KR102471768B1 - Primer sets for discrimination plants of Centaurea, and use thereof - Google Patents

Abstract

The present invention relates to a primer set for discriminating yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) belonging to the cornflower genus. More specifically, it is about identifying the plant chloroplast genomes of the two plants and using the ARMS-PCR method based on this, and for primers and combinations thereof, and the primer combination according to the present invention is for yellow cornflower or pink cornflower Since each is specifically amplified for each, it can be usefully used to quickly and accurately discriminate the two plants, which are invasive alien species.

Description

Primer sets for discrimination plants of Centaurea, and use thereof {Primer sets for discrimination plants of Centaurea, and use thereof}

The present invention relates to a primer set capable of discriminating each of Centaurea maculosa and yellow cornflower (Centaurea solstitialis) belonging to the cornflower genus, which is an invasive alien species, and uses thereof.

Globally, interest in recognizing the status of countries possessing genetic resources and the necessity of preserving life resources is on the rise, and countries around the world are making enormous efforts to secure and preserve plant genetic resources, which are the basic material for creating new national growth engines and the core of their own food security. making an effort Activities for this include the Convention on Biological Diversity (CBD) and the Convention on International Trade in Endangered Species of wild fauna and flora (CITES).

In addition, it is necessary to actively respond to access to genetic resources and benefit sharing (ABS) and to secure resources and establish a basis for use in preparation for the global war on life resources, but environmental changes such as global warming are necessary. It is necessary to adjust the resource creation strategy accordingly. In this regard, Invasive Alien Species (IAS) has been raised as the most threatening factor to Earth's biodiversity since the 20th century.

In particular, the problem of invasive alien species appearing complexly in connection with climate change is pointed out as the most important environmental problem on earth in the 21st century, consuming 10% of world GDP. For this reason, the Global Invasive Species Program (GISP) points out that climate change and the problem of invasive alien species must be approached and responded to at the national level. SDG) is set to reduce the inflow and damage of invasive alien species by 2020.

In Korea, damage to the domestic ecosystem and damage to the agricultural and industrial sectors by invasive alien species such as pine wood nematode, nutria, bullfrog, red-eared turtle, blue ball rockfish (bluegill), largemouth bass (bass), back young beetle, and pine cone fly have already occurred. It is considered a major social issue. In addition, it is predicted that ecosystem confusion will increase due to the introduction of new invasive alien species and the spread of existing invasive alien species due to climate change in the future.

However, evaluation of physiological and ecological changes of alien species due to climate change, establishment of measures to prevent invasion of alien species in connection with this, as well as establishment of strategies at the national and regional level to manage invasive alien species have not yet been made. A specific method for screening has also not been established.

In particular, among plants among invasive alien species, Asteraceae alien plants are known to have the highest frequency of appearance because they can spread over long distances using wind through the hairs on their fruits.

The yellow cornflower (Centaurea solstitialis) belonging to the Asteraceae family contains fatal toxicity to livestock, and due to the thorns of the plant, it slows down the plant intake rate of grazing livestock and restricts the germination and growth of other plants. have a wide impact

In addition, the pink cornflower (Centaurea maculosa) damages the mouth and digestive system of livestock with its thorns, secretes special chemicals to suppress the growth of other species, and reduces biodiversity. It affects.

Therefore, it is necessary to clearly discriminate and remove the two plants from various plant species in order to protect domestic plant ecosystems and livestock, but there is currently no method for accurately distinguishing the two plants.

So far, it has been largely dependent on classification and identification techniques using morphological characteristics of plants (especially seeds), and recently, the Ministry of Environment's National Institute of Biological Resources and the National Institute of Scientific Investigation (Ministry of Security and Public Administration) are focusing on genetic identification of plant resources using DNA barcodes. Molecular genetic research on forensics is being conducted or research on the development of molecular markers for psychotropic plants is being prepared.

However, depending on the plant group, the reproducibility of the noncoding region, which is a representative DNA barcode section, is remarkably low, or the nucleotide sequence of the nuclear DNA ITS region and the rbcL and matK genes of chloroplast DNA are different between taxa within a family or within a genus. It is the same (eg, honeysuckle, etc.), but there is a problem in that the resolution is very low.

Therefore, it is necessary to develop a method capable of accurately distinguishing the pink cornflower and the yellow cornflower among various plants distributed in Korea by overcoming the above problems.

The present inventors can discriminate each of yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) belonging to the genus Centaurea, an invasive alien species. ARMS (Amplification refractory mutation system) - PCR method was applied to prepare primers Thus, the present invention was completed.

Accordingly, an object of the present invention is to provide a primer set for discriminating yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa).

Another object of the present invention is to provide a kit for determining yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa).

Another object of the present invention is to provide a method for identifying cornflower yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa).

In order to achieve the above object, the present invention is yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea solstitialis) or pink cornflower ( Centaurea maculosa) provides a set of primers for discrimination.

In addition, in order to achieve the above another object, the present invention is a primer set according to the present invention; And reagents for carrying out the amplification reaction; provides a kit for identifying yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) containing.

In addition, in order to achieve the above another object, the present invention comprises the steps of isolating genomic DNA from a plant sample; Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set according to the present invention; And it provides a yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) discrimination method comprising the step of detecting the amplification product.

The present invention relates to a primer set for identifying yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa), and more specifically, identifying the yellow cornflower or pink cornflower chloroplast genome and based on this ARMS-PCR method It is for a primer and a combination thereof prepared using the primer set according to the present invention, since the primer set of the combination according to the present invention is specifically amplified for yellow cornflower or pink cornflower, respectively, to quickly and accurately discriminate and remove the two plants, which are invasive alien species. can be put to good use.

1 is a diagram of a genetic map of the chloroplast genome of Centaurea maculosa, a plant of the genus Cornflower.
Figure 2 is a diagram of the genetic map of the yellow cornflower (Centaurea solstitialis) chloroplast genome, a plant of the genus Cornflower.
Figure 3 is a result of confirming whether each amplification after various combinations of primers prepared by applying the ARMS (Amplification refractory mutation system) method in yellow cornflower.
4 is a result of confirming the amplification of each primer after various combinations of primers prepared by applying the ARMS method in cornflower chrysanthemum.
5 is a result of confirming whether the ARMS-based primers of the confirmed combination were amplified in yellow cornflower.
6 is a result of confirming whether the ARMS-based primers of the confirmed combination were amplified in cornflower chrysanthemum.

Hereinafter, the present invention will be described in detail.

In the present invention, primers capable of discriminating each of Centaurea solstitialis and pink cornflower (Centaurea maculosa) belonging to the genus Centaurea, which are invasive alien species, are produced, and in this case, the discrimination specificity for each target species Primer sets of higher combinations were derived.

Therefore, the present invention is a primer for distinguishing yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) comprising an oligonucleotide primer set represented by any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 14 provide a set.

In the present invention, "alien species" is a term that collectively refers to introduced species, naturalized species, and invasive species, and refers to species that enter from outside their original habitat and occupy the habitat of other organisms, regardless of specific artificial purposes. do. In addition, “invasive alien species” refers to alien species that threaten or adversely affect ecosystem services related to biodiversity as they are introduced and spread into the ecosystem.

The criteria for risk assessment of the above-mentioned alien species are: first, among alien organisms, organisms that disturb or are likely to disturb the balance of the ecosystem; second, among organisms that do not fall under the category of alien organisms, those that disturb or are likely to disturb the balance of the ecosystem in a specific area Third, among LMOs produced through genetic modification, they are defined as organisms that disturb or are likely to disturb the balance of the ecosystem.

The invasive alien species changes the function of the ecosystem by changing the availability of genetic resources or disturbing the system (age) of the invasive ecosystem, changing the gene pool of the ecosystem through hybridization between native and alien species, and changing the soil material. It is known to alter metabolic processes and in particular affect carbon capture processes. In particular, competition among native species for location, ecological status, and position appears, which is a cause of reducing the diversity of native species.

In the present invention, the cornflower (Centaurea) variety plant belongs to Asteraceae and is a plant of the genus containing 350 to 600 species. The Cornflower cultivar plant is called a naturalization plant or an ecosystem disruptor plant, which means a species that invades a species that was native to a foreign country or spreads wild seeds of a cultivated plant, and has a significantly superior growth ability than native plants . When the stable plant ecosystem is changed by external factors, it easily enters, settles, spreads, and dominates, disturbing the ecosystem and causing damage.

In Korea, various cases of damage caused by breeding cornflower varieties, among them, yellow cornflower and pink cornflower, occur in Korea, and it is required to develop a method that can clearly identify them for their removal.

Therefore, the present invention searches for a gene having a specific SNP in the chloroplast genome of each plant in order to discriminate (identify) yellow cornflower or pink cornflower, and applies ARMS-PCR technique. Primers capable of detecting the gene was produced.

In the present invention, the "Single Nucleotide Polymorphism (SNP)" means a genetic change or mutation showing a difference in one nucleotide sequence (A, T, G, C) in a DNA nucleotide sequence, and DNA It is the most common form of sequence polymorphism.

In the present invention, “polymorphism” refers to the case where two or more alleles exist in one locus, and among polymorphic sites, a single nucleotide polymorphism in which only a single base differs from person to person It is called Preferred polymorphic markers have two or more alleles that exhibit a frequency of greater than 1%, more preferably greater than 10% or greater than 20% in a selected population.

In the present invention, "allele" refers to several types of a gene present on the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

In the present invention, the "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary nucleic acid template, and the strand of the nucleic acid template A short nucleic acid sequence that serves as a starting point for copying. Primers can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.

When designing the primers, various restrictions are followed, such as the A, G, C, and T content ratio of the primers, prevention of primer dimer formation, and prohibition of repeating the same base sequence three or more times. (template) Conditions such as the amount of DNA, concentration of primer, concentration of dNTP, concentration of Mg ²⁺ , reaction temperature, and reaction time should be appropriate.

The above primers can incorporate additional features that do not change the basic properties. That is, nucleic acid sequences can be modified using a number of means known in the art. Examples of such modifications are methylation, capping, substitution of nucleotides with one or more homologues, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates, or phosphorothioates or phosphorodithioates. Transformation of nucleotides into charged linkages such as Nucleic acids may also contain one or more nucleic acids, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly-L-lysine, intercalating agents such as acridine or psoralen, chelating agents and alkylating agents such as metals, radioactive metals, and iron oxidizing metals. It may have additional covalently linked moieties.

In addition, the primer sequence of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The primer may include a label that can be detected using spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins for which antiserum or monoclonal antibodies are available.

The primers are cloned with an appropriate sequence and digested with restriction enzymes, followed by the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68:90-99), the diethylphosphoramidite method of Beaucage et al. (1981, Tetrahedron Lett. 22:1859-1862), and any other well-known method including direct chemical synthesis, such as the solid support method of US Pat. No. 4458066.

In particular, the present invention is characterized in that the primers are prepared by applying the ARMS-PCR method based on the chloroplast genomes of cornflower yellow and cornflower pink. The "Amplification refractory mutation system (ARMS)" method is a method for detecting point mutations. During the PCR reaction, the 3' nucleotide sequence of the primer decisively affects the subsequent PCR reaction, so if the 3' nucleotide sequence of the primer is changed by point mutation, etc., the subsequent process will not proceed successfully and the target region cannot be amplified. It means a technique using the principle that there is no.

If a primer capable of specifically reacting only to a target species is produced using the above principle, it can be used as a species-specific molecular marker capable of identifying a species at the molecular level. To develop a species-specific marker, the position of the primer is determined so that the SNP region where the mutation appears is located at the 3' end of the primer, and then the base right in front of the 3' end is replaced with another base to prepare a primer.

In this case, the target species has a different nucleotide sequence immediately before the 3' end of the prepared primer, and the remaining comparative species have a different 2 bases at the 3' end of the primer, making amplification difficult. At this time, the base to be replaced is determined in consideration of the degree of mismatch between the bases. After that, find PCR reaction conditions that can specifically react with the produced species-specific primers, and verify that the confirmed experimental conditions produce the same results in other groups and individuals. Primers can be utilized as species-specific molecular markers of the target species.

According to a preferred embodiment of the present invention, the primer set is a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, a sequence In the group consisting of a primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, a primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14 It is characterized in that it is a set of any one or more selected.

In addition, according to a preferred embodiment of the present invention, among the primer sets, the primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, the primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, and the primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6 , and the primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8 is characterized in that it can discriminate yellow cornflower (Centaurea solstitialis).

In addition, according to a preferred embodiment of the present invention, among the primer sets, the primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, the primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and the primers consisting of SEQ ID NO: 13 and SEQ ID NO: 14 The pair are characterized by being able to identify the pink cornflower (Centaurea maculosa).

In addition, the present invention is a primer set according to the present invention; And reagents for carrying out the amplification reaction; provides a kit for identifying yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) containing.

The reagent for carrying out the amplification reaction is not particularly limited as long as it is a reagent that can be added to the amplification reaction in general, but may preferably include DNA polymerase, dNTPs, or a buffer. In addition, the kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

In addition, the present invention isolates genomic DNA from plant samples; Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set according to the present invention; And it provides a yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) discrimination method comprising the step of detecting the amplification product.

In the present invention, "polymerase chain reaction" refers to an experimental method for amplifying only a desired portion of a DNA chain in large quantities, examples of which include polymerase chain reaction, allele specific polymerase chain reaction (Allele Specific Polymerase Chain Reaction), Nested-Polymerase Chain Reaction, multiplex Polymerase Chain Reaction (multiplex PCR), competitive Polymerase Chain Reaction, real-time polymerase chain At least one selected from the group consisting of real-time polymerase chain reaction, real-time quantitative polymerase chain reaction, DNA chip, and loop-mediated isothermal amplification In the above discrimination method, the detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto.

The contents of the present invention described above are equally applied to each other unless contradictory to each other, and implementation by adding appropriate changes by a person skilled in the art is also included in the scope of the present invention.

Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited only to the following examples.

Example 1. Chloroplast DNA extraction

Chloroplast DNAs of Centaurea plants such as yellow cornflower (Centaurea solstitialis), pink cornflower (Centaurea maculosa), and grass-leaved cornflower (Centaurea diffusa) were isolated. In addition, as a comparison group, chloroplast DNA of a related taxon, Carthamus tinctorius, was also isolated. Specifically, 50-100 g of fresh and young leaves for each plant were prepared, washed with distilled water to remove foreign substances, wiped dry, and stored in a refrigerated state for 2-3 days to suppress unnecessary starch production.

After cutting the prepared leaves into 1-2 cm ² size, Isolation buffer (CIB; 0.35M Sorbitol, 50Mm Tris-HCl, 5mM EDTA, 0.1% BSA (w/v, sigma A4503), 0.01% DL-DTT)) was added and mixed until the leaves were submerged. The mixed sample was first woven using 4 layers of gauze, and then naturally separated using 3 layers of miracloth (CALBIOCHEM Co.). Then, the supernatant was collected by centrifugation at 200 g for 3 minutes and centrifuged again at 1,000 g for 7 minutes. The obtained pellet after centrifugation was dissolved in chloroplast isolation buffer (CIB) from which bovine serum albumin (BSA) was removed. Then, the chloroplast layer was separated by centrifugation at 3,200 g for 15 minutes using a 40/80% Percoll gradient. Only the chloroplast layer was collected, CIB (BSA-free buffer) corresponding to 3 times was added, and then centrifuged at 1,700 g for 1 minute to collect a pellet composed of purified chloroplasts. CIB from which BSA was removed was added to the pellet to dissolve, and chloroplast DNA was isolated using a DNeasy Plant Mini Kit (QIAGEN, Cat. No. 69104) and used as a template for NGS analysis.

Example 2. Chloroplast DNA analysis

2.1 Chloroplast DNA analysis method

To analyze the extracted chloroplast DNA, data generation through Next Generation Sequencing (NGS), gap-filling, annotation, comparative analysis, and Sanger sequencing ) was performed. After the NGS analysis using the DNA extracted in Example 1 was completed, the data (reads) generated were first analyzed by de novo assembly. Through this, reads corresponding to the chloroplast genome were collected to create a scaffold contig, and gaps were identified by comparing with the reference sequence. Then, using the nucleotide sequence for the corresponding region of the reference sequence, a primer for gap-filling was prepared and commissioned to Macrogen (located in Seoul) to confirm the nucleotide sequence using the Sanger method. filled the gaps. Finally, after completing the gap-filling, the nucleotide sequence of the entire chloroplast genome was determined. An annotation process was performed to confirm the type and order of genes on the chloroplast genome using the finally determined nucleotide sequence. To this end, DOGMA and Geneious programs, which are platforms mainly used in chloroplast genome analysis, were used.

After the annotation process was performed, the chloroplast genome sequences of related taxa were compared and analyzed to analyze the structural characteristics and the degree of variation of the chloroplast genomes of the taxa.

2.2 Chloroplast DNA analysis results

Chloroplast genomes of Centaurea plants and Carthamus tinctorius, a related taxon, are compared and shown in Tables 1 and 2 below (Table 1: Chloroplast genome genes of Cornflower plants), Table 2: Comparison of chloroplast genome length and AT content in cornflower and safflower plants). In addition, the genetic map of the confirmed chloroplast genome of pink cornflower and the chloroplast genome of yellow cornflower are shown in FIGS. 1 and 2, respectively.

According to the genetic map of the pink cornflower chloroplast genome, as shown in Figure 1, the size of the chloroplast genome is 152,518 bp and it is confirmed that it consists of a total of 114 genes (RNA genes (34), protein genes (46), ribosome proteins (ribosomal protein) (21), transcription/translation (13)).

In addition, according to the genetic map of the yellow cornflower chloroplast genome, as shown in Figure 2, it was confirmed that the size of the chloroplast genome was 151,967 bp and consisted of a total of 114 genes (RNA genes (34), protein genes (46), ribosomes ribosomal protein (21), transcription/translation (13)).

A list of genes corresponding to RNA genes, protein genes, ribosome proteins, and transcription/translation genes included in the chloroplasts of the pink cornflower and yellow cornflower is shown in Table 1 below, and it was confirmed that the two plants are the same.

gene group gene name number RNA gene ribosomal RNAs rrn4 . 5 , rrn5 , rrn16 , rrn23 4 transfer RNAs
(Transfer RNAs) trnA-UGC, trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC, trnG-UCC, trnH-GUG, trnI-CAU, trnI-GAU, trnK-UUU, trnL- CAA, trnL-UAA, trnL-UAG, trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG, trnR-ACG, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-CGU, trnT-UGU, trnV-GAC, trnV-UAC, trnW-CCA, trnY-GUA 30 protein gene Photosystem I psaA, psaB, psaC, psaI, psaJ 5 Photosystem II psbA , psbB , psbC , psbD , psbE , psbF , psbH , psbI , psbJ , psbK , psbL , psbM , psbN , psbT , psbZ 15 Cytochrome petA , petB , petD , petG , petL , petN 6 ATP synthases atpA , atpB , atpE , atpF , atpH , atpI 6 large unit of rubisco
(Large unit of Rubisco) rbcL One NADH dehydrogenase
(NADH dehydrogenase) ndhA, ndhB, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK 11 ATP-dependent protease subunit P
(ATP-dependent protease subunit P) clpP One Envelope membrane protein cemA One ribosome genes Large units of ribosome rpl14, rpl16, rpl2, rpl20, rpl22, rpl23, rpl32, rpl33, rpl36 9 Small units of ribosome rps11, rps12, rps14, rps15, rps16, rps18, rps19, rps2, rps3, rps4, rps7, rps8 12 transcription/translation genes RNA polymerase
(polymerase) rpoA , rpoB , rpoC1 , rpoC2 4 Initiation factor infA One other proteins
(Miscellaneous protein) accD , ccsA , matK 3 Hypothetical proteins and conserved reading frames
(Hypothetical proteins and conserved reading frames) ycf1, ycf15, ycf2, ycf3, ycf4, 5 gun 114

In addition, according to Table 2 below, among the plants of the genus Cornflower, turfgrass was found to be the longest at 153,202 bp, and yellow cornflower was confirmed to be the shortest at 151,967 bp. In addition, Cornflower plants showed similar AT content.

bell LSC
(large single copy) SSC
(small single copy) reverse repeat
(Inverted Repeat, IRs) gun Length (bp) AT (%) Length (bp) AT (%) Length (bp) AT (%) Length (bp) AT (%) pink cornflower
(Centaurea maculosa) 83,595 64.1 18,487 68.6 25,218 56.9 152,518 62.3 yellow cornflower
(Centaurea solstitialis) 83,255 64.0 18,577 68.5 25,066 56.8 151,967 62.2 grass leaf tallow
(Centaurea diffusa) 83,596 64.1 18,487 68.6 25,238 56.8 153,202 62.2 safflower
(Carthamus tinctorius) 84,166 64.0 18,598 68.6 25,156 56.9 153,114 62.2

Example 3. Cornflower pink and yellow cornflower specific primer development

3.1 Search for specific genes for each plant

Based on the chloroplast genomes of cornflower pink and cornflower yellow identified in Example 2, a specific gene capable of distinguishing the two plants was identified. Specifically, the nucleotide sequence of the chloroplast gene of each plant confirmed in Example 2 was aligned using MAFFT v.7 (https://mafft.cbrc.jp /alignment/server/), and DNAsp v.6 (http: //www.ub.edu/dnasp/) was used to search for SNPs. In addition, a neighbor joining (NJ) dendrogram was created using PAUP v.4.10b, and related relationships were analyzed. As a result, a total of 80 regions were selected as candidate groups: 42 regions of chloroplast genes and 38 regions of nuclear genes (Asteraceae universal COS gene 36 sites, ITS 2 sites).

Based on the candidate group, a specific SNP site was identified for each gene through Sanger sequencing.

3.2 Primer Fabrication

As a result, it was confirmed that there are SNP regions specific to three genes ( ITS, At3g44680, ycf2 ) in pink cornflower and three genes ( ITS, ycf2, rbcL ) in yellow cornflower, and the identified genes can be detected. A primer was prepared.

Gene amplification was amplified using Solgent Diastar Taq polymerase (Solgent, Korea), and the PCR reaction used touchdown PCR (Touchdown PCR) technique. In the first step, after initial denaturation at 98°C for 5 minutes, reaction was performed at 98°C for 30 seconds, 65°C for 30 seconds, and 72°C for 30 seconds. At this time, the annealing temperature was lowered by 1°C for each repetition, and this was repeated 10 times. And in the second step, 98°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds were repeated 20 times, followed by 72°C for 10 minutes.

For purification, PCR products were separated on a 1% agarose gel, and DNA was extracted from the gel using Wizardⓡ SV Gel and PCR Clean-UP System (Promega) according to the manufacturer's instructions. did The DNA sequence was determined through ABI PRISM (model 3700, version 3.6.1) automatic DNA sequencing (automatic sequencer) by requesting TaKaRa Korea Biomedical Inc.

However, when a PCR reaction was performed for screening cornflower pink and cornflower yellow using the primers prepared as described above, it was confirmed that DNA bands of the same size were produced in all except for some (data not shown). Therefore, it was determined that the primers lacked specificity, and thus, ARMS-based primers were prepared by applying the ARMS-PCR technique.

First, the primer length was set to 19-23 nucleotide sequence, and a mismatch was given to the second nucleotide sequence from the 3' end. The GC content was set to 50-60%, and Hairpin, Self-Dimer, and Hetero-Dimer were analyzed using the OligoAnalyzer Tool (sd.idtdna.com/calc/analyzer). measured. Hairpins having a temperature of 25° C. or higher and self-dimers and hetero-dimers having no more than 5 bonds were selected. Based on this, an ARMS-based primer was prepared in which primer annealing and extension were performed only in a specific species during PCR. The ARMS-based primers prepared as described above are shown in Table 3 below.

target species primer direction Sequence (5'-3') size yellow cornflower S-ITS-2GF F TGCCCTGCGATGCTTGCGA 510 S1-ITS-2CF F TGCCCTGCGATGCTTGCCA S1-ITS-2AF F TGCCCTGCGATGCTTGCAA S1-ITS-3GF F TGCCCTGCGATGCTTGGTA S1-ITS-3TF F TGCCCTGCGATGCTTGTTA S1-ITS-3AF F TGCCCTGCGATGCTTGATA S1-ITS-2TR R CGAGCAACTCTCTAGCATCTG S1-ITS-2CR R CGAGCAACTCTCTAGCATCCG S1-ITS-2GR R CGAGCAACTCTCTAGCATCGG S1-ITS-3GR R CGAGCAACTCTCTAGCATGAG S1-ITS-3TR R CGAGCAACTCTCTAGCATTAG S1-ITS-3AR R CGAGCAACTCTCTAGCATAAG S2-ITS-2AF F ATGCGTTCAACGTGCCTAAA 502 S2-ITS-2GF F ATGCGTTCAACGTGCCTAGA S2-ITS-2CF F ATGCGTTCAACGTGCCTACA S2-ITS-3TF F ATGCGTTCAACGTGCCTTTA S2-ITS-3CF F ATGCGTTCAACGTGCCTCTA S2-ITS-3GF F ATGCGTTCAACGTGCCTGTA S2-ITS-2AR R AGCTCGATACGAAGGCCTAA S2-ITS-2CR R AGCTCGATACGAAGGCCTCA S2-ITS-2GR R AGCTCGATACGAAGGCCTGA S-RBCL2TF F CGTGCTCTACGTCTGGTG 771 S-RBCL2CF F CGTGCTCTACGTTCTGGCG S-RBCL2GF F CGTGCTCTACGTCTGGGG S-RBCL3TF F CGTGCTCTACGTCTGTAG S-RBCL3AF F CGTGCTCTACGTCTGAAG S-RBCL3CF F CGTGCTCTACGTCTGCAG S-RBCL2GR R CATATGCCAAACGTGAATACGG S-RBCL2AR R CATATGCCAAACGTGAATACAG S-RBCL2TR R CATATGCCAAACGTGAATACTG S-RBCL3GR R CATATGCCAAACGTGAATAGCG S-RBCL3TR R CATATGCCAAACGTGAATATCG S-RBCL3AR R CATATGCCAAACGTGAATAACG S-YCF22AF F AAACCCTCCACTTCAATTGGTAAC 720 S-YCF22CF F AAACCCTCCACTTCAATTGGTACC S-YCF22GF F AAACCCTCCACTTCAATTGGTAGC S-YCF23TF F AAACCCTCCACTTCAATTGGTTTC S-YCF23CF F AAACCCTCCACTTCAATTGGTCTC 720 S-YCF23GF F AAACCCTCCACTTCAATTGGTGTC S-YCF22AR R TTTTTTCCACCAAGAACGTTTAC S-YCF22CR R TTTTTTCCACCAAGAACGTTTCC S-YCF22GR R TTTTTTCCACCAAGAACGTTTGC S-YCF23AR R TTTTTTCCACCAAGAACGTTATC S-YCF23GR R TTTTTTCCACCAAGAACGTTGTC pink cornflower M-ITSF F CCAAGGAAAACAAAACTCAAGAAGGAC 480 M-ITS2TF F CCAAGGAAAACAAAACTCAAGAAGGTC M-ITS2CF F CCAAGGAAAACAAAACTCAAGAAGGCC M-ITS2GF F CCAAGGAAAACAAAACTCAAGAAGGGC ITS4 R TCCTCCGCTTATTGATATGC CMA35NF2T F GACCCATGTGTATTGGATGTA 305 CMA35NF3T F GACCCATGTTGTATTGGATTGA CMA35NF3A F GACCCATGTTGTATTGGATAGA CMA35NF3C F GACCCATGTGTATTGGATCGA CMA35NR2T R ACCCAAAATTGACCCTTTTTG CMA35NR3G R ACCCAAAATTGACCCTTTGCG CMA35NR3C R ACCCAAAATTGACCCTTTCCG CMA35NR3A R ACCCAAAATTGACCCTTTACG STF2CF F TAAGTATCATACCAAATCCCACT 580 STF2AF F TAAGTATCATACCAAATCCCAAT STF2GF F TAAGTATCATACCAAATCCCAGT C16-1R R TCCAGGACCTTGTTCAGAAATAC

In addition, among the primers in Table 3, in the forward and reverse primers, primer sets of combinations capable of specifically selecting cornflower yellow or pink cornflower by various combinations were derived.

PCR was performed using various combinations of each primer, and the results are shown in FIGS. 3 and 4 . As shown in FIG. 3, in S1-ITS of yellow cornflower, the combination No. 4 (S1-ITS-3GF/S1-ITS-3GR) showed the most distinct band. In addition, in S2-ITS, the combination of No. 5 (S2-ITS-3CF/S2-ITS-2CR) showed the most distinct band. Also, in rbcL, combination 3 (S-RBCL2GF/S-RBCL2TR) showed the most distinct band. In addition, in ycf2, combination No. 2 (S-YCF22CF/S-YCF22CR) showed the most distinct band.

As shown in FIG. 4, in ITS among cornflowers, the combination of No. 3 (M-ITS2CF/ITS4) showed the strongest signal. In ycf2, it was confirmed that only combination 3 (STF2GF/C16-1R) was detected. In addition, in At3g44680, it was confirmed that only combination 1 (CMA35NF2T/CMA35NR2T) was detected.

Therefore, based on the results of FIGS. 3 and 4, as shown in Table 4 below, 4 primer sets for yellow cornflower and 3 primer sets for pink cornflower were confirmed.

target species primer Base sequence (5'-3') size
(bp) location order
number yellow cornflower S1-ITS-3GF TGCCCTGCGATGCTTGGTA 510 ITS(nc ^a ) One S1-ITS-3GR CGAGCAACTCTCTAGCATGAG 2 S2-ITS-3CF ATGCGTTCAACGTGCCTCTA 502 ITS(nc) 3 S2-ITS-2CR AGCTCGATACGAAGGCCTCA 4 S-RBCL2GF CGTGCTCTACGTCTGGGG 771 rbcL (cp ^b ) 5 S-RBCL2TR CATATGCCAAACGTGAATACTG 6 S-YCF22CF AAACCCTCCACTTCAATTGGTACC 720 ycf2 (cp) 7 S-YCF22CR TTTTTTCCACCAAGAACGTTTCC 8 pink cornflower M-ITS2CF CCAAGGAAAACAAAACTCAAGAAGGCC 480 ITS(nc) 9 ITS4 TCCTCCGCTTATTGATATGC 10 STF2GF TAAGTATCATACCAAATCCCAGT 580 ycf2 (cp) 11 C16-1R TCCAGGACCTTGTTCAGAAATAC 12 CMA35NF2T GACCCATGTGTATTGGATGTA 305 At3g44680 (NC) 13 CMA35NR2T ACCCAAAATTGACCCTTTTTG 14 * ^a , nuclear; ^b , chloroplast

3.3 Confirmation of specific amplification of the confirmed primer combination for the target species

In addition, in the primers of Table 4, it was confirmed that the pair including each confirmed forward and reverse primer was specifically amplified only for each species, and the results are shown in FIGS. 5 and 6. As a result, it was confirmed that the primer pair according to each combination was specifically amplified for each species.

Overall, the present invention relates to a technology for identifying yellow cornflower (Centaurea solstitialis) or pink cornflower (Centaurea maculosa) belonging to the cornflower genus, and more specifically, identifying the plant chloroplast genomes of the two plants, based on this Primers and combinations thereof prepared using the ARMS-PCR method, and the primer combination according to the present invention is specifically amplified for yellow cornflower or pink cornflower, respectively, so that the two plants, which are invasive alien species, can be quickly and accurately It can be usefully used for discrimination.

<110> Gachon University of Industry-Academic Cooperation Foundation REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Primer sets for discrimination plants of Centaurea, and use its <130> 1-2P <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> artificial sequence <220> <223> S1-ITS-3GF <400> 1 tgccctgcga tgcttggta 19 <210> 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> S1-ITS-3GR <400> 2 cgagcaactc tctagcatga g 21 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> S2-ITS-3CF <400> 3 atgcgttcaa cgtgcctcta 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> S2-ITS-2CR <400> 4 agctcgatac gaaggcctca 20 <210> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> S-RBCL2GF <400> 5 cgtgctctac gtctgggg 18 <210> 6 <211> 22 <212> DNA <213> artificial sequence <220> <223> S-RBCL2TR <400> 6 catatgccaa acgtgaatac tg 22 <210> 7 <211> 24 <212> DNA <213> artificial sequence <220> <223> S-YCF22CF <400> 7 aaaccctcca cttcaattgg tacc 24 <210> 8 <211> 23 <212> DNA <213> artificial sequence <220> <223> S-YCF22CR <400> 8 ttttttccac caagaacgtt tcc 23 <210> 9 <211> 27 <212> DNA <213> artificial sequence <220> <223> M-ITS2CF <400> 9 ccaaggaaaa caaaactcaa gaaggcc 27 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> ITS4 <400> 10 tcctccgctt attgatatgc 20 <210> 11 <211> 23 <212> DNA <213> artificial sequence <220> <223> STF2GF <400> 11 taagtatcat accaaatccc agt 23 <210> 12 <211> 23 <212> DNA <213> artificial sequence <220> <223> C16-1R <400> 12 tccaggacct tgttcagaaa tac 23 <210> 13 <211> 22 <212> DNA <213> artificial sequence <220> <223> CMA35NF2T <400> 13 gacccatgtt gtattggatg ta 22 <210> 14 <211> 21 <212> DNA <213> artificial sequence <220> <223> CMA35NR2T <400> 14 acccaaaatt gacccttttt g 21

Claims (8)

consisting of a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8 A primer set for discrimination of yellow cornflower (Centaurea solstitialis) comprising at least one primer pair selected from the group.
Pink color comprising at least one primer pair selected from the group consisting of a primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14 Primer set for discrimination of cornflower (Centaurea maculosa).
consisting of a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, and a primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8 A primer set for discrimination of yellow cornflower (Centaurea solstitialis) comprising at least one primer pair selected from the group; And a reagent for performing an amplification reaction; containing, a yellow cornflower (Centaurea solstitialis) discrimination kit.
Pink color comprising at least one primer pair selected from the group consisting of a primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14 A primer set for discrimination of cornflower (Centaurea maculosa); And a reagent for performing an amplification reaction; containing, a pink cornflower (Centaurea maculosa) discrimination kit.
According to claim 3,
Reagents for performing the amplification reaction are characterized in that they include DNA polymerase, dNTPs and a buffer, the discrimination kit.
isolating genomic DNA from the plant sample;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set according to claim 1; and
A yellow cornflower (Centaurea solstitialis) discrimination method comprising the step of detecting the amplification product.
isolating genomic DNA from the plant sample;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set according to claim 2; and
A method for determining Centaurea maculosa, comprising the step of detecting the amplification product.
According to claim 6,
Characterized in that the detection of the amplification product is performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images