KR101828774B1 - Method of distinguishing between the red pine and the scot pine using molecular marker - Google Patents

Abstract

The present invention provides a primer set capable of discriminating pines and pine trees and a method for identifying pine trees and pine trees using a PCR-RFLP technique using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) using the primer set.

Description

Methods for identification of pine and pine trees using molecular markers {

The present invention relates to a method for identifying pine trees and pine trees using molecular markers, and more particularly, to a method of identifying pine trees and pine trees using a primer set and a primer set, -RFLP) technique to identify pines and pine trees.

Genus Pinus is distributed over 100 species and is known as the largest genus existing in conifers (Mirov, 1967; Price et al., 1998). In Korea, pine trees, pine trees, pine trees, island pine trees, and pine trees are naturally distributed (Lee Seokwoo, 2007). Ligature pine trees, Teodaso trees and pine trees were introduced and planted.

Pine is a representative species of Korea distributed widely in temperate regions from Halla Mountain in Jeju Island to North Hamgyong Province in Korea (Cho Hyun-jae and Chang-bae Cho, 2011).

The pine tree is the most widely distributed among pine trees, and is a representative plant of Eurasia. The Savior pine tree is distributed from Europe, Scotland and Spain to Siberia and North Asia (Mirov, 1967).

The pine tree is classified taxonomically as Diplozylon and Haplozylon (Price et al., 1998), and the pine and the pear tree belong to the pine tree subspecies.

These species are characterized by the appearance of two orifices and the bark are red or reddish brown and are very difficult to distinguish because they are very similar in appearance. Molecular taxonomic studies have also shown that the pine and pine trees have very similar taxonomic relationships (Gernandt et al., 2005).

In general, visual identification of these species is very difficult for the general public except for highly trained specialists. In the case of processed wood, it is more difficult to identify by visual inspection, and it is difficult to identify it by microscopic method (National Forestry Academy, 2006).

Although the technology for solving the above problem has not yet been developed in Korea, there are slight differences in the shape of the leaves and the shape of the cones (Fu et al., 1999) There is a problem in that it is unclear to utilize it as an identification method and it is not possible to exclude the aspect of subjective identification error.

Therefore, in addition to the identification criteria of pine and pine tree by taxonomic empirical measurement, objective and scientific identification methods have not yet been developed.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned problems, and it is an object of the present invention to search for species-specific DNA mutations that can discriminate pines and pine trees and to provide polymerase chain reaction and restriction fragment polymorphism (PCR-RFLP). ≪ / RTI >

It is another object of the present invention to provide a method and an apparatus for discriminating between an object type and a specific consistency based on a DNA variation having no influence of an external form and an environmental variation using the primer set in order to solve the problem of uncertainty of external form comparison and subjective identification error The present invention provides a method for identifying a pine tree and a pine tree.

It is still another object of the present invention to provide a kit for identification of pine and pearl pine trees, which includes the primer set and has a clear consistency with the objectivity of identification based on a DNA variation without influence of external form and environmental variation.

In order to solve the above problems, the present invention provides a primer set for identification of pine and pine tree comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2.

In addition, the present invention provides a method for identifying pine trees and pine trees using the primer set.

In addition, the present invention provides a pine tree and a pine tree identification kit comprising the primer set.

According to the present invention, since the pine tree and the pine tree can be stably and reliably distinguished by using the pine tree and the pine tree identification primer set, it can be utilized as a primer set for scientific assurance for the identification of pine trees and pine trees.

In addition, when the method of the present invention is used, it is possible to solve unrecognized factors as compared with the conventional methods, and particularly to identify the processed wood which is difficult to identify by the microscopic method even when the external shape comparison itself is impossible have.

FIG. 1 shows the fragmentation patterns of PCR products (lane 1 to 30: pine tree, lane 31 to 60: pear tree, M: DNA size marker) using Pidest-cp1 primer set for identification of pine and pear tree.
FIG. 2 shows the results of fragmentation of the PCR products using the Pidest-cp1 primer set for identification of pine and pear trees using Hinf I restriction enzyme (lane 1 to 30: pine, lane 31 to 60: DNA size marker).

The present invention provides a primer set for identification of pine and pine tree comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2.

In the present invention, the term " primer set " means a DNA marker used for distinguishing DNA base sequences by electrophoresis.

Also, in the present invention, the term " primer " refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product.

The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer depends on the primer usage conditions such as the complexity of the desired DNA target, temperature and ionic strength.

In the present invention, an oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, And may include intercalating angents.

The nucleotide sequences of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 constituting the primer set according to the present invention were developed based on the nucleotide sequence of chloroplast DNA of pine and guinea pine. .

In addition, the present invention provides a method for identifying pine trees and pine trees using the primer set.

The method for identifying pines and pearls according to the present invention comprises the steps of (a) extracting template DNA from a sample, (b) amplifying the template DNA extracted in the step (a) by polymerase chain reaction using the primer set, (c) treating the amplification product produced by the above step with a restriction enzyme to cleave the amplification product, and (d) fractionating the cleavage product produced by the step.

In the method for identifying the pine and the pine of the present invention, the reaction solution for the polymerase chain reaction is prepared by mixing 25 ng of pine genomic DNA, 25 ng of pearl genomic DNA, 1 x buffer, 20 μM forward primer of SEQ ID NO: 1 and reverse primer of 20μM of SEQ ID NO: 2, may comprise a DNA polymerase of MgCl _2, and 0.125 units of dNTPs, 2.5mM of 0.2mM.

In the method for identification of the pine and the pine of the present invention, the amplification of step (b) is performed at 94 ° C for 5 minutes after the initial denaturation at 94 ° C for 30 seconds, at 60 ° C for 30 seconds, at 72 ° C for 30 seconds After repeating the polymerization process 45 times, the final polymerization process can be performed at 72 캜 for 10 minutes.

In the method for identifying the pine and the pine of the present invention, the reaction product for digesting the amplification product by treating the restriction enzyme of the step (c) is 1 x reaction buffer solution and 0.5 unit restriction enzyme Enzymes.

In the method for identification of the pine and the pine of the present invention, the restriction enzyme may be Hinf I, Tfi I, Pfe I or the like, but is not limited thereto.

In the method for identification of the pine and the pine of the present invention, the treatment of the restriction enzyme may include a step of activating at 37 캜 for 3 hours and then deactivating at 65 캜 for 20 minutes.

In addition, the present invention provides a pine tree and a pine tree identification kit comprising the primer set.

The constituents contained in the kit of the present invention and the method for producing the kit of the present invention are sufficient to use the components and the manufacturing method included in the conventional kit, and a detailed description thereof will be omitted.

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited to these examples.

≪ Example 1 > Extraction and purification of template DNA

To prepare samples for template DNA extraction and purification, 200 mg of leaf samples collected from each individual were quantitated and placed in a 2 ml microtube together with ceramic beads. 400 μl of Buffer AP1 from DNeasy Plant Mini Kit (QIAGEN) and 400 μl of RNase A 4 μl was added thereto, followed by shaking for 10 minutes at a rate of 30 times / sec using a Tissue Lyser (QIAGEN) to disrupt the leaf sample tissue.

DNA was extracted and purified according to the manufacturer's instructions using DNeasy Plant Mini Kit (QIAGEN). The final concentration of extracted DNA was diluted to 5 ng / μl.

Example 2: Design of primer

The nucleotide sequence of the amplification target region was determined using the pine chloroplast sequence (GenBank accession No. JN854210) and the pine chloroplast sequence (GenBank accession No. JN854158), and the primer was designed using Primer3 software.

Primer sizes ranged from 18 to 22 mers, Tm values ranged from 57 to 63 degrees, GC clamps were 1, and primer amplification products ranged from 250 bp to 350 bp.

Table 1 below shows the nucleotide sequences of the primer set Pdest-cp1 of the present invention, wherein the primer base sequence combination is regarded as a combination of the reverse primer base sequence and the same primer base sequence combination.

Primer set The nucleotide sequence (5 → 3) Forward primer Reverse primer Pdest-cp1 AACGAGGTGCTCTACCTTGC GACTCTCGCCGTATGAAAGC

≪ Example 3 > Polymerase chain reaction (PCR)

Using the primer set Pdest-cp1 designed in Example 2, amplification products were generated by performing PCR (PCR) on pine and pearl samples.

The composition of the PCR reaction mixture is as follows.

The PCR reaction solution contained 25 ng of each of pine, pine genomic DNA, 1 × buffer, 20 μM primer, 0.2 mM dNTPs, 2.5 mM MgCl 2, and 0.125 unit Taq DNA polymerase (RBC) per 50 μl.

After the initial denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, primer binding at 60 ° C for 30 seconds, and polymerization at 72 ° C for 30 seconds were repeated 45 times, followed by final polymerization at 72 ° C for 10 minutes Respectively.

<Example 4> Production of soybean product by restriction enzyme fragment polymorphism (RFLP) technique

The amplification product generated in Example 3 was treated with a restriction enzyme to generate a cleavage product of the amplification product.

As a restriction enzyme, Hinf I was used. The composition of the reaction product for restriction enzyme digestion of the PCR amplification products was prepared by adding 1 × reaction buffer and 0.5 U of restriction enzyme per 5 μl of the PCR amplification product .

The Hinf I restriction enzyme treatment was carried out by activating at 37 ° C for 3 hours and then inactivating at 65 ° C for 20 minutes.

&Lt; Example 5 > Amplification products and fractions of cleavage products

5 μl of the amplification product generated in Example 3 was removed and mixed with 3 μl of loading dye. Then, 2% agarose gel electrophoresis was performed. A 100 bp ladder (Fermentas Co., 50 μg / μl) The result of checking the size of the product fragments is shown in Fig.

In addition, 5 μl of loding dye was mixed with the cleavage product produced in Example 4, followed by 2% agarose gel electrophoresis. A 100 bp ladder (Fermentas Co., 50 μg / μl) The result of checking the size of the fragment is shown in Fig.

As shown in FIG. 1, when the fragmentation pattern was observed by electrophoresis on agarose gel, it was found that a DNA fragment of about 300 bp was commonly observed in pine and pearl pine samples.

Further, as shown in Fig. 2, when the cleavage product of the amplification product using the primer set Pidest-cp1 was subjected to electrophoresis on agarose gel and the fractionation pattern was observed, no cleavage product was observed in the pear tree, A 200 bp cleavage product DNA fragment was observed.

The sizes of the DNA fragments observed in the above are visually observed values based on the DNA size markers of the electrophoresis. From the nucleotide sequences used for the primer synthesis, the sizes of the base sequences amplified by the primers and the restriction enzymes The approximate size can be estimated based on the calculated length based on the recognition site.

When observing a DNA fragment through the electrophoresis, it is possible to display a slightly different value according to an observer by visual observation. However, the target DNA region can be accurately amplified and cut, have.

Although the present invention has been described in connection with the specific embodiments of the present invention, it is to be understood that the present invention is not limited thereto. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

According to the present invention, since the pine tree and the pine tree can be stably and reliably distinguished by using the pine tree and the pine tree identification primer set, it can be utilized as a primer set for scientific assurance for the identification of pine trees and pine trees.

In addition, when the method of the present invention is used, it is possible to solve unrecognized factors as compared with the conventional methods, and particularly to identify the processed wood which is difficult to identify by the microscopic method even when the external shape comparison itself is impossible have.

<110> Republic of Korea <120> Method of distinguishing between the red pine and the scot pine          using molecular marker <130> 9615 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 aacgaggtgc tctaccttgc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 gactctcgcc gtatgaaagc 20

Claims (9)

delete (a). Extracting template DNA from the sample;
(b). Amplifying the template DNA extracted in the above step using a primer set consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 by a polymerase chain reaction;
(c). Treating the 300 bp amplification product produced by the above step with a restriction enzyme to cleave the amplification product; And
(d). Wherein the cleavage product produced by said step is fractionated so that no cleavage product is observed in the pear tree, and a truncated product DNA fragment of 200 bp is observed in the pine tree. delete The method according to claim 2, wherein the reaction solution for the polymerase chain reaction comprises 25 ng of pine genomic DNA, 25 ng of pearl genomic DNA, 1 x buffer, 20 μM of the forward primer of SEQ ID NO: 1, , Reverse primer of SEQ ID NO: 2, dNTPs of 0.2 mM, MgCl _{2 of} 2.5 mM and DNA polymerase of 0.125 units. The method according to claim 2, wherein the amplification of step (b) comprises repeating the denaturation at 94 ° C for 30 seconds, the primer binding at 60 ° C for 30 seconds, and the polymerization at 72 ° C for 30 seconds for 45 times after initial denaturation at 94 ° C for 5 minutes Followed by final polymerization at 72 ° C for 10 minutes. [Claim 3] The method according to claim 2, wherein the reaction product for digesting the restriction enzyme of step (c) comprises 1 x reaction buffer solution and 0.5 units of restriction enzyme per 5 l of the PCR amplification product Identification of pine and pine. 3. The method according to claim 2, wherein the restriction enzyme is Hinf I. 3. The method according to claim 2, wherein the treatment of the restriction enzyme comprises activating at 37 DEG C for 3 hours and then inactivating at 65 DEG C for 20 minutes. delete

Images