KR102299594B1 - Development of CAPS marker for discrimination of shiitake mushroom culivar Sanbaekhyang and use thereof - Google Patents

Abstract

The present invention relates to a CAPS marker capable of discriminating shiitake cultivar, Sanbaekhyang, and a use thereof, and more specifically, to a biomarker for discriminating shiitake cultivar, Sanbaekhyang. According to the present invention, it is possible to quickly and conveniently identify shiitake cultivar, Sanbaekhyang. Shiitake strains can be distinguished by using the CAPS marker separated by PCR using primers of the present invention. Accordingly, it is possible to distinguish shiitake from other cultivars of shiitake, to identify mushrooms grown from illegally distributed starters, and to ensure the differentiation of the strains thereof.

Description

Caps marker for distinguishing shiitake mushroom varieties and its use {Development of CAPS marker for discrimination of shiitake mushroom culivar Sanbaekhyang and use thereof}

The present invention relates to a caps marker capable of discriminating the shiitake mushroom cultivar Sanbaekhyang and its use.

The world mushroom production value has been steadily expanding, increasing 4.7 times from about 8.5 billion dollars in the early 1990s to about 40 billion dollars in 2010, and the mushroom industry increased rapidly in the late 1990s. Shiitake mushrooms, which account for about 17% of the world's mushroom production, are mainly cultivated in Asian countries such as Korea, China, and Japan, and are also commercially grown in Western countries such as the United States, Canada, the Netherlands, and Poland. In addition, there is lentinan, which has anticancer effects, and its use is increasing not only for food but also for pharmaceutical purposes.

Until the 1980s, Japan was the world's major producer of shiitake mushrooms, but in 1990, China became the main producer. In 2012, China produced more than 4 million tons, or more than 90% of the world's production. In 2013, the total domestic mushroom production accounted for 1.1% of the total agricultural production, and the production ratio by item was 34% oyster mushroom, 24% oyster mushroom, 17% top, 16% shiitake, and 4% mushroom. Among mushrooms produced in Korea, the export amount and export volume of agricultural mushrooms are steadily increasing, but the import of shiitake mushrooms, a forest mushroom, has a high proportion of imports.

Korea enforced the Seed Industry Act in 1997 to protect new breeders in Korea, and joined the UPOV in 2002. By joining UPOV, Korea pays royalties when using foreign varieties, and domestic varieties exported abroad are also protected.

The market for shiitake mushrooms in the three Northeast Asian countries that are major producers and consumers of shiitake is rapidly changing. In the current situation, the development of a breeding marker can help protect domestically developed varieties by securing the differentiation of domestic varieties from foreign varieties.

Currently, the classification of shiitake mushroom varieties in Korea is made according to the shiitake mushroom characteristics investigation guidelines produced by the Korea Forest Service, but it can be more efficient if molecular markers are used. Types of molecular markers that have been developed and used so far include AFLP, RFLP, RAPD, SSR, STS, CAPS, and the like. Among them, CAPS is a marker that can detect SNP, a mutation in which one nucleotide sequence is substituted in the genome, or Indel, a mutation in which one or more nucleotide sequences are inserted or deleted. way to check Most CAPS markers are co-dominant and have the advantage that the results can be easily interpreted.

In shiitake mushroom sawdust cultivation, mushrooms can be harvested after a culture period of 120 days. Sanbaekhyang (application number: 2016-10), recently developed and distributed by the National Academy of Forest Sciences, has a 20 day shorter cultivation period than the existing shiitake mushroom varieties, so mushrooms can be harvested in 100 days.

Accordingly, the present inventors identified a CAPS marker capable of distinguishing sanbaekhyang, a cultivar developed in Korea, using the genomic sequence of shiitake mushroom, and confirmed that the cultivar can be easily distinguished using one restriction enzyme. The invention was completed.

Republic of Korea Patent Publication No. 10-2012-0103010 Republic of Korea Patent No. 10-1834565

Accordingly, it is an object of the present invention to provide a composition capable of effectively discriminating the shiitake mushroom variety Sanbaekhyang.

In addition, another object of the present invention is to provide a primer set for discrimination of shiitake mushroom varieties Sanbaekhyang.

Another object of the present invention is to provide a kit for identifying shiitake mushroom varieties Sanbaekhyang containing the composition.

Another object of the present invention is to provide a method for quickly and conveniently discriminating a shiitake mushroom variety Sanbaekhyang using the primer set.

Various problems to be solved in the present invention in the above are not limited thereto, but can be clearly understood by those of ordinary skill in the art to which the present invention pertains through the examples and claims to be described later. will be.

In order to achieve the above object, the composition for discrimination of shiitake mushroom cultivar Sanbaekhyang of the present invention includes an agent capable of detecting a single nucleotide polymorphism (SNP) marker at the 86th nucleotide position of SEQ ID NO: 1.

Here, the single nucleotide polymorphism (SNP) is characterized in that thymine (thymine) is deleted.

In addition, the agent capable of detecting the single nucleotide polymorphism (SNP) marker may be a primer set or probe that specifically binds to a polynucleotide sequence containing the single nucleotide polymorphism (SNP) marker.

Here, the primer set is characterized in that it has the nucleotide sequences of SEQ ID NOs: 3 and 4.

In the present invention, the composition may further include a restriction enzyme for cleaving a single nucleotide polymorphism (SNP) marker.

In addition, according to another embodiment of the present invention, the primer set for discriminating shiitake mushroom cultivar Sanbaekhyang may consist of nucleotides of SEQ ID NOs: 3 and 4.

Here, the primer set may amplify a cleaved amplified polymorphic sequences (CAPS) marker.

In addition, the kit for discriminating shiitake mushroom cultivar Sanbaekhyang according to another embodiment of the present invention may include the composition.

Here, the kit may further include a reagent and a restriction enzyme for performing an amplification reaction.

In addition, the restriction enzyme may be one or more of MseI, TaqI, SspI, NcoI, Hinfl and HhaI.

In addition, the method for determining the shiitake mushroom variety Sanbaekhyang according to another embodiment of the present invention comprises the steps of (a) isolating a nucleic acid molecule from a specimen; and, (b) identifying a single nucleotide polymorphism (SNP) marker at position 86 of SEQ ID NO: 1 from the isolated nucleic acid molecule.

Here, in step b), PCR is performed using the isolated nucleic acid molecule as a template and a primer set that specifically binds to a polynucleotide sequence including a single nucleotide polymorphism (SNP) marker to amplify the target sequence. , by treating the amplification product with a restriction enzyme, and detecting the fragment size from the resultant.

In addition, the primer set may have the nucleotide sequence of SEQ ID NOs: 3 and 4.

In addition, the restriction enzyme is characterized in that at least one of MseI, TaqI, SspI, NcoI, Hinfl and HhaI.

In addition, when the fragment size is 33 bp, 52 bp and 136 bp, it can be determined as a shiitake mushroom variety Sanbaekhyang.

According to the present invention as described above, it is possible to quickly and conveniently identify the shiitake mushroom variety Sanbaekhyang. Shiitake strains can be distinguished using the CAPS marker separated by PCR using the primers of the present invention. Accordingly, it is possible to distinguish between other varieties of shiitake mushrooms and sanbaekhyang, and to identify mushrooms cultivated from illegally distributed seeds, and to ensure the differentiation of this strain.

Since the CAPS marker checks whether the fragment is cut by treating the DNA fragment amplified by PCR with a restriction enzyme, unlike the case of the SSR marker, it is possible to quickly and easily check the result on an agarose gel without expensive size analysis equipment. Accordingly, it is possible to reduce the cost and time required to classify the variety, and since a high level of knowledge is not required to interpret the result, it is possible to more efficiently identify the variety.

The effects according to the present invention in the above are not limited to the above, and other effects of the present invention can be clearly identified by those of ordinary skill in the art through the examples and claims to be described later. can be understood

1 shows a polynucleotide nucleotide sequence including a shiitake mushroom cultivar Sanbaekhyang CAPS marker of the present invention and a marker nucleotide sequence capable of amplifying the same.
2 is a result of confirming the mutation by performing PCR and sequencing using the primer set of the present invention.
3 is a result of performing PCR using the primer set of the present invention, and analyzing the amplification product by treatment with HhaI, followed by oscillation on an agarose gel.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a CAPS marker capable of discriminating shiitake mushroom cultivar Sanbaekhyang and its use, and provides a biomarker for discriminating shiitake mushroom cultivar sanbaekhyang.

According to an embodiment of the present invention, a composition for discriminating shiitake mushroom variety sanbaekhyang includes an agent capable of detecting a single nucleotide polymorphism (SNP) marker at the 86th nucleotide position of SEQ ID NO: 1.

In the present invention, the term "CAPS (cleaved amplified polymorphic sequence) marker" refers to a SNP located at a restriction enzyme site among single nucleotide polymorphisms (SNPs). In an embodiment of the present invention, the CAPS marker can be developed as a candidate CAPS marker by selecting the SNP or indel located at the restriction enzyme (MseI, TaqI, SspI, NcoI, HinfI, HhaI) site among the specific SNPs of the shiitake mushroom variety Sanbaekhyang. have.

As used herein, the term “single nucleotide polymorphism (SNP)” refers to a DNA sequence that occurs when a single nucleotide (A, T, C or G) in the genome is different between members of a species or between paired chromosomes of an individual. means diversity. A single base can be changed (replaced), removed (deleted), or added (inserted) into the polynucleotide sequence. SNPs can cause changes in the translation frame. Single nucleotide polymorphisms may be contained in the coding sequence of a gene, in a non-coding region of a gene, or in intergenic regions between genes. SNPs in the coding sequence of the gene do not necessarily cause changes in the amino acid sequence of the target protein due to the degeneracy of the genetic code. SNPs that form the same polypeptide sequence are said to be synonymous (also called silent mutations), and SNPs that form different polypeptide sequences are said to be non-synonymous. Non-synonymous SNPs can be missense or nonsense, where a missense change results in another amino acid while a nonsense change forms an immature stop codon. SNPs that are not present in protein-coding sites can cause gene silencing, transcription factor binding, or non-coding RNA sequences. In the present invention, the single nucleotide polymorphism (SNP) may be one in which thymine is deleted, and more preferably, thymine at the 86th nucleotide position of SEQ ID NO: 1 may be deleted.

SEQ ID NO: 1 of the present invention is the sequence of the shiitake mushroom genome B17, SEQ ID NO: 2 is the RL-LE-133 sequence of the shiitake mushroom cultivar Sanbaekhyang of the present invention, when the two sequences are compared, the 86th nucleotide position of SEQ ID NO: 1 By confirming that the thymine is deleted, a CAPS marker for distinguishing this part was prepared (FIG. 2).

In the present invention, the term “agent capable of detecting a single nucleotide polymorphism (SNP) marker” refers to an agent used in a method for identifying the corresponding SNP contained in a sample, preferably RT-PCR, competitive RT- Targets used in methods such as PCR (Competitive RT-PCR), Real-time RT-PCR (RPA), RNase protection assay (RPA), Northern blotting, and gene chip assay It may be a primer, probe or antibody capable of specifically binding to a gene.

In the present invention, the agent capable of detecting the single nucleotide polymorphism (SNP) marker is a primer set or probe that specifically binds to a polynucleotide sequence containing a single nucleotide polymorphism (SNP) marker, and the primer set is SEQ ID NO: 3 And it may have a nucleotide sequence of 4.

In the present invention, the term “primer” refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow synthesis of the extension product to begin, and the specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use such as temperature and ionic strength. something to do. As a specific example, the specific length and sequence of the primer may be determined in consideration of various conditions such as guanine and cytosine contents (GC contents), GC arrangement, annealing temperature, and ionic strength.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to a gene or mRNA, oligonucleotide probe , single-stranded DNA probes, double-stranded DNA probes, RNA probes, etc. may be manufactured and labeled for easier detection.

In the present invention, the primer or probe may be chemically synthesized using a phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phossotriesters, phospho poroamidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

As a primer or probe used in the present invention, for example, a sequence that is completely complementary to the sequence including the SNP may be used, but is substantially complementary within a range that does not interfere with specific hybridization. An alternate sequence may also be used. Specifically, the probe used in the present invention includes a sequence capable of hybridizing to a sequence comprising 10-30 consecutive nucleotide residues comprising the SNP of the present invention. More specifically, the 3'-end or 5'-end of the probe has a base complementary to the SNP base. In general, since the stability of the duplex formed by hybridization tends to be determined by the match of the sequences at the ends, probes having a base complementary to the SNP base at the 3'-end or the 5'-end end If the parts do not hybridize, these duplexes can disintegrate under stringent conditions.

Suitable conditions for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985) can be determined with reference to the matters disclosed. Stringent conditions used for hybridization may be determined by controlling temperature, ionic strength (buffer concentration), and the presence of compounds such as organic solvents. These stringent conditions may be determined differently depending on the sequences to be hybridized.

In the present invention, the term "complementary" means that a primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under predetermined annealing or hybridization conditions, and is substantially complementary and completely complementary ( perfectly complementary), and specifically means completely complementary. As used herein, the term "substantially complementary sequence" used in relation to a primer sequence is not only a completely identical sequence, but also partially anneals to a specific sequence to function as a primer, and partially to a sequence to be compared. It is meant that sequences that do not match are also included.

Here, it contains a restriction enzyme site for cutting the specific SNP of shiitake mushroom variety Sanbaekhyang of the present invention. Accordingly, the restriction enzyme may use one of MseI, TaqI, SspI, NcoI, HinfI, and HhaI, preferably For example, it may be HhaI.

In addition, in another embodiment of the present invention, shiitake mushrooms of SEQ ID NO: 3 and SEQ ID NO: 4 specifically binding to 10 to 100 consecutive nucleotide sequences including the SNP site in order to discriminate the 86th SNP of SEQ ID NO: 1 Provides a primer set for identification of cultivar Sanbaekhyang. In the present invention, the primer set may amplify a cleaved amplified polymorphic sequences (CAPS) marker by PCR.

In addition, the present invention provides a kit capable of discriminating the shiitake mushroom variety Sanbaekhyang containing the composition.

The kit for discriminating shiitake mushroom cultivar of the present invention may further include a reagent and a restriction enzyme for performing an amplification reaction, wherein the restriction enzyme may use one or more of MseI, TaqI, SspI, NcoI, HinfI or HhaI. and preferably HhaI.

In the present invention, as a method for discriminating the mountain cedar, RT-PCR, competitive RT-PCR (Competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RPA; RNase protection assay) ), Northern blotting, gene chip analysis, and the like can be used.

Various amplification reactions have been reported in the art as a method for gene amplification in the present invention, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195,4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT- PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain ligase chain reaction (LCR) (17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP439,182), transcription-mediated amplification (TMA, WO) 88/10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase Consensus sequence primed polymerase chain reaction (CP-PCR), US Pat. Nos. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR), US Pat. Nos. 5,413,909 and 5,861,245 , nucleic acid sequence based amplification (NASBA), U.S. Pat. Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacemen t amplification (21, 22) and loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 09/854,317.

When the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer, a DNA polymerase, a DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

In an embodiment of the present invention, a method for determining a shiitake mushroom variety comprises the steps of (a) isolating a nucleic acid molecule from a specimen; and, (b) identifying a single nucleotide polymorphism (SNP) marker at position 86 of SEQ ID NO: 1 from the isolated nucleic acid molecule; through this, the shiitake mushroom variety Sanbaekhyang can be discriminated.

Here, in step b), PCR is performed using the isolated nucleic acid molecule as a template and a primer set that specifically binds to a polynucleotide sequence including a single nucleotide polymorphism (SNP) marker to amplify the target sequence, It can be made by treating the amplification product with a restriction enzyme and detecting the fragment size from the resultant, and the restriction enzyme used here may use one or more of MseI, TaqI, SspI, NcoI, HinfI or HhaI, preferably HhaI can

A primer set that can be used in the method for discriminating a shiitake mushroom variety of the present invention may have the nucleotide sequence of SEQ ID NOs: 3 and 4.

For example, after isolating genomic DNA from a shiitake mushroom variety to be analyzed, using the isolated genomic DNA as a template and using a primer set consisting of SEQ ID NOs: 3 and 4 to amplify a specific sequence including a CAPS marker, When the restriction enzyme in the amplification product detects the result obtained by processing HhaI, it can be determined that the size of the result is 33 bp, 52 bp, and 136 bp, which corresponds to the shiitake mushroom variety Sanbaekhyang.

According to the present invention as described above, the shiitake mushroom variety Sanbaekhyang can be quickly and conveniently identified, and the shiitake strain can be distinguished using the CAPS marker separated by PCR using the primer of the present invention. Accordingly, it is possible to distinguish between other varieties of shiitake mushrooms and sanbaekhyang, and to identify mushrooms cultivated from illegally distributed seeds, and to ensure the differentiation of this strain.

Since the CAPS marker provided in the present invention checks whether the fragment is cut by treating the PCR-amplified DNA fragment with a restriction enzyme, unlike the case of the SSR marker, it results quickly and easily on an agarose gel without expensive size analysis equipment. can be checked. Accordingly, it is possible to reduce the cost and time required to classify the variety, and since a high level of knowledge is not required to interpret the result, it is possible to more efficiently identify the variety.

Hereinafter, embodiments of the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are only for specifying the contents of the present invention, and the present invention will not be limited thereby.

<Example 1> Excavation of CAPS markers for identification of shiitake mushroom varieties Sanbaekhyang

In order to develop a CAPS (cleaved amplified polymorphic sequence) marker that can distinguish the shiitake cultivar Sanbaekhyang from other cultivars, 29 domestic shiitake cultivars (Table 1) and B17 (Shim et al., 2016) was used.

No. Cultivar name No. Cultivar name One Forest No. 7 16 Sanjo 501 2 summer scent 17 Sanjo 701 3 hyacinth 18 Sanjo 704 4 one hundred thousand 19 Sanjo 705 5 bountiful high school 20 Sanjo 706 6 Ceiling No. 1 21 Sanjo 707 7 Ceiling No.2 22 Sanjo 708 8 mountain cedar 23 Sanjo 709 9 Chujae No. 2 24 Sanjo 710 10 Gyunhong 135 25 be patient 11 incense 808 26 white pine 12 Sanjo 101 27 dewdrop 13 Sanjo 103 28 Estimate A6 14 Sanjo 110 29 Sanjo 302 15 Sanjo 111

_{The test varieties were washed with PBS buffer (NaCl 135mM, KCl 2.7mM, Na 2} HPO ₄ 4.3mM, KH ₂ PO ₄ 1.4mM) after filtering the shiitake mushroom mycelium cultured in PDB (potato dextrose broth) medium through Miracle. and remove the water. After freezing the dried mycelium in liquid nitrogen and grinding it finely with a mortar, genomic DNA was extracted using the GeneAll® GenEx™ Plant kit.

The identification of suitable SNPs and indels for the development of CAPS markers for the differentiation of shiitake mushroom varieties was conducted by comparing the whole genome information of test varieties analyzed using the Hiseq 2500 platform with the shiitake mushroom genome information analyzed by Shim et al. (2016). carried out. As a result of performing the alignment based on the nucleotide sequence information of the standard genome B17 of shiitake mushrooms, it was confirmed that a specific mutation was present in the cultivar of Sanbaekhyang. It was confirmed that this was deleted. This mutation occurs at 214449 of Scaffold19, and causes a frame shift in the 97th asparagine region of the short-chain dehydrogenase/reductase gene.

Therefore, the nucleotide sequence including the SNP was named “RL-LE-133” and used as a marker target sequence capable of distinguishing the shiitake mushroom variety Sanbaekhyang.

The flanking sequence was extracted from the identified SNP, and primers capable of amplifying this sequence were designed using Primer3Plus (http://biotools.umassmed.edu/cgi-bin/primer3plus/primer3plus.cgi). 2 is shown.

primer sequence primer sequence Target DNA sequence (SEQ ID NO: 1) Size(bp) RL-LE-133F
(Forward Primer)
SEQ ID NO: 3 GGAGACATGAGCAGCATTGA GGAGACATGAGCAGCATTGAgcaccaatacgcgcacaaatatattccgagagtttagaaaaatcccaaagggaggatatagaagcGTcgtctccaatatctccttgtcgagcaatgaattcagtcgttgagtctttgaattcctcctctcgcaatttagctgcctcctcagcaatTGcctcGGTTacagatgacatTGcctc 222 RL-LE-133R
(Reverse Primer)
SEQ ID NO: 4 GCTAAAGCAGGTGCTTCCAA

The marker nucleotide sequence amplified in the shiitake mushroom variety Sanbaekhyang by the PCR method using the primer sequence is shown in FIG. 1 .

When the specific restriction enzymes present in the marker sequence RL-LE-133 amplified from wild cedar was searched using dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html), The recognition site of the enzyme HhaI was confirmed and used as the restriction enzyme of the present invention (FIG. 2).

<Example 2> Identification of shiitake mushroom varieties Sanbaekhyang using CAPS markers

In order to confirm whether the CAPS marker sequence (RL-LE-133) of the present invention discriminates the shiitake mushroom variety Sanbaekhyang, genomic DNA was extracted from 29 domestic shiitake mushroom varieties and verification was performed. PCR was performed using 20 ng of DNA extracted from 29 domestic shiitake mushroom varieties. Specifically, for mushroom varieties, the mycelium of shiitake mushroom cultured in PDB (potato dextrose broth) medium was filtered through Miracle, followed by PBS buffer (NaCl 135mM, KCl 2.7mM, Na ₂ HPO ₄ 4.3mM, KH ₂ PO ₄ 1.4mM). Pour, rinse and drain the water. After freezing the dried mycelium in liquid nitrogen and grinding it finely with a mortar, genomic DNA was extracted using the GeneAll® GenEx™ Plant kit. After that, add 500ul of PL buffer to the mycelia transferred to the tube, heat at 65℃ for 10 minutes, and mix well using a pipette. After centrifugation at 13000 rpm for 1 minute, the supernatant is separated, transferred to a new tube, and 1/3 of the PP buffer is added and mixed well using a vortexer. After standing on ice for 5 minutes, centrifuge at 13000 rpm for 5 minutes. Separate the supernatant, transfer it to a new tube, add the same amount of PCI (phenol: Chloroform: isoamylalcohol = 25: 24: 1), and then turn over and mix. After centrifugation at 13000 rpm for 10 minutes, the supernatant is separated and transferred to a new tube, the same amount of isopropanol is added, and then inverted and mixed. After standing on ice for 10 minutes, centrifuge at 13000 rpm for 1 minute. After removing the supernatant, add 1 ml of 70% ethanol to slightly float the DNA pellet, and centrifuge at 13000 rpm for 1 minute. After removing the supernatant, centrifuge once more at 13000 rpm for 1 minute. After removing all remaining ethanol and drying the DNA pellet at room temperature for 5 minutes, 100ul of RE buffer was added to dissolve the DNA pellet. PCR was performed using the primers prepared in the present invention using 20 ng/μL of the extracted genomic DNA as a template. PCR was carried out by amplifying 35 cycles of 3 minutes at 95°C, 30 seconds at 95°C, 30 seconds at 56°C, and 20 seconds at 72°C, and then reacting at 72°C for 5 minutes.

Thereafter, the amplification product was treated with restriction enzyme HhaI, and the result was confirmed by agarose gel electrophoresis. Figure 3 shows the results of performing PCR using the primer sequence of the present invention and classification using the restriction enzyme HhaI. The classification of mountain baekhyang can be confirmed by the black band pattern.

As can be seen in FIG. 3 , the product of shiitake mushroom variety Sanbaekhyang was cut by restriction enzyme HhaI to show two bands with sizes of 33 bp, 52 bp, and 136 bp on an agarose gel, and the products of other shiitake mushroom varieties were One band not cleaved by restriction enzyme HhaI was shown. Through this, the primer sequence of the present invention developed a CAPS marker capable of distinguishing the shiitake mushroom cultivar Sanbaekhyang from other cultivars.

As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same spirit, and other degenerate inventions. However, other embodiments included within the scope of the present invention may be easily proposed. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the claims described later rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention. should be interpreted as

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Development of CAPS marker for discrimination of shiitake mushroom culivar Sanbaekhyang and use thereof <130> 20P97 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 222 <212> DNA <213> Lentinula edodes <400> 1 ggagacatga gcagcattga gcaccaatac gcgcacaaat atattccgag agtttagaaa 60 atcccaaagg gaggatatag aagcgtcgtc tccaatatct ccttgtcgag caatgaattc 120 agtcgttgag tctttgaatt cctctcgcaa tttagctgcc gcagcgtcca agaccgcatt 180 cctgcggcct acaatgatga tcttggaagc acctgcttta gc 222 <210> 2 <211> 221 <212> DNA <213> Lentinula edodes <400> 2 ggagacatga gcagcattga gcaccaatac gcgcacaaat atattccgag agtttagaaa 60 atcccaaagg gaggatatag aagcgcgtct ccaatatctc cttgtcgagc aatgaattca 120 gtcgttgagt ctttgaattc ctctcgcaat ttagctgccg cagcgtccaa gaccgcattc 180 ctgcggccta caatgatgat cttggaagca cctgctttag c 221 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RL-LE-133 Forward Primer <400> 3 ggagacatga gcagcattga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RL-LE-133 Reverse Primer <400> 4 gctaaagcag gtgcttccaa 20

Claims (15)

A composition for discriminating a shiitake mushroom variety Sanbaekhyang, comprising an agent capable of detecting a single nucleotide polymorphism (SNP) marker at the 86th nucleotide position of SEQ ID NO: 1.
According to claim 1,
The single nucleotide polymorphism (SNP) is a composition, characterized in that thymine (thymine) is deleted.
According to claim 1,
The agent capable of detecting the single nucleotide polymorphism (SNP) marker is a single nucleotide polymorphism (SNP) composition, characterized in that the primer set or probe that specifically binds to a polynucleotide sequence containing the marker.
4. The method of claim 3,
The primer set composition, characterized in that having the nucleotide sequence of SEQ ID NOs: 3 and 4.
According to claim 1,
The composition further comprises a restriction enzyme for cleaving a single nucleotide polymorphism (SNP) marker.
A primer set for discrimination of shiitake mushroom varieties Sanbaekhyang consisting of nucleotides of SEQ ID NOs: 3 and 4.
7. The method of claim 6,
The primer set is a primer set, characterized in that amplifying the CAPS (cleaved amplified polymorphic sequences) marker.
A kit for discriminating shiitake mushroom cultivar Sanbaekhyang comprising the composition according to any one of claims 1 to 5.
9. The method of claim 8,
The kit further comprises a reagent for performing an amplification reaction and a restriction enzyme for cleaving the SNP marker .
10. The method of claim 9,
The kit, characterized in that the restriction enzyme is HhaI.
(a) isolating a nucleic acid molecule from a specimen sample; and,
(b) identifying a single nucleotide polymorphism (SNP) marker at position 86 of SEQ ID NO: 1 from the isolated nucleic acid molecule;
12. The method of claim 11,
In step b), PCR is performed using the isolated nucleic acid molecule as a template and a primer set that specifically binds to a polynucleotide sequence including a single nucleotide polymorphism (SNP) marker to amplify the target sequence, then amplify A method, characterized in that the product is treated with a restriction enzyme for cleaving the SNP marker, and the fragment size is detected from the product.
13. The method of claim 12,
The method, characterized in that the primer set has the nucleotide sequence of SEQ ID NOs: 3 and 4.
13. The method of claim 12,
The method, characterized in that the restriction enzyme is HhaI.
15. The method of claim 14,
When the fragment size by the HhaI restriction enzyme treatment is 33 bp, 52 bp and 136 bp, the method characterized in that it is discriminated as a shiitake mushroom variety Sanbaekhyang.

Images