KR102657593B1 - A Cosmetic Composition for Enhancing Function of Skin Barrier with Filaggrin Activity Comprising Hizikia fusiformis Extract - Google Patents

Abstract

The present invention provides a skin barrier strengthening cosmetic composition containing Hizikia fusiformis extract.
The skin barrier strengthening cosmetic composition according to the present invention contains Hizikia fusiformis extract, is non-cytotoxic, and significantly increases the expression of skin moisturizing genes (HAS-1, HAS-2, HAS-3, FLG). It works.

Description

A cosmetic composition for strengthening the skin barrier with excellent filaggrin activity containing hijikiba extract as an active ingredient {A Cosmetic Composition for Enhancing Function of Skin Barrier with Filaggrin Activity Comprising Hizikia fusiformis Extract}

The present invention relates to a skin barrier improving cosmetic composition containing Hizikia fusiformis extract and having excellent hyaluronic acid and filaggrin activity.

Hizikia fusiformis ( Hizikia fusiformis ) is one of the seaweeds classified as brown algae, belonging to the genus Hizikia, and is widely distributed on the west and south coasts of Korea and the Jeju region. It has been used as a food for a long time not only in Korea but also in Asian regions such as China and Japan. have been ingesting Hijiki contains a large amount of dietary fiber and is known to contain various physiologically active substances, showing antioxidant, anti-thrombotic, anti-viral, and anti-cancer effects.

Skin moisturization plays a major role in maintaining healthy skin. Maintaining healthy skin is achieved through the balance of factors such as natural moisture factor (NMF) such as lipid layer between keratinocytes, amino acids, organic acids, and sebum. Natural moisturizing factors are known to be important for maintaining moisture in the epidermis by directly retaining or absorbing moisture. Moisture loss from the skin results from damage to the skin barrier, and the stratum corneum plays a very important role in maintaining the skin barrier function. Filaggrin is a gene that plays a major role in maintaining the skin barrier in the stratum corneum, and several studies have reported that it is involved in skin moisturization.

Hyaluronic acid (HA) is a type of glycosaminoglycan (GAG). It is one of the three major skin elements along with collagen and elastin. It is highly hydrophilic and has the property of combining with water to form a gel. It is known as a natural moisturizer that plays an important role in maintaining skin moisture. there is. HA decreases with age or due to various external environmental factors. This decrease in HA is known to cause decreased skin moisture content, decreased elasticity, rough skin, and wrinkles. Therefore, substances that induce the synthesis of HA or inhibit its decomposition are effective in moisturizing the skin and preventing aging. In particular, hyaluronic acid synthase (HAS) is known to play a critical role in HA synthesis, and recent research has been actively conducted to promote HA production by increasing HAS gene expression.

Accordingly, the present inventors made efforts to develop a natural product-derived skin barrier strengthener, and as a result, Hizikia fusiformis extract was non-cytotoxic and contained significant skin moisturizing-related genes (HAS-1, HAS-2, HAS-3, FLG). The present invention was completed by increasing expression.

Therefore, the purpose of the present invention is to provide a skin barrier strengthening cosmetic composition containing Hizikia fusiformis extract.

In order to achieve the above object, the present invention

Provided is a skin barrier strengthening cosmetic composition containing Hizikia fusiformis extract.

The skin barrier strengthening cosmetic composition according to the present invention contains Hizikia fusiformis extract, is non-cytotoxic, and significantly increases the expression of skin moisturizing genes (HAS-1, HAS-2, HAS-3, FLG). It works.

Additionally, the cosmetic composition according to the present invention has excellent skin moisturizing effect.

Figure 1 is a diagram confirming Fillagrin gene expression after treating HaCaT cells with the hijiki extract prepared in an example of the present invention.
Figure 2 is a diagram confirming the expression of Hyaluronan synthase-1, -2, and -3 genes after treating HaCaT cells with the hijiki extract prepared in an example of the present invention.

Hereinafter, various embodiments will be described in more detail with reference to the attached drawings. The embodiments described herein may be modified in various ways. Specific embodiments may be depicted in the drawings and described in detail in the detailed description. However, the specific embodiments disclosed in the attached drawings are only intended to facilitate understanding of the various embodiments. Accordingly, the technical idea is not limited to the specific embodiments disclosed in the attached drawings, and should be understood to include all equivalents or substitutes included in the spirit and technical scope of the invention.

Terms containing ordinal numbers, such as primary, secondary, first, second, etc., may be used to describe various components, but these components are not limited by the above-mentioned terms. The above-mentioned terms are used only for the purpose of distinguishing one component from another.

In this specification, terms such as 'include' or 'have' are intended to designate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features. It should be understood that it does not exclude in advance the possibility of the existence or addition of elements, numbers, steps, operations, components, parts, or combinations thereof. When a component is said to be 'connected' or 'connected' to another component, it is understood that it may be directly connected or connected to the other component, but that other components may exist in between. It should be. On the other hand, when a component is mentioned as being 'directly connected' or 'directly connected' to another component, it should be understood that there are no other components in between.

In addition, when describing the present invention, if it is determined that a detailed description of a related known function or configuration may unnecessarily obscure the gist of the present invention, the detailed description thereof is abbreviated or omitted.

This invention

Provided is a skin barrier strengthening cosmetic composition containing Hizikia fusiformis extract.

The skin barrier strengthening cosmetic composition according to the present invention contains Hizikia fusiformis extract, is non-cytotoxic, and significantly increases the expression of skin moisturizing genes (HAS-1, HAS-2, HAS-3, FLG). It works.

In addition, the present invention

1-5 parts by weight of hijiki extract, 0.5-1.5 parts by weight of fruit extract mixed with tangerine extract, kiwi extract, pear extract, and orange extract in a weight ratio of 3:3:2:2, honeysuckle extract, honeysuckle extract, and 0.5-1.5 parts by weight of flower extract mixed with peony flower extract at a weight ratio of 1:1:1, 0.5-1.5 parts by weight of grapefruit-derived exosomes, fermented corn extract, and fermented folding screen extract mixed at a weight ratio of 1:1. Fermentation extract 0.5-1.5 parts by weight, niacinamide 1-3 parts by weight, arginine 0.5-1.5 parts by weight, phenylalanine 0.5-1.5 parts by weight, 1,2-hexanediol 0.5-1.5 parts by weight, pentylene glycol 0.5- 1.5 parts by weight, glyceryl caprylate 0.5-1.5 parts by weight, ascorbyl glucoside 0.5-1.5 parts by weight, squalane 3-7 parts by weight, dextrin 1-3 parts by weight, linalool 1-3 parts by weight, limonene 1-3 parts by weight parts, xanthan gum 1-3 parts by weight, adenosine 0.5-1.5 parts by weight, stearyl alcohol 0.05-0.2 parts by weight, sodium hyaluronate 0.05-0.2 parts by weight, valine 0.05-0.2 parts by weight, isoquercitrin 0.05-0.2 It provides a skin barrier strengthening cosmetic composition comprising 0.05-0.2 parts by weight of polyglyceryl-6 stearate, 0.3-0.7 parts by weight of glutamic acid, and 68-72 parts by weight of carrot water.

Lonicera Caprifolium (Honeysuckle), also called honeysuckle or honeysuckle, is mainly distributed in East Asia. It has antipyretic, detoxifying, antibacterial, and anti-inflammatory effects and has been used as a treatment for inflammation and infectious diseases. In the present invention, it is intended to be applied as a skin barrier strengthening cosmetic composition.

Zingiber mioga (Zingiber mioga) is a perennial edible plant belonging to the ginger family and is mainly cultivated in East Asia. In Korea, it is mainly produced in the southern coast and Jeju Island area. Yangha's flower buds have a unique spicy flavor called mioganal and are mainly consumed as seasoned or pickled foods. In a previous study, it was reported that the extract of Yangja was effective in reducing blood glucose concentration by inhibiting carbohydrate hydrolyzing enzymes, and was shown to improve memory in a mouse model in which dementia was induced with scopolamine. There were also research reports that found it helpful. In addition, research results have been reported on the antioxidant effect and allergic asthma improvement effect of Yanghae extract. In the present invention, it is intended to be applied as a skin barrier strengthening cosmetic composition.

Peony (Paeonia lactiflora, Paeonia albiflora) is a perennial plant of the dicotyledonous plant Peony genus and is mainly cultivated in China. Peony flowers are large in size and have good color, so they were mainly used only for gardening, but recently, various attempts have been made to use peony flowers for skin care purposes. In the present invention, it is intended to be applied as a skin barrier strengthening cosmetic composition.

Grapefruit (Citrus Paradisi, Grapefruit) is the fruit of the grapefruit tree, belonging to the genus Citrus. Grapefruit is a relatively large tree, has leaves with prominent wing-shaped petioles, blooms fragrant white flowers, and produces large round fruits in small bunches like grapes. The flesh is light yellow, rich in juice, and has a sour yet strong sweet taste with a slightly bitter taste. In the present invention, grapefruit-derived exosomes are used to apply them as a skin barrier strengthening cosmetic composition.

The cosmetic composition has excellent skin moisturizing effect.

In addition, the present invention

Preparing hijiki powder by washing, freeze-drying, and pulverizing the hijiki; Preparing an extract by mixing hijiki powder and ethanol at a ratio of 1:9-11 g/L and extracting 2-4 times at a temperature of 20-30°C for 22-26 hours; And filtering the extract through filter paper, concentrating under reduced pressure and freeze-drying the filtered filtrate at -50°C; Preparing a hijiki extract comprising a step;

Preparing honeysuckle flower powder, Yangha flower powder, and peony flower powder by washing, freeze-drying, and pulverizing honeysuckle flowers, Yangha flowers, and peony flowers; The prepared mixed powder of honeysuckle flower powder, Yangha flower powder, and peony flower powder was mixed at a weight ratio of 1:1:1 with a mixed solvent of ethanol and hexane at a volume ratio of 1:1 and a weight ratio of 1:9. mixing and extracting at a temperature of 28-32°C for 22-26 hours to prepare an extract; And filtering the extract through filter paper, concentrating and freeze-drying the filtered filtrate at -50°C under reduced pressure; Preparing a fruit extract comprising a;

Preparing honeysuckle flower powder, peony flower powder, and evening primrose powder by washing, freeze-drying, and pulverizing honeysuckle flowers, peony flowers, and evening primrose flowers; 20 g of the prepared mixed powder of honeysuckle flower powder, peony flower powder, and evening primrose powder mixed at a weight ratio of 1:1:1 was mixed with 200 ml of water, and heated for 8 hours at a temperature of 80°C while stirring. performing extraction; After the first hot water extraction, filtering with filter paper and then freeze-drying the filtrate to prepare a first mixed extract; After the first hot water extraction, filter through filter paper and mix the remaining solids with water again so that the mixing ratio of solids and water is 0.1 g/ml, and perform the second hot water extraction at a temperature of 120°C for 12 hours while stirring. steps; After secondary hot water extraction, filtering through filter paper and then freeze-drying the filtrate to prepare a secondary mixed extract; After secondary hot water extraction and filtering with filter paper, the remaining solids are mixed with water again so that the mixing ratio of solids and water is 0.1 g/ml, and then mixed with [BMIm][TFSI](1-Butyl-3-methylimidazoliumbis) Adding 1-2 g of trifluoromethylsulfonyl)imide) and performing third hot water extraction at a temperature of 100°C for 8 hours while stirring; After the third hot water extraction, filtering through filter paper and then freeze-drying the filtrate to prepare a third mixed extract; And mixing the first mixed extract, second mixed extract and third mixed extract; Preparing a flower extract comprising a;

Washing the grapefruit and pretreating it at a temperature of 18-22°C and a pressure of 140-160 MPa for 3-7 minutes; Preparing grapefruit juice by squeezing pretreated grapefruit; Centrifuging the grapefruit juice to obtain a supernatant containing exosomes; Preparing a lyophilisate by lyophilizing the supernatant containing the exosomes; Forming an aqueous two-phase system using polyethylene glycol/dextran in the freeze-dried product; and obtaining a lower layer solution in which exosomes in the aqueous two-phase system are concentrated; a step of producing grapefruit exosomes comprising a;

Preparing corn powder and Centella asiatica powder by washing corn grains and Centella asiatica with boiled water and pulverizing them; A mixture was prepared by mixing 23-27 parts by weight of corn powder, 23-27 parts by weight of Centella asiatica powder, and 58-62 parts by weight of water, and 1 part by weight of Saccharomyces cerevisiae as a yeast was added to the mixture. Fermentation at a temperature of 38-42°C for 34-38 hours; Preparing an extract by mixing the fermented mixture and butylene glycol and stirring for 4-6 days at a temperature of 28-32°C; Preparing a fermentation extract comprising: filtering and concentrating the extract under reduced pressure and then freeze-drying it; and

1-5 parts by weight of the hijiki extract, 0.5-1.5 parts by weight of the fruit extract, 0.5-1.5 parts by weight of the flower extract, 0.5-1.5 parts by weight of the grapefruit-derived exosomes, 0.5-1.5 parts by weight of the fermented extract, niacinamide 1 -3 parts by weight, arginine 0.5-1.5 parts by weight, phenylalanine 0.5-1.5 parts by weight, 1,2-hexanediol 0.5-1.5 parts by weight, pentylene glycol 0.5-1.5 parts by weight, glyceryl caprylate 0.5-1.5 parts by weight Parts by weight, ascorbyl glucoside 0.5-1.5 parts by weight, squalane 3-7 parts by weight, dextrin 1-3 parts by weight, linalool 1-3 parts by weight, limonene 1-3 parts by weight, xanthan gum 1-3 parts by weight, adenosine 0.5-1.5 parts by weight, stearyl alcohol 0.05-0.2 parts by weight, sodium hyaluronate 0.05-0.2 parts by weight, valine 0.05-0.2 parts by weight, isoquercitrin 0.05-0.2 parts by weight, polyglyceryl-6 stearate 0.05 It provides a method for producing a cosmetic composition comprising - mixing 0.2 parts by weight, 0.3-0.7 parts by weight of glutamic acid, and 68-72 parts by weight of carrot water.

First, the method for producing a cosmetic composition according to the present invention includes preparing a hijiki extract. The step of preparing the hijiki extract includes washing the hijiki, freeze-drying, and pulverizing the hijiki to produce hijiki powder; Preparing an extract by mixing hijiki powder and ethanol at a ratio of 1:9-11 g/L and extracting 2-4 times at a temperature of 20-30°C for 22-26 hours; And filtering the extract with filter paper, concentrating the filtered filtrate under reduced pressure at -50°C and freeze-drying it. The hijiki extract is prepared through the same process as above, so that the active ingredient can be easily extracted.

Next, the method for producing a cosmetic composition according to the present invention includes preparing a fruit extract. The step of preparing the fruit extract includes washing, freeze-drying, and pulverizing honeysuckle flowers, honeysuckle flowers, and peony flowers to prepare honeysuckle flower powder, honeysuckle flower powder, and peony flower powder; The prepared mixed powder of honeysuckle flower powder, Yangha flower powder, and peony flower powder was mixed at a weight ratio of 1:1:1 with a mixed solvent of ethanol and hexane at a volume ratio of 1:1 and a weight ratio of 1:9. mixing and extracting at a temperature of 28-32°C for 22-26 hours to prepare an extract; And filtering the extract with filter paper, concentrating the filtered filtrate under reduced pressure at -50°C and freeze-drying it. The fruit extract is prepared through the same process as above, so that the effective ingredients can be easily extracted.

Next, the method for producing a cosmetic composition according to the present invention includes preparing a flower extract. The step of preparing the flower extract includes washing, freeze-drying, and pulverizing honeysuckle flowers, peony flowers, and evening primrose flowers to prepare honeysuckle flower powder, peony flower powder, and evening primrose powder; 20 g of the prepared mixed powder of honeysuckle flower powder, peony flower powder, and evening primrose powder mixed at a weight ratio of 1:1:1 was mixed with 200 ml of water, and heated for 8 hours at a temperature of 80°C while stirring. performing extraction; After the first hot water extraction, filtering with filter paper and then freeze-drying the filtrate to prepare a first mixed extract; After the first hot water extraction, filter through filter paper and mix the remaining solids with water again so that the mixing ratio of solids and water is 0.1 g/ml, and perform the second hot water extraction at a temperature of 120°C for 12 hours while stirring. steps; After secondary hot water extraction, filtering through filter paper and then freeze-drying the filtrate to prepare a secondary mixed extract; After secondary hot water extraction and filtering with filter paper, the remaining solids are mixed with water again so that the mixing ratio of solids and water is 0.1 g/ml, and then mixed with [BMIm][TFSI](1-Butyl-3-methylimidazoliumbis) Adding 1-2 g of trifluoromethylsulfonyl)imide) and performing third hot water extraction at a temperature of 100°C for 8 hours while stirring; After the third hot water extraction, filtering through filter paper and then freeze-drying the filtrate to prepare a third mixed extract; And mixing the first mixed extract, second mixed extract, and third mixed extract. The flower extract is prepared through the same process as above, so the active ingredients can be easily extracted.

Next, the method for producing a cosmetic composition according to the present invention includes the step of producing grapefruit exosomes. The step of producing the grapefruit exosomes includes washing the grapefruit and pretreating it at a temperature of 18-22°C and a pressure of 140-160 MPa for 3-7 minutes; Preparing grapefruit juice by squeezing pretreated grapefruit; Centrifuging the grapefruit juice to obtain a supernatant containing exosomes; Preparing a lyophilisate by lyophilizing the supernatant containing the exosomes; Forming an aqueous two-phase system using polyethylene glycol/dextran in the freeze-dried product; and obtaining a lower layer solution in which exosomes in the aqueous two-phase system are concentrated.

Next, the method for producing a cosmetic composition according to the present invention includes the step of producing a fermentation extract. The step of preparing the fermented extract includes washing corn grains and centella asiatica with boiled water and pulverizing them to prepare corn powder and centella asiatica powder; A mixture was prepared by mixing 23-27 parts by weight of corn powder, 23-27 parts by weight of Centella asiatica powder, and 58-62 parts by weight of water, and 1 part by weight of Saccharomyces cerevisiae as a yeast was added to the mixture. Fermentation at a temperature of 38-42°C for 34-38 hours; Preparing an extract by mixing the fermented mixture and butylene glycol and stirring for 4-6 days at a temperature of 28-32°C; And a step of filtering and concentrating the extract under reduced pressure and then freeze-drying it.

Next, the method for producing the cosmetic composition according to the present invention is 1-5 parts by weight of the hijiki extract, 0.5-1.5 parts by weight of the fruit extract, 0.5-1.5 parts by weight of the flower extract, and 0.5-1.5 parts by weight of the grapefruit-derived exosomes. , 0.5-1.5 parts by weight of the fermented extract, 1-3 parts by weight of niacinamide, 0.5-1.5 parts by weight of arginine, 0.5-1.5 parts by weight of phenylalanine, 0.5-1.5 parts by weight of 1,2-hexanediol, pentylene glycol 0.5-1.5 parts by weight, glyceryl caprylate 0.5-1.5 parts by weight, ascorbyl glucoside 0.5-1.5 parts by weight, squalane 3-7 parts by weight, dextrin 1-3 parts by weight, linalool 1-3 parts by weight, limonene 1- 3 parts by weight, xanthan gum 1-3 parts by weight, adenosine 0.5-1.5 parts by weight, stearyl alcohol 0.05-0.2 parts by weight, sodium hyaluronate 0.05-0.2 parts by weight, valine 0.05-0.2 parts by weight, isoquercitrin 0.05 It includes mixing -0.2 parts by weight, 0.05-0.2 parts by weight of polyglyceryl-6 stearate, 0.3-0.7 parts by weight of glutamic acid, and 68-72 parts by weight of carrot water.

Hereinafter, the present invention will be explained in more detail by the following examples.

However, the following examples only illustrate the content of the present invention and the scope of the invention is not limited by the examples and experimental examples.

<Example 1> Preparation of hijiki extract

The hijiki was powdered using a grinder, and 1 L of 70% ethanol was added to 100 g of the powdered hijiki, and extracted three times at room temperature for 24 hours each. Whatman No. 3 The extract was filtered using filter paper (Whatman Ltd, Maidstone, Kent, UK) and then concentrated using a vacuum concentrator (Rotavapor R-100, Buchi, Flawil, Switzerland). The concentrated extract was freeze-dried in a freeze dryer (Vision, Daejeon, Korea), powdered, and stored in a freezer before use.

<Experimental Example 1> Confirmation of the skin barrier strengthening effect of hijiki extract in skin keratinocytes

<1-1> Cell culture

The cell line used in the test was HaCaT cells, which are keratinocytes. The cell line was dissolved in DMEM medium containing penicillin (100 IU/mL), streptomycin (100 IU/mL), and 10% FBS, inoculated into a 100 mm dish, and cultured in an incubator containing 5% CO ₂ at 37°C. , subcultured every 2 to 3 days.

<1-2> Confirmation of skin moisturizing related gene expression

Skin moisturizing-related genes hyaluronic acid synthase HAS-1, HAS-2, HAS-3, and FLG were confirmed using RT-PCR method. HaCaT cells were adjusted to a density of ³ After culturing in the incubator for 24 hours, the medium was replaced with an inorganic medium and cultured for an additional 24 hours. Tulip extract of various concentrations diluted in serum-free medium was treated and re-cultured for 24 hours. After removing the supernatant, total RNA was extracted using Trizol reagent (Invitrogen), and RNA quantification was measured using Nano drop (Thermo). cDNA was synthesized using Bioneer AccuPower ^® RT PreMix, and cDNA was amplified through PCR using specific primers. For PCR amplification, Bioneer AccuPower ^® PCR PreMix was used, and the reaction conditions were initial denaturation at 95°C for 5 minutes, followed by 30 cycles of amplification. Each cycle consisted of denaturation at 95°C for 30 seconds, annealing at 55°C-60°C for 30 seconds, and extension at 72°C for 30 seconds. The PCR product was electrophoresed on a 1.5% agarose gel, stained with ethidium bromide (EtBr), and observed using Gel Doc (Bio-Rad, USA). Using GAPDH as an internal control, the relative expression of FLG, HAS-1, HAS-2, and HAS-3 genes was evaluated. The primers used in PCR are shown in Table 1 below.

Primer Sequences (5’ to 3’) Filaggrin
(FLG) Forward AGGGAAGATCCAAGAGCCCA
Reverse ACTCTGGATCCCCCTACGCTT Hyaluronan synthase 1
(HAS-1) Forward CCACCCAGTACAGCGTCAAC
Reverse CATGGGTGCTTCTGTCGCTCT Hyaluronan synthase 2
(HAS-2) Forward TTCTTTATGTGACTCATCTGTCTCACCGG
Reverse ATTGTTGGCTACCAGTTTATCCAAACG Hyaluronan synthase 3
(HAS-3) Forward TATACCGCGCGCTCCAA
Reverse GCCACTCCCGGAAGTAAGACT GAPDH Forward TGAAGGTCGGAGTCAACGGATTTGGT
Reverse CATGTGGGCCATGAGGTCCACCAC

As a result of treating HaCaT cells with 70% ethanol extract of hijikijiki at different concentrations, it was confirmed that the expression level of filaggrin gene, a skin barrier maintenance factor, increased in a concentration-dependent manner and that the hijikiji extract helps maintain skin moisture (Figure 1 ).

In addition, it was confirmed that the expression of HAS-1, HAS-2, and HAS-3, which are hyaluronic acid synthase enzymes involved in skin moisturization, was increased, and it was determined that the 70% ethanol extract of hijiki cypress was effective in moisturizing the skin (Figure 2).

<Example 2> Preparation of cosmetic composition

3 parts by weight of hijiki extract prepared in Example 1, 1 part by weight of fruit extract, 1 part by weight of flower extract, 1 part by weight of grapefruit-derived exosomes, 1 part by weight of fermented extract, 2 parts by weight of niacinamide, 1 part by weight of arginine , 1 part by weight of phenylalanine, 1 part by weight of 1,2-hexanediol, 1 part by weight of pentylene glycol, 1 part by weight of glyceryl caprylate, 1 part by weight of ascorbyl glucoside, 5 parts by weight of squalane, 2 parts by weight of dextrin, Linalool 2 parts by weight, limonene 2 weight parts, A cosmetic composition was prepared by mixing 0.1 parts by weight of polyglyceryl-6 stearate, 0.5 parts by weight of glutamic acid, and 70 parts by weight of carrot water.

<Experimental Example 2>

<2-1> Skin wrinkle improvement effect

The following experiment was performed to confirm the skin wrinkle improvement effect of the cosmetic composition prepared in Example 2. Specifically, each of 25 test subjects in their 40s and 50s was tested for 40 days by spreading about 3-4 g of the cosmetic composition evenly on the face twice a day, morning and evening. After completion of the 40-day test, the degree of wrinkle improvement was evaluated using the observer's naked eye. The degree of wrinkle improvement was evaluated using items 1 to 4 as follows, and the results are shown in Table 2 below.

No. 1: No improvement in wrinkles at all

No. 2: Wrinkles were improved, but no significant change was felt.

No. 3: Excellent wrinkle improvement effect, feel the change

No. 4: The wrinkle improvement effect is clearly excellent.

item Example 2 no. 1 0 No.2 0 number 3 14 Number 4 11

As shown in Table 12 above, it was confirmed that the wrinkle improvement effect was excellent.

<2-2> Moisturizing effect

The following experiment was performed to confirm the moisturizing effect of the cosmetic composition prepared in Example 2. Through a survey, 100 healthy adult men and women who felt their skin was dry were randomly selected and the cosmetic composition of Example 2 was applied to their faces twice a day for 8 weeks and then washed off with water. The moisturizing effect was evaluated every week from the start of the actual use test, and the improvement effect after the end was evaluated using a corneometer CM 820 (Corage + Khazaka, Germany), a moisture content measuring device. The moisturizing effect measurement results are shown in Table 3 below.

Example 1 Before use 22.7 After 1 week of use 41.2 After 2 weeks of use 55.7

As shown in Table 3 above, it was confirmed that the moisturizing effect was excellent.

Claims (3)

1-5 parts by weight of hijiki extract, 0.5-1.5 parts by weight of fruit extract mixed with tangerine extract, kiwi extract, pear extract, and orange extract in a weight ratio of 3:3:2:2, honeysuckle extract, honeysuckle extract, and 0.5-1.5 parts by weight of flower extract mixed with peony flower extract at a weight ratio of 1:1:1, 0.5-1.5 parts by weight of grapefruit-derived exosomes, fermented corn extract, and fermented folding screen extract mixed at a weight ratio of 1:1. Fermentation extract 0.5-1.5 parts by weight, niacinamide 1-3 parts by weight, arginine 0.5-1.5 parts by weight, phenylalanine 0.5-1.5 parts by weight, 1,2-hexanediol 0.5-1.5 parts by weight, pentylene glycol 0.5- 1.5 parts by weight, glyceryl caprylate 0.5-1.5 parts by weight, ascorbyl glucoside 0.5-1.5 parts by weight, squalane 3-7 parts by weight, dextrin 1-3 parts by weight, linalool 1-3 parts by weight, limonene 1-3 parts by weight parts, xanthan gum 1-3 parts by weight, adenosine 0.5-1.5 parts by weight, stearyl alcohol 0.05-0.2 parts by weight, sodium hyaluronate 0.05-0.2 parts by weight, valine 0.05-0.2 parts by weight, isoquercitrin 0.05-0.2 A skin barrier strengthening cosmetic composition comprising 0.05-0.2 parts by weight of polyglyceryl-6 stearate, 0.3-0.7 parts by weight of glutamic acid, and 68-72 parts by weight of carrot water. delete delete