KR102287539B1 - Microsatellite markers for analysis of genetic diversity of Fraxinus chiisanensis and their using method - Google Patents

Abstract

The present invention relates to a microsatellite marker composition for analyzing genetic diversity of Fraxinus chiisanensis and a using method thereof, and more specifically, to a microsatellite maker composition for analyzing genetic diversity through individual identification of Fraxinus chiisanensis, to a kit for analyzing genetic diversity through individual identification of Fraxinus chiisanensis including the microsatellite marker composition, to a method for identifying the individuals of Fraxinus chiisanensis using the microsatellite marker composition, and to a method for analyzing genetic diversity in the population of Fraxinus chiisanensis using the microsatellite marker composition.

Description

Microsatellite markers for analysis of genetic diversity of Fraxinus chiisanensis and their using method

The present invention relates to a supersatellite marker composition for analyzing the genetic diversity of dynamite, and a method of using the same, and more particularly, to a supersatellite marker composition for genetic diversity analysis through individual identification of yeoljeolminae, the supersatellite marker composition A kit for genetic diversity analysis through individual identification of yeolgaensis, including a method for identifying individuals of yeoleumnae using the supersatellite marker composition, and a group of dandelions using the supersatellite marker composition It relates to a method for analyzing genetic diversity.

Fraxinus chiisanensis Nakai (Fraxinus chiisanensis Nakai) is a deciduous arboreous tree belonging to the genus Ash, and is a special species that grows only in Korea. It grows naturally only in Mt. Jiri, Mt. Deogyu, Mt. Naejang, Mt. Gaya, Mt. Cheonhwang and Mt. Baegun, including Mt. Minjuji in Chungcheongbuk-do. Previously, it was reported as a natural hybrid of oleracea and oleracea belonging to the genus Ash, but it was classified as an independent species in 2001 (Min Woong-gi, Jeon Jeong-il, and Jang Jin-seong. Taxonomic reconsideration of oleracea. Journal of the Korean Forestry Society. 90(3): 266-276). Flowers are androdioecious, with only male or bisexual flowers, without petals, but with sepals and bloom from mid-April to mid-May. The leaves are obovate, long oval, and 7 to 11 leaflets are attached, and the buds are dark brown or brown. Although it was used as a lumber resource until the 1960s, it was evaluated and classified as an 'endangered' species on the IUCN Red List in 2016 due to the observed decline in its native habitat (IUCN report, 2016).

Biodiversity includes genetic diversity, species diversity, and ecosystem diversity. Among them, genetic diversity is known to be the potential for species to adapt to changing environments. Therefore, it is important to preferentially preserve genetic diversity for biodiversity conservation. In addition, the genetic diversity of each species group is usefully used in the selection criteria for trees in the native habitat for the formation of a breeding group.

In order to respond to the entry into force of the Nagoya Protocol, which enforces biological sovereignty, there is a great need to preserve Korea's indigenous forest genetic resources. Also, the cypress tree grows up to 20 m tall and has great breeding value as a lumber resource for wood use. Therefore, there is a high need to develop a high-resolution (analytical stability and polymorphic informational) DNA marker and a genetic diversity evaluation method using the same in order to prepare the tree selection criteria for conservation and breeding group formation in consideration of the genetic diversity of sycamore.

Genetic diversity can be analyzed using DNA markers. A DNA marker is a molecular biological analysis technique that indicates the genetic difference of a species, and a PCR technique using a DNA polymerase has been mainly used. Among them, microsatellite is a region in which units consisting of 1 to 6 nucleotide sequences repeatedly appear in the genome of an organism. DNA marker technique. Because supersatellite markers are developed based on the sequencing information of biological species, it is reported that they provide significantly higher analysis stability compared to any primer (RAPD, AFLP, ISSR) technique that can be used without relying on sequencing information. (Lee Je-wan, Baek Seung-hoon, Hong Kyung-nak, Hong Yong-pyo, Lee Seok-woo, Ahn Ji-young. 2015. Development and Characterization of the Simple Sequence Repeat Marker for Pine Tree Chloroplasts. Journal of the Korean Forestry Society. 104(4):549-557).

However, a supersatellite marker with high analytical stability and polymorphic information, suitable for analyzing genetic diversity through individual identification, has not yet been developed.

Accordingly, the present inventors have continuously studied to develop a supersatellite marker with high analytical stability and polymorphic information as a genetic diversity evaluation technology for the preservation and breeding of tree tree selection criteria for the conservation and breeding of the genetic resource of Korea's special tree species. As a result, the present invention was completed.

Accordingly, it is an object of the present invention to provide a supersatellite marker composition for genetic diversity analysis through individual identification of dynamite.

Another object of the present invention is to provide a kit for genetic diversity analysis through individual identification of dynamite including the supersatellite marker composition.

Another object of the present invention is to provide a method for identifying an individual of dynamite using the supersatellite marker composition.

Another object of the present invention is to provide a method for analyzing genetic diversity in a mulberry population using the supersatellite marker composition.

In order to achieve the above object of the present invention, the present invention provides a supersatellite marker composition for genetic diversity analysis through individual identification of dynamite.

In the present invention, the supersatellite marker composition includes a primer set of SEQ ID NOs: 1 and 2 specific for FC_004, a supersatellite marker.

The supersatellite marker composition of the present invention comprises a primer set of SEQ ID NOs: 3 and 4 specific for FC_012, a supersatellite marker, a primer set of SEQ ID NOs: 11 and 12 specific for FC_043, a supersatellite marker, and a supersatellite marker specific for FC_171. Primer sets of SEQ ID NOs: 15 and 16, primer sets of SEQ ID NOs: 7 and 8 specific for FC_036, a supersatellite marker, primer sets of SEQ ID NOs: 17 and 18, specific for FC_172, a supersatellite marker, specific for FC_038, a supersatellite marker Selected from the group consisting of primer sets of SEQ ID NOs: 9 and 10, primer sets of SEQ ID NOs: 13 and 14 specific to FC_055, a supersatellite marker, and primer sets of SEQ ID NOs: 5 and 6, specific to FC_030, a supersatellite marker It further comprises one or more primer sets.

Most preferably, the supersatellite marker composition of the present invention comprises a primer set of SEQ ID NOs: 1 and 2, a primer set of SEQ ID NOs: 3 and 4, a primer set of SEQ ID NOs: 5 and 6, a primer set of SEQ ID NOs: 7 and 8, SEQ ID NO: and a primer set of 9 and 10, a primer set of SEQ ID NO: 11 and 12, a primer set of SEQ ID NO: 13 and 14, a primer set of SEQ ID NO: 15 and 16, and a primer set of SEQ ID NO: 17 and 18.

The present inventors have secured the genetic information of the sycamore tree, searched the supersatellite region based on this genetic information, and designed a primer, so that 9 kinds of supersatellites capable of analyzing the genetic diversity through individual identification of the dynamite, that is, FC_004 , FC_012, FC_030, FC_036, FC_038, FC_043, FC_055, FC_171, and FC_172 were excavated, and nine primer sets (SEQ ID NOs: 1 to 18) specifically amplifying these supersatellites were discovered (Table 1 and Table 2). ).

In the present invention, the term 'microsatellite' refers to a simple sequence repeat (SSR) region having a structure in which 1 to 6 nucleotide sequences are repeated.

Since the number of repeats of the supersatellite repeat unit may vary depending on the individual or species of a supersatellite, a unique sequence on the genome among base pairs of both base pairs of the repeating portion of the supersatellite is designed as a primer sequence, PCR amplification is performed, and the product obtained An individual or species can be identified by comparing the size of

In the present invention, the term 'marker' may refer to a supersatellite or a primer set capable of amplifying the supersatellite that indicates polymorphism caused by the presence of a mutation in the number of repeats of the supersatellite repeat unit to enable individual identification.

As used herein, the term 'primer' refers to a nucleic acid sequence having a short free 3' terminal hydroxyl group, capable of base pairing with a complementary template, and serving as a starting point for template strand copying. means sequence. A 'primer pair' refers to a combination of a forward primer and a reverse primer.

In the present invention, the primer can initiate DNA synthesis in the presence of four different deoxynucleotides and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. In addition, the base sequence of the primer can be modified using a label that can directly or indirectly provide a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, and biotin.

The size of alleles amplified by the supersatellite primer set according to the present invention ranges from 170 to 302 bp, and the number of alleles is 5 to 38 (Tables 1 and 2).

According to the examples of the present invention, when analyzing using the primer set specific for the supersatellite marker according to the present invention, it was possible to identify the sycamore individuals as unique genotypes (Tables 3 to 8).

According to another object of the present invention, the present invention provides a kit for genetic diversity analysis through individual identification of dynamite including the supersatellite marker composition.

The kit of the present invention may be a PCR kit. The kit may further include a DNA polymerase, deoxynucleotide (dNTP), a PCR buffer, a test tube, an appropriate container, and the like. In addition, a primer set specific for a gene used as a quantitative control may be included.

The kit of the present invention may further comprise a user's guide describing optimal conditions for conducting the reaction. A handbook is a printout explaining how to use the kit, eg, how to prepare a PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

In addition, according to another object of the present invention, the present invention provides a method for identifying an individual of dynamite using the supersatellite marker composition.

Specifically, the method of identifying the individual of the present invention

i) isolating the genomic DNA from the biological sample of the sycamore individual;

ii) performing a PCR reaction using the genomic DNA and the supersatellite marker composition; and

iii) analyzing the amplification product of the PCR reaction.

In addition, according to another object of the present invention, the present invention provides a method for analyzing genetic diversity in a sycamore population using the supersatellite marker composition.

Specifically, the method of analyzing the genetic diversity of the oleander tree population of the present invention is

i) isolating genomic DNA from the biological sample of each individual of the sycamore population;

ii) performing a PCR reaction using the genomic DNA and the supersatellite marker composition;

iii) analyzing the amplification product of the PCR reaction; and

iv) calculating and comparatively analyzing the genetic diversity index for each group of dynamite;

includes

In the present invention, a 'biological sample' refers to a sample containing genomic DNA of oleracea, specifically, the biological sample may be leaves, stems, roots, seeds, and parts thereof, but is not limited thereto. does not

A method for isolating genomic DNA from a biological sample may use a method known in the art, and is not particularly limited to a specific method.

PCR reactions include Polymerase Chain Reaction, multiplex Polymerase Chain Reaction, multiplex PCR, competitive Polymerase Chain Reaction, real-time Polymerase Chain Reaction), Real-time Quantitative Polymerase Chain Reaction, DNA chips, or loop-mediated isothermal amplification methods known in the art may be used.

For the analysis of the amplification product of the PCR reaction, methods known in the art such as gel electrophoresis, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement, or phosphorescence measurement may be used, but are not limited thereto. The gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the marker with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence can be measured using a fluorometer. there is. In addition, the radioactive measurement method includes ^{adding a radioactive isotope such as 32} P or ³⁵ S to the PCR reaction solution during PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or a liquid scintillation counter. (Liquid scintillation counter) can be used to measure radioactivity.

In the present invention, the 'genetic diversity index' refers to the number of alleles (number of Allele, A ), the effective number of Allele ( A _e ), the observed heterozygosity ( H _o ), and the degree of heterozygosity. Including expected heterozygosity ( H _e ).

By using the primer set specific for the Hyolexinosa supersatellite marker according to the present invention, high affinity can be secured in the binding step, so the stability of the assay is very high, and various alleles of the Hyalesthenia can be searched for. Tree objects can be identified.

In addition, if the supersatellite marker composition according to the present invention is used, the genetic diversity index for each group of Dyedulenus can be calculated and used by comparing and analyzing the genetic diversity between groups. As a result, it will be possible to use it as a scientific certification technology to select genetically excellent individuals for the establishment of a conservation strategy considering the genetic diversity of sycamore cypress and the selection of tree trees to form a breeding group.

1 is a graph showing the results of polymorphism analysis (allele comparison) of supersatellite marker FC_055 according to the present invention (the horizontal axis is the size of the allele, and the peak is the amplified DNA product (allele)).

The present invention is further illustrated by the following examples. These examples are for the purpose of illustrating the present invention, and the scope of the present invention should not be limited thereto.

Example 1. Preparation of primers for selection of hypersatellite markers and amplification of supersatellite markers

In order to analyze the genetic information of banyan tree, a genomic DNA library was constructed by extracting the DNA from the leaves of the dandelion quince growing wild in the Jirisan area, a large-scale community.

Specifically, 1 μg/μl of DNA was cut into any size using a cleaving enzyme (Fragmentase® (NEB)). The end was repaired in the cleaved product using the SPARK DNA sample Prep Kit, and a specific adapter for ion proton sequencing was bound. Using beads, the size of the DNA fragment was selected to be 230 to 270 bp, and PCR amplification was performed. The amplified product was subjected to sequencing using Ion Proton (Thermo Fisher Scientific) next-generation sequencing equipment.

By assembling the nucleotide sequence obtained above, contigs of 500 bp or more were selected, and the supersatellite region was searched using the MSATCOMMANDER program. Thereafter, nucleotide sequence similarity analysis was performed using BLAST.

A primer pair was designed to amplify the PCR product to include the supersatellite region by using the Primer3 program for the contig containing the supersatellite region. As for the primer set, 200 primer sets were designed from a total of 255,317 contigs, and 9 types of supersatellite regions (locus) where polymorphism between individuals of oleracea were observed and 9 sets of primers specific for them were selected, and the results are shown in Table 1 shown in

Locus Primer sequence (F: forward primer,
R: reverse primer) (5'-3') SEQ ID NO: repeat sequence motif
(Repeat motif) The observed allele size range (Size
range (bp)) FC_004 F: TCCCAACACAAAAGAGTTTTAGC One (GA)24 214-296 R: GAACGAGTTTAGCAAGGGATTG 2 FC_012 F: TCAACCTTCGCCTCAGAAAG 3 (AG)17 227-285 R: AGCCAAGGAAAGTCATGCAG 4 FC_030 F: AACTAGGCAAACGTGCATTG 5 (TA)6 188-194 R: GCTTTAGGCAACGGTTTCTTC 6 FC_036 F: GCGGACCTTCCTTATTCATTC 7 (CA)8 186-264 R: AACCCAATGCTCACATCATTC 8 FC_038 F: AAGTGGTCTCGTGCGATTTC 9 (CT)8 226-264 R: CTCATGAAGTGTTGGCGAAG 10 FC_043 F: GCAACCCGGTATCCATTG 11 (TC)8 240-290 R: TAGCGAGTCTCGATTTCCAC 12 FC_055 F: TCCACCACTGTGACCTGATG 13 (TG)10 210-230 R: CACAAAGGGCACACACAAAG 14 FC_171 F: AAGCGTCTGGTAACGAAAGTG 15 (AAT)15 170-233 R: TTCCCTTGAGCGAATAAAGC 16 FC_172 F: AACAAGTCGGCTTGATCGAC 17 (AAT)12 236-302 R: ATCTTCACTGCGGCAATCAG 18

As shown in Table 1, all of the primer sets amplified the supersatellite region (locus) composed of 2-3 nucleotide repeat units, and the size of the supersatellite region (amplification product) was in the range of 170 to 302 bp with each supersatellite. It varied according to the primer pair.

As shown in Table 1, the 9 kinds of supersatellite markers according to the present invention were different from each other because the size range of the allele to be amplified (the size range of the locus) was specific, thereby exhibiting polymorphism.

In addition, the number (type) and size (bp) of alleles amplified by the supersatellite primer set (9 pairs) discovered above were analyzed, and the results are shown in Table 2.

Supersatellite markers Primer set allele
number Allele size (bp) FC_004 SEQ ID NOs: 1,2 38 214 216 218 220 222 224 230 232 234 236 238 240 242 244 246 250 252 254 256 258 260 262 264 266 268 270 272 274 276 278 280 282 284 286 288 290 292 296 FC_012 SEQ ID NO: 3,4 25 227 239 241 243 245 247 249 251 253 255 257 259 261 263 265 267 269 271 273 275 277 279 281 283 285 FC_030 SEQ ID NO: 5,6 4 188 190 192 194 FC_036 SEQ ID NO: 7,8 19 186 188 192 234 236 238 240 242 244 246 248 250 252 254 256 258 260 262 264 FC_038 SEQ ID NOs: 9,10 10 226 248 250 252 254 256 258 260 262 264 FC_043 SEQ ID NO: 11,12 22 240 250 252 254 256 258 260 262 264 266 268 270 272 274 276 278 280 282 284 286 288 190 FC_055 SEQ ID NO: 13,14 9 210 214 216 218 220 222 226 228 230 FC_171 SEQ ID NOs: 15,16 20 170 173 179 182 185 188 191 194 197 200 203 206 209 212 215 218 224 227 230 233 FC_172 SEQ ID NO: 17,18 19 236 248 251 254 257 260 263 266 269 272 275 278 281 284 287 290 293 296 302

As shown in Table 2, the size of the alleles amplified by each of the nine primer sets was different, and the number of alleles varied from 4 to 38. The number of allele types (number) identified by the FC_004 primer pair was 38 the most, and the FC_030 primer pair had the smallest number of four.

Example 2. Hypersatellite markers for identification and analysis

We searched the Minjujisan, Jirisan, Deogyusan, Cheonhwangsan, Baegunsan, and Naejangsan clusters distributed in Korea, and found 27, 36, 30, 30, 16 and 30 yeoljeolbin individuals (total of 169). After extracting and isolating a leaf sample of each individual), PCR analysis was performed using each of the 9 primer sets in Table 1 using the DNA as a template.

Specifically, each individual DNA (template DNA) 20ng, 1x reaction buffer _{, 2.5mM MgCl 2} , 0.2mM dNTP, 0.04μM FAM fluorescent M13(-19) sequencing primer, 0.2 μM each forward direction in Table 1 And the reverse primer set mixture, and 0.1 U of Taq DNA polymerase (Biofact) were mixed, and distilled water was added so that the final reaction amount was 15 μl, followed by PCR reaction. PCR reaction conditions were repeated 5 times each in the order of 94 °C for 30 seconds, 65 °C for 1 minute, 72 °C for 1 minute after performing initial DNA modification at 94 °C for 5 minutes, transformation, primer binding, and synthesis reaction in succession. However, during repetition, the primer binding temperature was decreased by 1°C from 65°C to 60°C. Thereafter, the sequence was repeated 30 times in the order of modification, primer binding, and synthesis reaction at 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 1 minute. Finally, a final synthesis step was performed at 72° C. for 7 minutes. PCR amplification products were fractionated using ABI 3730 xl equipment and analyzed using GeneMapper version 5.0 software, and the results are shown in FIG. 1 and Tables 3 to 8.

Baegunsan
16 objects genotype Baiyun 1 216,236,241,243,285,190,192,244,250,254,256,250,252,260,264,258,260,214,216,170
,185,194,215,254 Baiyun 2 216,232,242,241,247,279,190,246,250,252,252,264,258,268,280,214,218,185,188,191
,200,266 Baiyun 3 216,238,246,245,247,249,255,190,192,246,250,252,252,260,264,258,270,276,210,214
,170,182,188,191,203,209,248 baekun 4 216,254,241,245,247,265,190,194,250,254,256,258,252,260,264,258,214,216,218,222
,188,200,269 Baiyun 5 216,232,241,247,190,192,250,254,256,258,252,254,260,264,258,214,218,222,182,185
,191,215,266,272 Baiyun 6 216,274,239,245,259,271,190,250,254,256,260,252,256,260,264,254,258,272,214,182
,188,200,203,248 Baiyun 7 216,240,244,256,247,190,192,244,246,250,256,258,260,264,258,214,216,170,188,266 Baiyun 8 246,250,258,271,273,190,192,248,252,252,256,260,264,250,254,274,214,220,170,188
,272,302 Baiyun 9 216,218,263,192,244,254,256,250,252,260,258,214,218,170,191,194,209,248 Baiyun 10 218,247,249,263,190,192,244,254,252,260,264,258,214,170,191,194,197,251,266 baekyun 11 216,232,274,280,249,273,192,250,256,258,254,260,264,258,214,218,182,185,188,254
,293 Baegun 12 216,238,241,245,192,252,256,258,260,264,258,266,214,218,222,170,188,191,203,215
,251,263,269,281 Baiyun 13 216,244,245,267,190,192,194,250,254,258,252,260,264,254,258,214,218,220,170,182
,191,251,254,266,290,302 Baiyun 14 216,238,241,245,192,252,256,258,260,264,258,266,214,218,222,170,188,191,203,215
,251,263,269,281 Baegun 15 216,218,244,246,247,190,192,244,250,254,248,260,264,258,214,218,185,188,263 baekun 16 216,245,247,190,192,246,250,264,258,214,218,220,182,188,197,0

Cheonhwangsan
28 objects genotype Emperor 1 216,218,238,245,249,269,190,192,248,256,260,264,258,268,210,218,220,185,188,191
,206,251,290 Emperor 2 216,222,238,255,0,244,250,254,252,260,264,258,214,226,182,185,197,254,266 Emperor 3 216,222,250,256,243,190,192,250,256,258,252,264,258,270,216,218,226,182,188,266 Emperor 4 216,218,222,269,190,192,250,256,258,252,260,264,258,216,226,182,188,191,197,251
,287 Emperor 5 216,250,256,0,190,192,244,250,252,264,258,270,218,170,188,284,287 Emperor 6 216,218,240,250,254,,239,241,190,192,244,250,254,256,252,256,264,258,214,182,
185,251 Emperor 7 216,238,249,192,244,254,258,260,264,258,288,214,218,220,170,182,251,266,287 Emperor 8 216,222,249,273,190,240,246,250,256,252,260,264,258,214,218,182,188,191,206,266 Emperor 9 216,218,238,288,241,279,190,192,256,258,260,264,258,268,214,218,170,188,269,302 Emperor 10 216,218,238,245,190,192,248,250,254,252,260,264,250,254,214,218,170,185,188,251
,302 Emperor 11 216,218,274,282,245,249,190,192,246,254,252,260,264,258,266,214,218,185,191,251
,266,272, Emperor 12 216,218,254,249,251,190,192,256,258,252,256,260,264,250,254,214,222,185,194,203
,266 Emperor 13 216,218,238,0,190,238,244,250,256,252,260,264,258,268,214,218,182,185,197,248,
278 Emperor 14 216,258,241,257,192,250,254,256,258,252,256,260,264,258,268,214,197,212,266,281
,290 Emperor 15 216,218,241,247,249,190,192,238,244,250,252,264,258,214,206,215,266 Emperor 16 216,218,240,241,243,245,247,190,244,250,254,260,262,258,260,270,286,214,218,222
,170,185,281 Emperor 17 216,240,256,249,190,192,244,250,252,264,258,214,216,182,206,254 Emperor 18 216,218,280,241,245,257,190,194,244,250,254,252,260,264,258,214,216,218,170,182
,185,200,263,266,275 Emperor 19 216,222,236,240,276,245,190,192,250,256,252,256,260,262,264,258,270,214,185,197
,200,212,260,269,290 Emperor 20 216,236,242,257,190,192,246,250,252,260,264,258,266,214,182,185,251,275 Emperor 21 216,218,268,247,255,281,190,192,250,254,260,262,258,214,182,188,200,206,251,266
,272 Emperor 22 216,218,249,251,261,283,190,192,238,244,250,252,260,262,264,258,214,170,182,185
,188,194,206,272 Emperor 23 216,218,264,241,247,267,190,192,238,244,256,258,262,258,214,220,194,197,251,263
,272,290 Emperor 24 216,264,241,247,190,192,250,254,256,258,264,258,214,220,188,191,194,197,251 Emperor 25 216,240,244,264,241,267,190,192,256,258,252,262,264,258,268,214,216,220,197,251
,254,263,266 Emperor 26 216,240,264,247,251,257,261,190,242,246,250,252,252,256,262,258,218,182,185,194
,272 Emperor 27 216,222,234,247,257,192,250,256,260,262,264,250,252,254,264,210,214,218,170,185
,188,194,254,263 Emperor 28 216,218,244,247,249,192,244,250,256,256,264,254,258,218,222,170,182,197,266

Deogyusan
30 objects genotype Duckyu 1 0,0,0,188,0,0,0,0,266 Duckyu 2 216,276,247,251,255,190,192,250,256,252,262,258,0,185,188,197,266 Duckyu 3 216,218,242,239,245,249,190,192,244,246,250,252,254,258,252,258,264,258,274,282
,0,170,182,185,260 Deogyu 4 214,216,236,242,245,190,192,250,256,258,252,258,264,258,218,182,185,188,197,266 Deogyu 5 216,240,250,245,247,271,190,244,250,250,256,260,258,214,170,182,266 Deogyu 6 216,242,0,190,192,234,254,258,254,264,258,270,284,214,218,170,182,197,203,263 Deogyu 7 216,242,260,0,190,192,234,250,254,258,252,254,264,258,264,276,214,218,182,188,
197,263 Deogyu 8 216,242,245,247,190,246,250,254,252,264,250,266,282,214,218,170,182,185,191,203
,251,254,266 Deogyu 9 216,286,0,190,250,262,258,270,284,214,218,170,182,191,197,203,,254,275 Duckyu 10 216,218,244,266,251,190,192,244,250,254,256,252,260,264,258,260,270,216,182,185
,191,254 Deogyu 11 216,218,244,245,247,190,192,244,250,254,256,262,260,264,258,286,214,182,194,254
,269 Deogyu 12 216,218,236,249,261,190,192,244,252,254,258,264,258,266,278,214,218,170,182,185
,218,254 Deogyu 13 216,244,270,0,192,250,256,258,252,260,262,258,214,218,185,188,254,266 Dukyu 14 0,0,0,0,0,0,0,0,254,257 Deokyu 15 216,270,247,257,190,192,250,252,254,252,260,262,258,226,170,188,197,209,254,269 Deokyu 16 218,280,286,241,247,249,190,192,194,248,254,256,260,264,258,214,218,185,194,209
,263,272,284 Deogyu 17 0,239,245,247,257,190,242,248,252,264,258,214,218,222,182,194,197,269 Deogyu 18 216,218,232,247,257,259,192,250,254,258,252,256,260,264,258,276,214,216,170,188
,194,197,266,275 Dukyu 19 218,232,249,273,190,192,250,254,262,258,290,214,182,185,197,269,272 Duckyu 20 216,218,245,247,192,254,256,260,262,258,276,214,216,170,188,194,197,266,275,284 Deokyu 21 244,245,247,255,190,192,244,250,252,262,258,282,214,218,170,194,197,254,269 Deokyu 22 216,218,234,236,242,,241,257,259,273,190,192,250,254,256,256,260,264,258,214,
216,218,185,194,209,269 Deogyu 23 236,240,244,250,266,0,190,250,254,256,252,260,264,250,254,214,216,218,170,182,
188,191,266 Deogyu 24 216,232,256,257,269,190,250,254,256,256,262,250,254,278,214,218,222,182,194,281 Deogyu 25 218,240,242,244,247,0,248,250,256,252,256,264,258,-9,185,188,191,194,266 Deogyu 26 216,254,245,247,257,259,192,250,252,252,260,264,258,214,170,185,194,206,251,269
,272 Deokyu 27 216,238,264,245,257,277,190,250,254,256,250,254,258,258,216,218,185,188,203,263
,266 Deogyu 28 240,252,256,245,251,257,190,192,250,254,256,262,252,256,260,264,258,270,272,214
,185,188,194,266,296 Deokyu 29 216,264,245,261,190,250,254,256,252,256,264,258,214,216,182,185,188,275 Deogyu 30 216,234,238,240,241,251,259,190,244,250,256,260,264,258,0,170,188,197,203,266,
269,275

Jirisan
36 objects genotype geography 1 216,234,251,190,192,238,248,252,252,264,258,0,170,182,185,269 geography 2 216,230,240,245,247,190,192,240,250,256,258,262,264,254,258,270,214,218,170,182
,188,191,194,248,251,269 geography 3 216,234,266,241,245,247,251,190,192,244,250,256,258,256,260,264,254,258,282,214
,228,182,185,197,254 geography 4 218,238,242,264,245,247,190,192,248,250,258,260,264,258,282,218,182,188,191,194
,224,254 geography 5 216,218,242,264,245,247,190,192,240,248,250,256,226,254,260,264,258,288,216,218
,173,182,185,188,224,254,263,266,275, geography 6 216,269,271,0,250,254,252,260,264,258,264,214,220,182,185,188,248 geography 7 216,232,258,245,247,257,261,190,244,250,252,264,254,258,214,216,218,170,182,185
,188,206,269 Geography 8 216,242,241,265,269,190,192,250,256,250,254,264,258,214,218,170,188,197,269 geography 9 216,218,254,241,247,190,192,248,250,254,256,260,264,258,214,216,220,170,185,188
,200,251,275 geography 10 216,242,252,258,269,190,248,250,258,252,254,264,258,272,214,220,188,191,197,254
,266 geography 11 216,242,243,281,190,192,246,250,254,256,252,264,254,258,214,170,194,203,254,275 geography 12 216,218,260,292,239,245,247,192,244,248,256,260,264,254,258,214,218,170,194,197
,200,251,263,269 geography 13 216,218,222,254,241,245,247,190,192,244,250,254,260,264,258,214,216,170,185,188
,197,278 geography 14 216,240,246,272,245,269,190,192,250,252,260,264,258,266,214,218,170,182,191,254
,269,281 geography 15 216,218,222,238,247,257,269,190,192,248,250,252,260,264,258,214,194,206,251,284 geography 16 216,241,257,190,248,250,252,254,256,262,264,258,268,214,182,194,263,269 geography 17 216,236,240,256,264,241,257,271,190,244,258,252,256,264,258,262,214,188,200,203
,251,266 Geography 18 216,266,296,247,257,190,192,250,256,258,252,260,264,254,258,282,214,218,170,182
,188,194,197,266 geography 19 216,240,239,190,192,244,254,256,258,226,252,260,264,258,268,214,218,170,182,200
,260 geography 20 216,240,254,282,245,247,190,192,244,250,252,256,252,260,264,258,214,218,170,203
,254,269,275 geography 21 216,218,244,245,190,192,250,254,258,260,264,258,284,214,218,170,191,194,266 geography 22 216,218,242,260,243,271,273,190,192,244,248,250,256,252,260,264,258,214,216,170
,194,209,254,266,269 geography 23 216,234,240,260,247,249,192,250,254,258,252,260,264,258,210,214,218,170,179,185
,188,191,254 Geography 24 218,236,250,250,256,241,257,190,248,250,252,254,256,260,264,258,210,214,218,170
,191,200,281 geography 25 ,216,250,278,245,247,190,192,244,250,254,256,258,252,254,260,264,258,268,214,
218,182,188,191,251,266 Geography 26 216,234,241,255,257,190,250,254,258,250,256,260,258,218,220,170,182,191,254,275 geography 27 216,218,234,282,241,255,190,192,250,254,256,258,252,264,258,218,191,218,254,275
,278 Geography 28 216,250,262,241,245,249,190,192,246,250,252,260,264,258,288,220,170,185,188,200
,254,278 geography 29 216,222,252,266,245,257,192,248,252,256,226,260,264,258,214,188,191,197,251,269
,281 Geography 30 216,252,254,256,247,257,275,190,192,194,250,256,252,260,262,254,258,218,170,182
,188,227,251,266 geography 31 216,218,286,245,257,190,192,250,252,256,252,264,254,258,214,185,191,248 Geography32 216,251,273,190,244,248,250,256,252,256,264,258,260,218,220,182,188,191,263,272 geography33 216,271,190,244,250,256,252,262,264,258,214,218,170,182,185,188,206,254,266 geography 34 216,218,240,262,241,190,244,250,254,256,262,256,258,272,214,170,182,191,194,248 geography 35 ,216,224,240,250,266,241,192,250,252,260,262,264,258,266,214,222,182,197,248 geography 36 216,280,241,245,251,271,190,192,244,250,254,258,252,258,264,,280,218,220,170,
197,218,248,266

Mt. Minju
27 objects genotype democracy 1 216,222,249,257,190,192,194,244,250,254,256,256,260,264,258,214,216,220,200,
215,263 democracy 2 0,249,0,188,0,0,0,0,236,263,266 democracy 3 0,0,0,0,0,0,0,0,0,236,263,266 democracy 4 216,244,227,247,265,190,192,246,250,252,254,264,258,266,214,222,182,191,194,
254,266, democracy 5 0,0,0,0,0,0,0,182,263,266 democracy 6 0,0,0,0,0,0,0,0,236,266 democracy 7 0,0,0,186,192,0,0,0,0,263,266 democracy 8 216,245,190,192,238,250,254,258,226,252,264,250,252,254220,170,182,188,194,203
,257,269,281 democracy 9 216,218,244,258,280,257,192,238,250,258,252,262,264,258,288,214,216,218,170,
179,185,188,200,278,281 democracy 10 216,218,268,251,190,248,250,254,262,252,260,264,256,284,214,218,170,182,197,
266 democracy 11 216,222,236,244,290,227,239,190,192,238,244,254,252,264,256,258,270,216,170,
179,182,185,188,197,266 democracy 12 216,218,240,241,243,249,257,190,192,250,254,258,252,264,258,214,218,170,185,
194,266 democracy 13 216,244,290,245,249,192,244,250,256,264,258,218,220,170,179,191,194,197,266,
287 democracy 14 216,218,238,244,290,251,190,192,248,262,252,264,256,258,284,214,218,182,188,
191,197,200,266 democracy 15 216,218,238,290,251,192,248,262,260,264,258,214,216,170,182,188,191,200,266 democracy 16 216,238,247,253,285,190,192,238,250,256,262,264,258,214,216,170,188,191,260 democracy 17 216,244,258,268,251,190,192,244,246,250,262,264,258,284,214,218,170,179,182,
188,191,266 democracy 18 ,216,234,227,190,192,250,254,256,252,264,254,258,214,218,188,194,200,248,278 democracy 19 216,218,246,241,249,192,238,244,250,252,252,262,258,214,218,170,182,185,194,
209,,263,275 democracy 20 216,244,250,264,245,192,250,254,258,252,260,264,258,272,214,216,218,170,182,
266 democracy 21 216,238,278,247,192,236,240,246,250,254,,258,262,264,258,272,214,216,218,170,
182,209,248 democracy 22 216,218,238,250,257192,244,250,258,,256,258,262,264,258,260,272,214,216,218,
170,173,182,209,248 democracy 23 218,288,247,257,273,194,250,254,258,252,260,264,258,214,216,182,254 Democracy 24 216,218,232,284,241,263,190,194,254,258,252,264,258,276,218,222,170,269 democracy 25 216,245,190,192,250,256,258,260,264,254,258,214,220,188,194,197,203,257,266,
275,281, democracy 26 242,246,249,190,250,256,260,264,258,214,218,182,188,191,206,209,,254 democracy 27 216,0,0,256,0,0,0,0,236,266

Naejangsan
30 objects genotype Built-in 1 216,222,245,257,190,192,250,256,260,250,254,214,170,188,200,230,254,266 Built-in 2 216,245,257,192,250,256,260,264,254,258,214,170,200,230,263 Built-in 3 216,222,256,241,245,192,244,248,250,252,262,240,214,182,200,206,212,266 Built-in 4 216,218,245,247,190,192,244,250,258,260,262,258,214,216,220,182,188,194,266,
275,287 built-in 5 216,222,244,241,245,192,250,258,260,258,214,216,170,188,191,200,263,266,284 Built-in 6 216,218,252,274,245,249,190,192,250,264,256,260,264,258,216,188,197,200,284 Built-in 7 216,222,274,245,190,192,250,256,260,258,216,170,182,188,200,263,266,284 Built-in 8 216,218,241,245,190,192,250,256,260,264,258,214,216,182,188,197,200,263,266,284 built-in 9 216,222,241,245,192,250,256,252,260,264,258,216,218,188,194,200,218,266,284 Built-in 10 218,222,236,268,241,245,247,249,190,192,244,248,250,,252,256,260,262,264,258,
282,214,216,220,170,194,197,200,281 built-in 11 216,218,222,245,192,250,252,260,264,258,214,218,170,188,191,200,254,266,284 Built-in 12 218,234,250,252,254,241,249,190,192,250,256,260,262,264,258,214,218,209,218,248 built-in 13 216,222,274,245,247,192,250,258,252,256,260,264,258,214,216,218,170,188,200,284 built-in 14 216,218,222,238,245,247,190,192,250,260,264,258,216,188,230,263,287 built-in 15 216,218,238,250,247,251,192,250,256,258,256,260,264,258,276,0,170,185,194,197,
209,230,266 Built-in 16 0,0,0,0,0,0,0,,0,266 Built-in 17 216,241,247,249,190,192,250,254,258,252,260,264,258,214,188,194,200,266 built-in 18 216,218,220,245,267,192,,250,256,258,260,262,258,214,220,182,191,200,266 built-in 19 ,216,252,241,247,249,190,192,244,254,256,252,260,264,258,214,182,188,194,200,
266 built-in 20 216,218,242,246,245,249,267,190,192,246,250,252,254,,,252,260,264,258,214,188,
194,200,284 Built-in 21 216,218,222,238,246,,241,245,247,192,250,256,260,262,258,214,216,220,194,200,
206,233,284,287 Built-in 22 216,218,224,245,247,190,192,250,254,252,256,260,264,254,258,216,220,188,191,200
,230,284,287 Built-in23 216,218,246,278,241,245,249,271,192,250,254,256,258,252,262,254,258,218,220,182
194,200,248 Built-in 24 216,218,246,241,245,247,249,267,192,250,256,252,260,262,258,214,220,182,188,194
,200,266 built-in 25 216,218,220,222,246,276,247,249,267,192,250,256,258,252,260,262,264,258,214,182
,191,194,260,266 Built-in 26 216,218,246,245,247,267,192,246,252,254,256,260,264,254,258,214,216,220,182,188
,197,200,269 Built-in 27 216,218,222,238,,,241,249,190,192,250,256,260,262,258,214,218,182,194,200,287 Built-in 28 216,276,241,245,249,259,0,248,252,256,258,260,264,258,214,220,188,206,209,269,
275,284 built-in29 216,218,245,247,259,190,192,,252,254,256,258,252,262,264,258,260,214,,182,188,
191,212,266 built-in 30 216,222,241,247,259,192,244,250,256,260,262,240,,214,216,182,197,209,212,269

In the above tables, '0' is a filtered value during data analysis and represents a case in which the peak is amplified below the reference value, and other three-digit numbers represent the size of the amplified allele.

1 is an illustration of the result of identification (polymorphism analysis) of the supersatellite marker FC_055, and the PCR reaction is performed on 4 individuals of the mulberry tree from the Jirisan population with the primer sets of SEQ ID NOs: 13 and 14. DNA This is the result of comparing the allele as the amplification product using the GeneMapper version 5.0 software. The amplified allele size of the first individual was observed at the same time as 214bp and 220bp, in the second individual, 214bp, in the third individual, 214bp and 218bp were observed simultaneously, and in the fourth individual, 214bp and 216bp were simultaneously observed, indicating that individual identification is possible. can be checked

As shown in Tables 3 to 8, as a result of comparing the individual genotypes analyzed with the primer set according to the present invention, each of the 169 individuals of oleander was identified as a unique genotype. It can be confirmed that the size of alleles amplified by the primer set according to the present invention is different from each other and the number of alleles is also varied, so that polymorphism is high and individual discrimination is high.

Example 3. Analysis of Genetic Diversity of the sycamore tree population

Using the supersatellite marker composition according to the present invention, genetic diversity analysis was performed among the populations of Mt. Minju, Mt. Jiri, Mt. Deogyu, Mt. Cheonhwang, Mt. Baegun, and Mt. Naejang.

Specifically, in the same manner as in the PCR analysis of Example 2, genomic DNA was isolated from 169 individuals of 6 groups of cypress, amplified using the primer set according to the present invention, and genotyping data for each individual was obtained. . The genotype data is then converted to R-based Polysat program number of allelic genetic diversity index using Genodive v3.04 software for the analysis of genetic diversity of the group (A), the number of effective allele (A _e), heterozygous FIG observations ( H _o ), and the expected heterozygosity ( H _e ) were calculated and shown in Table 9.

group number of objects A A _e H _o H _e Mt. Minju 27 11.8 4.5 0.536 0.735 Jirisan 36 13.0 4.7 0.589 0.719 Deogyusan 30 11.2 4.5 0.589 0.738 Cheonhwangsan 30 11.1 4.7 0.594 0.734 Baegunsan 16 9.8 4.3 0.580 0.713 Naejangsan 30 8.9 3.6 0.535 0.644

As shown in Table 9, the number of alleles ( A ), the number of effective alleles ( A _e ), the observed heterozygosity ( H _o ), and the expected heterozygosity ( H _e ), which are the genetic diversity index, were comprehensively compared and analyzed. Looking at this, the Deogyusan group ( A =11.2, A _e =4.5, H _o =0.589, H _e =0.738) has the highest genetic diversity among the Korean dynamite groups, and the Naejangsan group ( A =8.9, A _e =3.6, H _o = 0.535, H _e = 0.644) we can see that the lowest genetic diversity.

Therefore, it can be seen that by using the supersatellite marker composition according to the present invention, it is possible to analyze the genetic diversity of the dynamite tree, which is a native species of Korea.

<110> National Institute of Forest Science <120> Microsatellite markers for analysis of genetic diversity of Fraxinus chiisanensis and their using method <130> P10411 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 tcccaacaca aaagagtttt agc 23 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 gaacgagttt agcaagggat tg 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 tcaaccttcg cctcagaaag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 agccaaggaa agtcatgcag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 aactaggcaa acgtgcattg 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 gctttaggca acggtttctt c 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 gcggaccttc cttattcatt c 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 8 aacccaatgc tcacatcatt c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 aagtggtctc gtgcgatttc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 ctcatgaagt gttggcgaag 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 11 gcaacccggt atccattg 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 12 tagcgagtct cgatttccac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 13 tccaccactg tgacctgatg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 14 cacaaagggc acacacaaag 20 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 15 aagcgtctgg taacgaaagt g 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 16 ttcccttgag cgaataaagc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 17 aacaagtcgg cttgatcgac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 18 atcttcactg cggcaatcag 20

Claims (11)

Primer set of SEQ ID NOs: 1 and 2, primer set of SEQ ID NO: 3 and 4, primer set of SEQ ID NO: 5 and 6, primer set of SEQ ID NO: 7 and 8, primer set of SEQ ID NO: 9 and 10, primer set of SEQ ID NO: 11 and 12 of a primer set, a primer set of SEQ ID NOs: 13 and 14, a primer set of SEQ ID NOs: 15 and 16, and a primer set of SEQ ID NOs: 17 and 18, supersatellite marker composition for genetic diversity analysis through individual identification .
delete delete A kit for analysis of genetic diversity through individual identification of dynamite, comprising the supersatellite marker composition according to claim 1 .
According to claim 4, wherein the kit is a PCR kit for genetic diversity analysis kit through individual identification of dynamite tree.
i) isolating the genomic DNA from the biological sample of the sycamore individual;
ii) performing a PCR reaction using the genomic DNA and the supersatellite marker composition according to claim 1; and
iii) A method of identifying an individual of sycamore, comprising the step of analyzing the amplification product of the PCR reaction.
The method of claim 6 , wherein the biological sample is one selected from the group consisting of leaves, stems, roots, seeds and parts thereof.
The method of claim 6, wherein the PCR reaction in step ii) is a polymerase chain reaction (Polymerase Chain Reaction), multiplex polymerase chain reaction (multiplex Polymerase Chain Reaction, multiplex PCR), competitive polymerase chain reaction (competitive Polymerase Chain Reaction), It consists of real-time Polymerase Chain Reaction, Real-time Quantitative Polymerase Chain Reaction, DNA chip, and Loop-mediated isothermal amplification. A method of identifying an individual of a sycamore tree using any one selected from the group.
The method according to claim 6, wherein the analysis of the amplification product of the PCR reaction in step iii) uses any one selected from the group consisting of gel electrophoresis, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement and phosphorescence measurement. A method for identifying individuals of sycamore.
i) isolating genomic DNA from the biological sample of each individual of the sycamore population;
ii) performing a PCR reaction using the genomic DNA and the supersatellite marker composition according to claim 1;
iii) analyzing the amplification product of the PCR reaction; and
iv) calculating and comparatively analyzing the genetic diversity index for each group of dynamite;
A method of analyzing genetic diversity in a group of sycamore trees, including a.
11. The dye according to claim 10, wherein the genetic diversity index is the number of alleles ( A ), the number of effective alleles ( A _e ), the observed heterozygosity ( H _o ), and the expected heterozygosity ( H _e ). A method of analyzing genetic diversity in a population of trees.

Images