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab')2, Fv, or the like.

The antibody can be readily prepared through techniques known in the art. For example, monoclonal antibodies can be prepared using the hybridoma method well known in the art (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), or phage antibody libraries (Clackson et al, Nature, 352:624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991) technique. Polyclonal antibodies can be produced by a method of injecting a target protein antigen into an animal and collecting blood from the animal to obtain antibody-containing serum. Such polyclonal antibodies can be prepared from animals such as goats, rabbits, sheep, monkeys, horses, pigs, cows, and dogs.

The antibody prepared by the above method may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography.

In addition, one aspect of the present invention provides a kit for predicting trastuzumab resistance of cancer cells comprising the composition.

As used in the present invention, the "kit for predicting Trastuzumab resistance of cancer cells" refers to a substance capable of predicting Trastuzumab resistance through a biological sample collected from a test subject or cancer patient, through which the test subject's Trastuzumab resistance can be predicted. Zumab resistance can be quickly and easily diagnosed. In the present invention, an agent for measuring the expression level of the HMGCR gene or protein is included.

The kit may include, without limitation, a diagnostic kit based on conventional gene and protein quantitative analysis.

According to one embodiment of the present invention, the kit may be at least one selected from the group consisting of a PCR kit, an RT-PCR kit, a DNA chip kit, a protein kit, and a protein array kit.

For example, when the kit is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs, When the kit is applied to an immunoassay, the kit of the present invention may optionally include a substrate of a secondary antibody and a label. In addition, the kit according to the present invention may be manufactured in a plurality of separate packaging or compartments including the reagent components described above, and the kit of the present invention may be a diagnostic kit including essential elements necessary for performing a DNA chip. there is. A DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, reagents, enzymes, and the like for producing a fluorescently labeled probe. In addition, the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof.

Another aspect of the present invention is a) collecting a biological sample from a cancer patient; b) measuring the expression level of the HMGCR gene or protein in the biological sample; and c) providing information for predicting trastuzumab resistance of cancer cells, comprising comparing the measured expression level of the HMGCR gene or protein with a control group.

Steps a) to c) will be examined in detail in the following, and the description of the contents common to the above will be omitted to avoid excessive complexity.

Step a) is a process of collecting a biological sample from a cancer patient who needs to be tested for resistance to trastuzumab.

According to one embodiment of the present invention, the cancer patient in step a) may be a HER2-positive cancer patient.

According to one embodiment of the present invention, the biological sample in step a) may be cancer cells or tissues containing the same.

Step b) is a process of measuring the expression level along with the presence or absence of the biomarker HMGCR in a biological sample. An amplification reaction can be used to measure HMGCR expression at the gene level, and an antigen-antibody reaction can be used to measure HMGCR expression at the protein level. is available. In the present invention, it is preferable to use the above-described composition or kit for predicting trastuzumab resistance of cancer cells.

According to one embodiment of the present invention, the biomarker HMGCR in step b) may be measured at the level of nucleic acid or protein expression.

According to one embodiment of the present invention, the expression level of the HMGCR gene is measured by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease protection assay It may be measured by one or more methods selected from the group consisting of (nuclease protection assay), in situ hybridization, DNA microarray, and Northern blot.

In addition, according to one embodiment of the present invention, the expression level of the HMGCR protein is one selected from the group consisting of ELISA, Western blot, radioimmunoassay, immunodiffusion, immunoprecipitation, immunohistochemistry, immunofluorescence, and protein microarray. It may be measured by the above method.

Step c) is a process of determining whether resistance to Trastuzumab is achieved by comparing the expression level of the gene or protein of HMGCR measured in the biological sample with a control group that does not exhibit Trastuzumab resistance.

According to one embodiment of the present invention, the control group may be a normal person or a cancer patient without trastuzumab resistance.

According to one embodiment of the present invention, step c) may be to determine that the cancer cells have trastuzumab resistance when the measured expression level of the HMGCR gene or protein is lower than that of the control group.

In the present invention, by presenting a new biomarker capable of predicting trastuzumab resistance of cancer cells, a composition and kit for predicting trastuzumab resistance are provided to promptly and accurately determine individuals with trastuzumab resistance at an early stage and to provide appropriate treatment. can provide

1 shows a trastuzumab resistance in vitro model, A is to obtain trastuzumab-sensitive cells (BT474_S) and resistant cells (BT474_R) according to whether trastuzumab was treated with 50 ug/ml during subculture of BT474 cells. B is the total expression of HER2 and β-actin for each passage (passages 2, 4, 9, 11 and 13) in BT474 cells treated with 50 ug/ml of trastuzumab, and trastuzumab was not treated. C is a result of comparison with BT474 cells (W/T) without treatment, and C is a result of comparison of cell morphological changes according to trastuzumab treatment in 13 passage BT474 cells.
Figure 2 shows a trastuzumab resistant in vivo model, A is a trastuzumab sensitive mouse model according to intraperitoneal injection of 20 mg/kg trastuzumab for Balb/C nude mice injected with BT474 cells into the mammary fat pad. (TRZ_S) and resistant mouse model (TRZ_R), and B is a comparison of tumor size changes in trastuzumab sensitive mouse model (TRZ_S) and resistant mouse model (TRZ_R) after intraperitoneal injection of 20 mg/kg trastuzumab is a result
Figure 3 is a GSEA and heat map showing differences in the expression of cholesterol biosynthetic pathway-related genes in trastuzumab sensitive/resistant cells.
4 is a result of comparing the expression levels of HMGCR, GGPS1, and HMGCS1 genes among cholesterol biosynthetic pathway-related genes in trastuzumab-sensitive/resistant cells.
5 shows HER2 internalization of trastuzumab-sensitive/resistant cells, A is a result of trastuzumab binding assay, and B is a schematic diagram showing the process of trastuzumab being introduced into cells by HER2 internalization.

Hereinafter, the present invention will be described in more detail. However, these descriptions are merely presented as examples to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

1. Construction of trastuzumab resistance model

1-1. In vitro Model

To construct an in vitro model of trastuzumab resistance, human breast cancer cell line BT474 cells were used. BT474 cells are HER2 expressing cells and are sensitive cells that are not resistant to trastuzumab.

BT474 cells were cultured in RPMI medium containing 10% FBS (fetal bovine serum) and 1% penicillin/streptomycin as a culture medium in a 5% CO ₂ incubator at 37°C. BT474 cells were subcultured at intervals of 4 to 5 days with or without 50 ug/ml of trastuzumab in the culture medium to prepare trastuzumab sensitive/resistant cells (FIG. 1A). During subculture, the cell morphology was observed under an optical microscope and the amount of HER2 protein expression in the cells was measured.

Western blot was performed to measure HER2 protein expression in BT474 cells. First, total proteins were isolated from each group of cells using a lysis buffer. The same amount of protein (30 μg) was separated by 8-10% acrylamide gel and then SDS-PAGE was performed. The protein band of the gel was transferred to a nylon membrane and treated with 5% skim milk for 1 hour at room temperature. The membrane was reacted with the primary antibody, total HER2 antibody (Santa cruz, sc-33684) or β-actin antibody (Abfrontier, LF-PA0207) overnight at 4°C, and then 1xTBST (0.1% tween-20-containing tris-buffered saline (pH 7.4)) was washed three times for 15 minutes. The membrane was reacted with the secondary antibody HRP-labeled anti-mouse (Santa cruz, sc-2005) at room temperature for 2 hours and then washed three times with 1xTBST. Afterwards, protein bands were detected using ECL reagent.

As a result, as shown in B of FIG. 1, when BT474 cells were treated with trastuzumab and subcultured, cell growth by trastuzumab was inhibited at the beginning of the passage, resulting in BT474 cells not treated with trastuzumab (W /T), the total HER2 protein expression level decreased, but after passage 9 (passage 9), the cell growth continued even after treatment with trastuzumab, and the total HER2 protein expression level was restored.

In addition, as shown in FIG. 1C, BT474 cells (BT474_R) treated with trastuzumab in passage 13 have a round shape compared to BT474 cells (BT474_S) not treated with trastuzumab. Morphological changes were observed.

Therefore, BT474 cells cultured for up to 13 passages in the presence of trastuzumab were determined to have resistance to trastuzumab, and were used as an in vitro model for trastuzumab resistance.

1-2. In vivo Model

To construct an in vivo model of trastuzumab resistance, BT474 cells were orthotopic transplanted into mice.

5-week-old female Balb/C nude mice were supplied from Orient Bio Co., Ltd. and used. 1X10 ⁷ of BT474 cells suspended in Matrigel were injected on both sides of the mouse's mammary fat pad. When the average tumor size reached 100 mm ³ , trastuzumab 20 mg/kg or PBS was intraperitoneally injected (Fig. 2A). In the case of the control group injected intraperitoneally with PBS, the trastuzumab sensitivity (TRZ_S) was observed, whereas, when the tumor size significantly decreased due to trastuzumab injection and then became resistant to the drug after a certain period of time and the tumor grew larger, the trastuzumab resistance (TRZ_R ) was classified as (B in FIG. 2). Trastuzumab sensitive/resistant cells were separated and cultured in a culture medium by collecting tumor tissue from each trastuzumab sensitive/resistant mouse model.

Example 2. Comparison of gene expression between cells susceptible and resistant to Trastuzumab

2-1. RNA sequencing

RNA sequencing was performed on trastuzumab-sensitive cells and trastuzumab-resistant cells obtained through the in vitro and in vivo models of Example 1.

Whole transcriptome sequencing libraries were performed using the TruSeq RNA sample preparation v2 kit (Illumina, RS-122-2001, RS-122-2002). The integrity of the library was checked with a bioanalyzer and Qubit. Library sequencing was performed using an Illumina HiSeq2500 in 100-bp paired-end mode with TruSeq Rapid PE Cluster kit and TruSeq Rapid SBS kit. Original image data was converted to sequence data by base-calling and saved in FASTQ format. Paired-end reads for four independent samples were adapted for both PCR and sequencing adapters using Cutadapt. Trimmed leads were aligned to the hg19 human reference genome using STAR59. Gene expression was quantified by Expectation-Maximization (RSEM), and at the gene expression level, Cufflink and Cuffdiff were used to determine whether there was a significant difference in expression.

2-2. heatmap

Differences in expression of genes were made into a heatmap using the R language. To functionally classify the expressed gene differences between the four groups, gene set enrichment analysis (GSEA) was run on all gene sets in the Molecular Signatures Database version 5.2 using GSEA version 2.2 and multiple hypothesis testing was corrected; The FDR threshold was set to ≤0.25. Fisher's exact test was used to evaluate common gene sets in the four gene sets.

As a result, as shown in FIG. 3, the expression of genes involved in the cholesterol biosynthetic pathway was reduced in trastuzumab-resistant cells (BT474_R and TRZ_R) of in vitro and in vivo models, especially the expression of HMGCR, GGPS1 and HMGCS1 genes this was significantly reduced.

2-3. Real-time PCR

To quantitatively analyze the expression of HMGCR, GGPS1 and HMGCS1 genes, real-time PCR was performed.

After isolating total RNA from the cells of the in vivo model in the same way as in RNA sequencing, reaction was performed at 95 ° C for 10 minutes using the primers shown in Table 1 below, followed by 15 seconds at 95 ° C, 15 seconds at 60 ° C, and 15 seconds at 72 ° C. Each gene was amplified by reacting for 15 seconds and repeating 40 times, and reacting at 72°C for 5 minutes.

Primer name Primer sequence (5'-3') sequence number HMGCR Forward (F) CACCAAGAAGACAGCCTGAA One Reverse (R) CATCCTCCACAAGACATTGC 2 GGPS1 Forward (F) ACTCAAGAAACAGTCCAAAGA 3 Reverse (R) TCTGTAGCTTGTCCTCTGGAA 4 HMGCS1 Forward (F) GCTCTGGAATCTGGAATG 5 Reverse (R) CTCTTCAATGGCAGTGTT 6

As a result, as shown in FIG. 4 , the expression levels of HMGCR, GGPS1, and HMGCS1 genes in trastuzumab-resistant cells (TRZ_R) were significantly decreased compared to trastuzumab-sensitive cells (TRZ_S). In particular, HMGCR is known as a rate limiting enzyme involved in the cholesterol synthesis process, and clinically applied drugs (statins) targeting it are used as therapeutic agents. It was selected as the causative gene.

Example 3. Comparison of HER2 internalization between cells susceptible and resistant to trastuzumab

In order to compare HER2 internalization of cells according to whether or not they were resistant to Trastuzumab, Trastuzumab binding assay was performed.

Trastuzumab sensitive/resistant cells isolated from the in vivo model were treated with 50 ug/ml of Trastuzumab for 3 hours. Thereafter, the cell culture medium was removed, washed three times with PBS, replaced with a new culture medium, and 5 μg/mL of ErbB2/HER2 Alexa Fluor 647-conjugated antibody (R&D system, Cat. FAB9589R) was added and reacted for 2 hours. Thereafter, the cell culture medium was removed and the cells were recovered by treatment with 0.25% trypsin, and then the number of cells bound to ErbB2/HER2 Alexa Fluor 647-conjugated antibody was measured using flow cytometry (BD Biosciences, BD FACS Verse Flow Cytometer). was measured.

As a result, as shown in FIG. 5A , it was confirmed that HER2 expression was high in the cell membrane of trastuzumab-resistant cells (TRZ_R).

Taken together, Trastuzumab resistance is due to the high level of HER2 expression and the marked suppression of the expression of several genes involved in the biosynthetic pathway of cholesterol constituting cell membranes. It can (B in FIG. 5).

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> SAMSUNG LIFE PUBLIC WELFARE FOUNDATION <120> Novel biomarker for predicting of resistance against Trastuzumab and uses it <130> BPN211015 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCR F <400> 1 caccaagaag acagcctgaa 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCR R <400> 2 catcctccac aagacattgc 20 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> GGPS1 F <400> 3 actcaagaaa cagtccaaag a 21 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> GGPS1 R <400> 4 tctgtagctt gtcctctgga a 21 <210> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> HMGCS1 F <400> 5 gctctggaat ctggaatg 18 <210> 6 <211> 18 <212> DNA <213> artificial sequence <220> <223> HMGCS1 R <400> 6 ctcttcaatg gcagtgtt 18

Claims (8)

A composition for predicting trastuzumab resistance of cancer cells comprising an agent for measuring the expression level of HMGCR gene or protein.
The method of claim 1,
Wherein the cancer cells are at least one cancer-derived cell selected from the group consisting of ovarian cancer, peritoneal cancer, fallopian tube cancer, breast cancer, non-small cell lung cancer, squamous cell cancer, prostate cancer, gastric cancer and colorectal cancer.
The method of claim 1,
The composition comprising at least one selected from the group consisting of a primer, a probe, an antibody, an aptamer, an oligopeptide, and a PNA, each of which binds specifically to the HMGCR gene or protein.
A kit for predicting trastuzumab resistance of cancer cells comprising the composition of any one of claims 1 to 3.
a) collecting a biological sample from a cancer patient;
b) measuring the expression level of the HMGCR gene or protein in the biological sample; and
c) comparing the measured expression level of the HMGCR gene or protein with a control group.
Method for providing information for predicting trastuzumab resistance of cancer cells comprising a.
The method of claim 5,
The expression level of the HMGCR gene in step b) was determined by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, and nuclease protection assay. , In situ hybridization, DNA microarray, and a method in which the nucleic acid expression level is measured by one or more methods selected from the group consisting of Northern blot.
The method of claim 5,
The expression level of the HMGCR protein in step b) was determined by at least one method selected from the group consisting of ELISA, Western blot, radioimmunoassay, immunodiffusion, immunoprecipitation, immunohistochemistry, immunofluorescence, and protein microarray. How it is to be measured.
The method of claim 5,
Wherein step c) is to determine that the cancer cells have trastuzumab resistance when the measured expression level of the HMGCR gene or protein is lower than that of the control group.

Images