KR102348242B1 - A composition of primers for detection of Gastrodia elata pathogenic fungi and its use - Google Patents

Abstract

The present invention relates to a primer composition for detecting pathogenic fungi of Gastrodia elata and a use thereof and discloses a primer composition for detecting pathogenic fungi of Gastrodia elata, which is capable of detecting whether Gastrodia elata that is used to be processed into powder is infected with pathogenic fungi and a method for detecting pathogenic fungi of Gastrodia elata using the same. A primer composition or kit, according to the present invention, is used to specifically detect pathogenic fungi of Gastrodia elata which is a causing bacterium that causes soft rot and post-harvest diseases and is used to specifically detect pathogenic fungi of Gastrodia elata not only in Gastrodia elata raw materials but also in processed Gastrodia elata powder. In addition, the primer composition or kit, according to the present invention, is capable of specifically detecting pathogenic fungi of Gastrodia elata even in the early stages of onset that cannot be identified with the naked eye so that the early diagnosis of pathogenic fungi of Gastrodia elata is possible. As a result, the present invention can contribute to the improvement of productivity and quality of Gastrodia elata in the Gastrodia elata cultivation field.

Description

A composition of primers for detection of Gastrodia elata pathogenic fungi and its use}

The present invention relates to a primer composition for detecting a thousand horse pathogenic mold and its use, and more particularly, a primer composition for detecting a thousand horse pathogenic mold that can specifically detect whether or not pathogenic fungal infection of a thousand horses used in the processed thousand horse powder is used, and It relates to a method for detecting a thousand horse pathogenic fungus using the same.

Chunma ( Gastrodia elata ) is a perennial parasitic plant of the orchid family, distributed in Korea, China, Japan, and Taiwan. It is known to grow well in semi-shaded areas with broad-leaved forests with an average annual temperature of 10 to 15 °C and an average humidity of 70% at an altitude of 400 to 800 m above sea level. Chunma is a tuber, extending horizontally, with a length of 10~18cm and a diameter of 3~4cm, with an indistinct rim on the side. Chunma, which is used as a medicine, has been used as a preventive and therapeutic agent for head diseases because it is effective for stroke, high blood pressure, dizziness, and neurological diseases.

Chunma, an important forest medicinal plant, is a completely organically grown plant and is cultivated using 100% eco-friendly farming methods that do not use pesticides or chemical fertilizers. have. The main production complex of Cheonma in Korea has been cultivated in various regions, including Muju, Sangju, Gimcheon, Sancheong, and Jinan. Although Chunma is distributed as a raw material, it is usually processed into powder in consideration of storage properties and distributed as Chunma powder. Recently, a lot of Chunma powder is being imported from China.

However, Chunma is known to be easily susceptible to rot or rot during cultivation or storage after harvest.

Soft blight is also called soft disease, and the pectin in the middle layer of the cell wall of the plant tissue melts and looks watery at first, but as time goes on, it softens and sinks, rots and flows down like a liquid. When Cheonma is afflicted with soft blight, the tuber turns yellowish-brown and becomes weak and soft.

Rot disease is a symptom of decomposition or rotting of the roots or underground stems of plants. When infected, the root tissue is destroyed and turns brown and then rots black. The damage is more severe from the fine roots, so the roots are cracked and easily pulled out. The rot-infected horses had round, grayish-brown spots, and over time the spots on the tubers coalesced into larger black lesions. The pathogens of soft blight and rot are different depending on the plant species, and in the case of Chunma, it is known that pathogenic fungi are related to soft blight and rot.

Even if Chunma was afflicted with soft and rot, it was not observed with the naked eye at the beginning.

Therefore, there is an urgent need to develop a method that can specifically detect the pathogenic fungus, which is the causative agent of soft blight and rot of Chunma.

Registered Patent No. 10-1905677 Registered Patent No. 10-2130332

Accordingly, the present inventors developed a primer set capable of specifically detecting the pathogenic fungi of the genus soft and rot while researching to find out the pathogenic mold of celery in order to meet the needs in the prior art, and using this, the processed cheonma The present invention was completed by confirming that pathogenic mold could also be detected in powder.

Therefore, it is an object of the present invention to provide a primer composition for detecting a thousand horse pathogenic fungus.

Another object of the present invention is to provide a kit for detecting a yeast pathogenic fungus comprising the primer composition.

Another object of the present invention is to provide a method for detecting a yeast pathogenic fungus using the primer composition.

In order to achieve the above object of the present invention, the present invention provides a primer composition for detecting a pathogenic fungus in Chunma.

In the present invention, the primer composition is one selected from the group consisting of primer sets of SEQ ID NOs: 1 and 2, primer sets of SEQ ID NOs: 3 and 4, primer sets of SEQ ID NOs: 5 and 6, and primer sets of SEQ ID NOs: 7 and 8 The above primer sets are included.

In the present invention, 'Chunma pathogenic fungus' is Fusarium solani confirmed as the causative agent of soft disease or rot in the horseshoe crab ( Fusarium solani ), Clonostachys rosea ( Clonostachys rosea ), Trichoderma hamatum ( Trichoderma hamatum ), and Fusarium oxysporum ( Fusarium oxysporum ).

The primer sets of SEQ ID NOs: 1 and 2 can specifically detect the pathogenic fungi Fusarium solani , and the primer sets of SEQ ID NOs: 3 and 4 are Clonostachys rosea (Clonostachys rosea) ) can be specifically detected, and the primer sets of SEQ ID NOs: 5 and 6 can specifically detect Trichoderma hamatum , a pathogenic fungus, of SEQ ID NOs: 7 and 8, and the primer sets of SEQ ID NOs: 7 and 8 are It is possible to specifically detect Fusarium oxysporum , which is a pathogenic fungus, Fusarium oxysporum.

In the present invention, the term 'primer' refers to a nucleic acid sequence having a short free 3' terminal hydroxyl group, capable of base pairing with a complementary template, and serving as a starting point for template strand copying. means sequence. A 'primer pair' refers to a combination of a forward primer and a reverse primer.

In the present invention, the primer can initiate DNA synthesis in the presence of four different deoxynucleotides and reagents for the polymerization reaction (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. In addition, the base sequence of the primer can be modified using a label that can directly or indirectly provide a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, and biotin.

According to an embodiment of the present invention, when the primer composition is used in the present invention, the pathogenic fungi Fusarium solani in the powdery mildew are Fusarium solani, Clonostachys rosea , Trichoderma hamatum ( Trichoderma hamatum ) , and the presence of Fusarium oxysporum could be specifically detected ( FIGS. 2 to 5 ).

According to another object of the present invention, the present invention provides a kit for detecting a yeast pathogenic fungus comprising the primer composition.

The kit of the present invention may be a PCR kit. The kit may further include a DNA polymerase, deoxynucleotide (dNTP), a PCR buffer, a test tube, an appropriate container, and the like. In addition, a primer pair specific for a gene used as a quantitative control may be included.

The kit of the present invention may further comprise a user's guide describing optimal conditions for conducting the reaction. A handbook is a printout explaining how to use the kit, eg, how to prepare a PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

In addition, according to another object of the present invention, the present invention provides a method for detecting a yeast pathogenic fungus using the primer composition or the kit.

Specifically, the method of detecting a thousand horse pathogenic fungus of the present invention is

i) extracting DNA from the Chunma sample;

ii) performing a PCR reaction using the DNA and the composition or the kit, and

iii) analyzing the amplification product of the PCR reaction.

In the present invention, 'Chenma sample' refers to a sample containing DNA, and specifically, the Chunma sample may be a Chunma processed product such as a Chunma raw material, a Chunma powder, or a Chunma extract, but is not limited thereto.

A method of extracting DNA from a thousand horse sample may use a method known in the art, and is not particularly limited to a specific method.

PCR reactions include Polymerase Chain Reaction, multiplex Polymerase Chain Reaction, multiplex PCR, competitive Polymerase Chain Reaction, real-time Polymerase Chain Reaction), Real-time Quantitative Polymerase Chain Reaction, a DNA chip, or a loop-mediated isothermal amplification method known in the art may be used.

For the analysis of the amplification product of the PCR reaction, methods known in the art such as gel electrophoresis, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement, or phosphorescence measurement may be used, but are not limited thereto. The gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the marker with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence can be measured using a fluorometer. have. In addition, the radioactive measurement method includes ^{adding a radioactive isotope such as 32} P or ³⁵ S to the PCR reaction solution during PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or a liquid scintillation counter. (Liquid scintillation counter) can be used to measure radioactivity.

By using the primer composition or kit according to the present invention, it is possible to specifically detect the genus pathogenic mold, which is the causative agent of soft blight and rot.

In addition, the primer composition according to the present invention can specifically detect a thousand horse pathogenic mold not only in raw material but also in processed thousand horse powder.

In addition, the primer composition or kit according to the present invention specifically detects the pathogenic fungus of Chunma even at the initial stage of onset that cannot be identified with the naked eye and enables early diagnosis, thereby contributing to the improvement of productivity and quality of Chunma at the Chunma cultivation site. .

Figure 1a shows the results of amplification against 4 species of pathogenic fungi using Fusarium solani -specific primer sets of SEQ ID NOs: 1 and 2 (left) or Clonostachys rosea -specific primer sets of SEQ ID NOs: 3 and 4 (right). This is a picture that shows
Figure 1b shows the results of amplification of 4 species of pathogenic fungi using Trichoderma hamatum -specific primer sets (left) or Fusarium oxysporum -specific primer sets of SEQ ID NOs: 7 and 8 (right) This is a picture that shows
Figure 2 is a photograph showing the results of performing PCR on DNA extracted from Chunma powder using the primer sets of SEQ ID NOs: 1 and 2.
3 is a photograph showing the results of performing PCR on the DNA extracted from Chunma powder using the primer sets of SEQ ID NOs: 3 and 4.
Figure 4 is a photograph showing the results of performing PCR on DNA extracted from Chunma powder using the primer sets of SEQ ID NOs: 5 and 6.
5 is a photograph showing the results of performing PCR on the DNA extracted from Chunma powder using the primer sets of SEQ ID NOs: 7 and 8.

Hereinafter, the configuration and effect of the present invention will be described in more detail with reference to specific examples in order to help the understanding of the present invention. However, the following examples are merely illustrative in order to understand the present invention more clearly, and the scope of the present invention is not limited by the following examples.

Example 1: Preparation of primers specific to Cheonma pathogenic fungus

Fusarium solani ( Fusarium solani ), Clonostachys rosea ( Clonostachys rosea ), Trichoderma hamatum ( Trichoderma hamatum ), and Fusarium oxysporum ( Fusarium oxysporum ) By alignment based on the translation elongation factor gene sequence that exists in each, primers specific to each were designed and manufactured without overlapping with each other. The results are shown in Table 1. In addition, the size (bp) of the gene product amplified by the excavated primer set was analyzed and sequenced, and the results are shown in Table 2.

fungal species abbreviation Forwar Sequence (5-->3) Reverse Sequence (5-->3) Fusarium solani FS GATATTCCACATCGAATTCC
(SEQ ID NO: 1) CGTCTGTTGATTGTTAGTGGTGAG
(SEQ ID NO: 2) Clonostachys rosea CR GAGAAGGTAAGAACAGC
(SEQ ID NO: 3) CGTCTGTGGGGTATCGGTTAGTC
(SEQ ID NO: 4) Trichoderma hamatum TH GTCAATATTTTTTCCCACC
(SEQ ID NO: 5) CGTCTGTAGAGTCGCACGTTAGC
(SEQ ID NO: 6) Fusarium oxysporum FO CTGTCGAGTGGCTAGGGAAG
(SEQ ID NO: 7) TGCTCCCCAATTAACCTACG
(SEQ ID NO: 8)

Primer set amplification product size (bp) SEQ ID NOs: 1 and 2 GATATTCCACATCGAATTCCCCGTCGAATTCCCTCCATCGCGATACGCTC
TGCGCCCGCTTCTCCCGAGTCCCAAAATTTTTGCGGTCCGACCGTAATTT
TTTTGGTGGGGCATTTACCCCGCCACTCGGGCGACGTTGGACAAAGCCCT
GATCCCTGCACACAAAAACACCAAACCCTCTTGGCGCGCATCATCACGTG
GTTCACGACAGACGCTAACCGGTCCAACAATAGGAAGCCGCTGAGCTCGG
TAAGGGTTCCTTCAAGTACGCCTGGGTCCTTGACAAGCTCAAGGCCGAGC
GTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCC
CGCTACTATGTCACCGTCATTGGTATTGTTGCTGTCACCTCTCTCCACACAT
GTCTCACCACTAACAATCAACAGACG
(SEQ ID NO: 9) 426 SEQ ID NOs: 3 and 4 GAGAAGGTAAGAACAGCCACTCCTTTGATGCCCATATCGTGCGGCGTCTT
GCATCTCACTCACCCTTGGCTTTTTTTGTGCCCCTCTTACCCCTCCTCAA
AAAGTTCAATTTTTTTGTGGCCCATTTTAGTGGGGCCACAACCCCGCCAC
AGTGCTCGATACAATTCTCAAGGAAGGCACACGCTGACAGTGATCAAATA
GGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTCCTTG
ACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTC
TGGAAGTTCGAGACTCCCAAGTACCAGGTCACCGTCATTGGTATGTGGTT
GCACCTCTGTTGTTTGTTGCGAAGACGTGTTGACTAACCGATACCCCACA
GACG
(SEQ ID NO: 10) 404 SEQ ID NOs: 5 and 6 GTCAATATTTTTTTCCCACCAAGCATCGCACCCCGCTTTGTCTGCCCTACTA
CCCCTCCTTTGGCACAGCAAAAATTTTCTGGCTGCCTTGGTTGGTTTTTA
GTGGGGTGCCAAATTTTTGGCAGTGACCCCGCCATCGCCACTGTTCCTCA
TGCACTACCCAACACATGCTACGTATCAACTGCTTGGTTCATTGTGCTAA
TCATACTTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAA
GTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCA
CCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACC
GTCATTGGTATGTTTTCAGTCCGACTGGTCACTATCCCAACATCATGCTA
ACGTGCGACTCTACAGACG
(SEQ ID NO: 11) 419 SEQ ID NOs: 7 and 8 CTGTCGAGTGGCTAGGGAAGGTGTTTTTACCCCAAACGCAACCTGAGAAT
CCAGCCGATGGTCGCCTACTTATCGTCGACGGTCACGGCAGTCATACCTC
GGACGAATTTATAACTATGTGTTACCTAAACAACGTTCACTTACTCTTTT
TCCCTGCTCATACTTCCCATGTCCTCCAGCCCTTGGATCTCGGCTGCTTT
TCCAGTTTAAAAACGGCCTATCGTAGGTTAATTGGGGAGCA
(SEQ ID NO: 12) 241

Example 2. Specificity analysis of primer sets

In order to confirm that the primer set discovered in Example 1 is specific only to each Chunma pathogenic fungus, Fusarium solani , Clonostachys rosea , Trichoderma hamatum , and Fusarium oxysporum 4 pathogens identified from Chunma at the National Institute of Forest Sciences using a kit to extract DNA and primer sets according to the present invention (primer sets of SEQ ID NOs: 1 and 2 specific for Fusarium solani, primer sets of SEQ ID NOs: 3 and 4 specific for Clonostachys rosea , SEQ ID NOs: 5 and 6 specific for Trichoderma hamatum PCR was performed using the primer set of , and the primer sets of SEQ ID NOs: 7 and 8 specific for Fusarium oxysporum).

Specifically, 2 μl of 10X PCR buffer, 2 μl of 2.5 mM dNTP, 0.2 μl of GnC Power Taq polymerase, 0.5 μl of each forward primer (10 pmol), 0.5 μl of reverse primer (10 pmol) and After mixing 13.8 μl of distilled water with 1 μl of template DNA, using T100 ^TM Thermal Cycler (BIO-RAD, Catalog #186-1096), denaturation was performed at 96° C. for 3 minutes, followed by 20 seconds at 96° C., 20 seconds at 52° C., PCR was performed at 72 °C for 35 cycles for 1 minute. After PCR was completed, the amplification product and size were confirmed by electrophoresis, and the results are shown in FIGS. 1A and 1B.

As shown in Figures 1a and 1b, PCR was performed using the primer sets of SEQ ID NOs: 1 and 2 according to the present invention. Among the four types of fungi, Fusarium solani specifically amplified products only This was confirmed, and as a result of performing PCR using the primer sets of SEQ ID NOs: 3 and 4 , the amplification product was specifically identified only in Clonostachys rosea among the four types of fungi, and the primers of SEQ ID NOs: 5 and 6 As a result of performing PCR using the set, the amplification product was specifically identified only in Trichoderma hamatum among the four types of fungi, and as a result of performing PCR using the primer sets of SEQ ID NOs: 7 and 8, 4 Among the fungi of the species, it can be confirmed that the amplification product was specifically identified only in Fusarium oxysporum, and was not amplified at all in other fungi.

Example 3. Test for detecting a thousand horse pathogenic fungus in a thousand horse powder

Using the primer set excavated in Example 1, a test for detecting a thousand horse pathogenic fungus was performed in the thousand horse powder.

Specifically, after obtaining a commercially available domestic Chunma raw material, each Chunma tissue was inoculated with the fungi Fusarium solani, Clonostachys rosea, Trichoderma hamatum, and Fusarium oxysporum in Example 2, and left for 7 to 10 days to develop disease. After that, it was dried for 7-10 days at around 60° C. (mainly matched with the conditions for making dry cheonma), and then pulverized and powdered to prepare cheonma powder.

After DNA extraction using the DNeasy plant mini kit (QIAGEN) from the prepared Chunma powder, each primer set according to the present invention (Fusarium solani-specific primer sets of SEQ ID NOs: 1 and 2, Clonostachys rosea -specific SEQ ID NO: PCR was performed using the primer sets of 3 and 4, the primer sets of SEQ ID NOs: 5 and 6 specific for Trichoderma hamatum , and the primer sets of SEQ ID NOs: 7 and 8 specific for Fusarium oxysporum). Specifically, 2 μl of 10X PCR buffer, 2 μl of 2.5 mM dNTP, 0.2 μl of GnC Power Taq polymerase, 0.5 μl of each forward primer (10 pmol), 0.5 μl of reverse primer (10 pmol) and After mixing 13.8 μl of distilled water with 1 μl of template DNA, using T100 ^TM Thermal Cycler (BIO-RAD, Catalog #186-1096), denaturation was performed at 96° C. for 3 minutes, followed by 20 seconds at 96° C., 20 seconds at 52° C., PCR was performed at 72°C for 40 cycles for 1 minute. After PCR was completed, the presence of an amplification product was checked by electrophoresis, and the results are shown in FIGS. 2 to 5 .

As shown in FIG. 2, when PCR was performed using the primer sets of SEQ ID NOs: 1 and 2 in Chunma powder processed with Chunma infected with Fusarium solani, a specific amplification product with a size of 426bp was confirmed, and as shown in FIG. Likewise, when PCR was performed using the primer sets of SEQ ID NOs: 3 and 4 in the Clonostachys rosea -infected Cheonma powder, a specific amplification product of 404bp size was confirmed, and as shown in FIG. 4, Trichoderma hamatum -infected When PCR was performed using the primer sets of SEQ ID NOs: 5 and 6 in the Chunma powder processed into Chunma, a specific amplification product with a size of 419bp was confirmed, and as shown in FIG. 5, Chunma powder processed into Chunma infected with Fusarium oxysporum In the case of PCR using the primer sets of SEQ ID NOs: 7 and 8, a specific amplification product with a size of 241 bp was confirmed, and it can be seen that the primer composition of the present invention can specifically detect the A. have.

<110> National Institute of Forest Science <120> A composition of primers for detection of Gastrodia elata pathogenic fungi and its use <130> P-10394 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 gatattccac atcgaattcc 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 cgtctgttga ttgttagtgg tgag 24 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 gagaaggtaa gaacagc 17 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 cgtctgtggg gtatcggtta gtc 23 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 gtcaatattt tttcccacc 19 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 cgtctgtaga gtcgcacgtt agc 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 ctgtcgagtg gctagggaag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 8 tgctccccaa ttaacctacg 20 <210> 9 <211> 426 <212> DNA <213> Artificial Sequence <220> <223> amplified sequence by primers of SEQ.NO. 1 & 2 <400> 9 gatattccac atcgaattcc ccgtcgaatt ccctccatcg cgatacgctc tgcgcccgct 60 tctcccgagt cccaaaattt ttgcggtccg accgtaattt ttttggtggg gcatttaccc 120 cgccactcgg gcgacgttgg acaaagccct gatccctgca cacaaaaaca ccaaaccctc 180 ttggcgcgca tcatcacgtg gttcacgaca gacgctaacc ggtccaacaa taggaagccg 240 ctgagctcgg taagggttcc ttcaagtacg cctgggtcct tgacaagctc aaggccgagc 300 gtgagcgtgg tatcaccatc gacattgccc tctggaagtt cgagactccc cgctactatg 360 tcaccgtcat tggtatgttg ctgtcacctc tctcacacat gtctcaccac taacaatcaa 420 cagacg 426 <210> 10 <211> 404 <212> DNA <213> Artificial Sequence <220> <223> amplified sequence by primers of SEQ.NO. 3 & 4 <400> 10 gagaaggtaa gaacagccac tcctttgatg cccatatcgt gcggcgtctt gcatctcact 60 cacccttggc tttttttgtg cccctcttac ccctcctcaa aaagttcaat ttttttgtgg 120 cccattttag tggggccaca accccgccac agtgctcgat acaattctca aggaaggcac 180 acgctgacag tgatcaaata ggaagccgct gaactcggca agggttcctt caagtacgca 240 tgggtccttg acaagctcaa ggccgagcgt gagcgtggta tcaccatcga tatcgccctc 300 tggaagttcg agactcccaa gtaccaggtc accgtcattg gtatgtggtt gcacctctgt 360 tgtttgttgc gaagacgtgt tgactaaccg ataccccaca gacg 404 <210> 11 <211> 419 <212> DNA <213> Artificial Sequence <220> <223> amplified sequence by primers of SEQ.NO. 5 & 6 <400> 11 gtcaatattt tttcccacca agcatcgcac cccgctttgt ctgcctacta cccctccttt 60 ggcacagcaa aaattttctg gctgccttgg ttggttttta gtggggtgcc aaatttttgg 120 cagtgacccc gccatcgcca ctgttcctca tgcactaccc aacacatgct acgtatcaac 180 tgcttggttc attgtgctaa tcatacttca atcaatagga agccgccgaa ctcggcaagg 240 gttccttcaa gtatgcgtgg gttcttgaca agctcaaggc cgagcgtgag cgtggtatca 300 ccatcgacat tgccctgtgg aagttcgaga ctcccaagta ctatgtcacc gtcattggta 360 tgttttcagt ccgactggtc actatcccaa catcatgcta acgtgcgact ctacagacg 419 <210> 12 <211> 241 <212> DNA <213> Artificial Sequence <220> <223> amplified sequence by primers of SEQ.NO. 7 & 8 <400> 12 ctgtcgagtg gctagggaag gtgtttttac cccaaacgca acctgagaat ccagccgatg 60 gtcgcctact tatcgtcgac ggtcacggca gtcatacctc ggacgaattt ataactatgt 120 gttacctaaa caacgttcac ttactctttt tccctgctca tacttcccat gtcctccagc 180 ccttggatct cggctgcttt tccagtttaa aaacggccta tcgtaggtta attggggagc 240 a 241

Claims (12)

As a primer composition for detecting a yeast pathogenic mold comprising the primer sets of SEQ ID NOs: 1 and 2, the primer sets of SEQ ID NOs: 3 and 4, the primer sets of SEQ ID NOs: 5 and 6, and the primer sets of SEQ ID NOs: 7 and 8,
The primer composition is a composition that can detect a thousand horse pathogenic fungi from a thousand horse powder.
According to claim 1, wherein the pathogenic fungi Fusarium solani ( Fusarium solani ), Chronostachys rosea ( Clonostachys rosea ), Trichoderma hamatum ( Trichoderma hamatum ), and Fusarium oxysporum ( Fusarium oxysporum ) A primer composition for detecting a thousand horse pathogenic fungus.
The primer composition of claim 1, wherein the primer sets of SEQ ID NOs: 1 and 2 are specific to Fusarium solani.
The primer composition of claim 1, wherein the primer sets of SEQ ID NOs: 3 and 4 are specific for Clonostachys rosea.
The primer composition of claim 1, wherein the primer sets of SEQ ID NOs: 5 and 6 are specific for Trichoderma hamatum.
The primer composition of claim 1, wherein the primer sets of SEQ ID NOs: 7 and 8 are specific for Fusarium oxysporum.
As a kit for detecting celestial pathogenic fungi,
The kit comprises the primer sets of SEQ ID NOs: 1 and 2, the primer sets of SEQ ID NOs: 3 and 4, the primer sets of SEQ ID NOs: 5 and 6, and the primer sets of SEQ ID NOs: 7 and 8,
The kit is a kit that can detect a thousand horse pathogenic fungi from a thousand horse powder.
The kit according to claim 7, wherein the kit is a PCR kit.
As a method of detecting a celestial malignancy, the method comprises:
i) extracting DNA from the Chunma sample;
ii) performing a PCR reaction using the DNA and the composition according to claim 1 or the kit according to claim 7, and
iii) analyzing the amplification product of the PCR reaction,
The method that the thousand horse sample is a thousand horse powder.
delete 10. The method of claim 9, wherein the PCR reaction in step ii) is a polymerase chain reaction (Polymerase Chain Reaction), multiplex polymerase chain reaction (multiplex Polymerase Chain Reaction, multiplex PCR), competitive polymerase chain reaction (competitive Polymerase Chain Reaction), It consists of real-time Polymerase Chain Reaction, Real-time Quantitative Polymerase Chain Reaction, DNA chip, and Loop-mediated isothermal amplification. A method of detecting a thousand horse pathogenic mold using any one selected from the group.
10. The method of claim 9, wherein the analysis of the amplification product of the PCR reaction in step iii) uses any one selected from the group consisting of gel electrophoresis, capillary electrophoresis, DNA chip, radiometric measurement, fluorescence measurement and phosphorescence measurement. How to detect celestial pathogenic fungus.

Images