KR101718703B1 - Method of distinguishing the Korean pine from the dwarf stone pine using molecular marker - Google Patents

Abstract

The present invention relates to a primer set composition capable of amplifying the genetic variation of chloroplast DNA capable of distinguishing between Pinus koraiensis and Pinus koraiensis, which is difficult to distinguish in the seedling stage, and a polymerase chain reaction and restriction fragment polymorphism -RFLP) technique can be used to effectively select endemic seedlings for the restoration of snow pine trees and for the establishment of offshore conservation forests.

Description

TECHNICAL FIELD The present invention relates to a method for distinguishing between a pine tree and a pine tree using a primer set composition,

The present invention relates to a method for identifying pine trees and pine trees using a primer set composition, and more particularly, to a method for identifying pine trees and pine trees by polymerase chain reaction and restriction enzyme fragment polymorphism (PCR-RFLP) .

In Genus Pinus , more than 100 species are distributed and are known as the largest genus of conifers (Mirov, NT 1967. The Genus Pinus, Ronald Press Company, New York, NY .; Price, RA, Liston, A., and Strauss, SH 1998. Phylogeny and systematics of Pinus, In Ecology and Biogeography of Pinus, Richardson DM (Ed.), Cambridge University Press. Pinus koraiensis, Pinus koraiensis, and Pinus koraiensis are distributed naturally.

The pine trees and the snow pine trees belong to the soft pine, which has five numbers of shallow leaves in the pine tree. A typical characteristic distinguished from other pine trees is that the pine tree does not have real wings even when matured, and that there are no wings in the seed (Fu, LK, Li, N., and Mill, RR 1999. Pinus . In: Flora of China (eds Wu, ZY and Raven, PH), Vol 4, pp. 11-52. and < / RTI > Missouri Botanical Garden Press, St. Louis.).

The Pinus koraiensis is lower than the Pinus koraiensis, has small cone size, and has a short leaf. The Pinus koraiensis in the alpine region tends to lie down due to strong winds, and it is difficult to distinguish it from the Pinus koraiensis .

Although there is a method to distinguish two species as the type of resinous sphere appearing on the section of the needle, (Korean Journal of Plant Resources 25 (5): 517-522, 2012), the development of the resinous sphere is weak and the shapes are very similar , There are many difficulties in identifying the correct species.

According to the Red List criteria of the International Union for Conservation of Nature and Natural Resources (IUCN), the Pinus densiflora belongs to the Least Concern (LC) (IUCN, 2014. IUCN Red List of Threatened Species, Version 2014.2. <Www.iucnredlist.org>).

However, in Korea, it is limited only in the summit of Mt. Seolak and it is designated as CR (Critically Endangered) because of the high risk of extinction due to deterioration of habitat environment such as climate change. Arboretum 2008. Collection of Korean Rare Plants Collection, Jio North, Seoul, p.

In addition, in order to preserve the snow pine trees in Seoraksan, it is necessary to restore the seedlings from native pine seeds to native habitats, or to establish an offshore conservation forest.

However, as described above, the pine trees which are naturally grown in the high mountain region are not only similar to the snow pine trees but also have a difficulty in identification at the seedling stage, and therefore, development of DNA markers capable of distinguishing the two species at the seedling stage is urgently required .

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made keeping in mind the above problems occurring in the prior art, and an object of the present invention is to provide a DNA- (PCR-RFLP) for identifying pine trees and snow pine trees.

Another object of the present invention is to provide a method for identifying pine wood and pine cones using polymerase chain reaction and restriction enzyme fragment polymorphism (PCR-RFLP).

It is still another object of the present invention to provide a kit for identification of pine wood and pine tree based on DNA mutation which is free from external shape and environmental variation.

The present invention provides a primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, or a primer set of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: A primer set composition for identification of pine trees and snow pine trees.

In addition, the present invention provides a method of identifying pine trees and snow pine trees using the primer set composition.

In addition, the present invention provides a kit for identifying pine trees and snow pine trees comprising the primer set composition.

According to the present invention, using the primer set composition for identifying pine trees and snow pine trees, it is possible to stably and surely distinguish between pine wood and pine tree.

In addition, since DNA can be stably extracted even in a small amount of leaf tissue, it is possible to select the pine trees and the seedling seedlings in young seedlings under three years of age, thereby saving time and cost for restoring the pine tree .

FIG. 1 shows the results of amplification product fractions of polymerase chain reaction amplified with KP-cp14 primer set composition for identifying Pinus koraiensis and Pinus koraiensis (Lane 1 to 10: Pinus koraiensis, Lane 11-20: Pinus koraiensis, M: DNA size marker, N: Negative control ).
FIG. 2 is a photograph showing the fragmentation patterns of cleavage product fractions using Mse I restriction enzyme (lane 1 to 10: pine wood, lane 11 to 20: pine cone, M : DNA size marker).
FIG. 3 is a photograph showing the results of amplification product fractions of polymerase chain reaction amplified with KP-cp15 primer set composition of Pinus koraiensis and Pinus koraiensis (Lane 1 to 10: Pinus koraiensis, Lane 11-20: Pinus koraiensis, M: DNA size marker, ).
FIG. 4 shows the results of fragmentation of the cleavage product fractions using HinP1 I restriction enzyme (lane 1 to 10: pine wood , lane 11 to 20: pine cone, M : DNA size marker).

The present invention relates to a primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, or a primer set of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: Lt; / RTI &gt;

In the present invention, "primer set composition" means a DNA marker used for distinguishing DNA base sequences by electrophoresis.

Also, in the present invention, the term "primer " refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product.

The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer depends on the primer usage conditions such as the complexity of the desired DNA target, temperature and ionic strength.

In the present invention, an oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, And may include intercalating angents.

The base sequence of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2 and the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4 constituting the primer set composition according to the present invention, It was developed based on the chloroplast DNA sequence and is disclosed for the first time by the present invention.

In addition, the present invention provides a method of identifying pine trees and snow pine trees using the primer set composition.

In the present invention, the term " seedlings "means seedlings of three-year-old or younger, with cotyledon remaining partially.

The method for identifying the pine and pine trees of the present invention comprises the steps of (a) extracting template DNA from a sample, (b) amplifying the template DNA extracted in the above step using the primer set composition by a polymerase chain reaction (c) digesting the amplification product by treating the amplification product produced by the above step with a restriction enzyme, and (d) fractionating the cleavage product produced by the above step.

In the identification method of the Pine wood and the Pinus koraiensis according to the present invention, the reaction solution for the polymerase chain reaction is prepared by mixing 25 ng of pine genomic DNA, 25 ng of pine tree genomic DNA, 1 x buffer, 0.2 mM Of dNTPs, 2.5 mM MgCl ₂ , 0.125 units of DNA polymerase and 20 μM of the forward primer of SEQ ID NO: 1 and 20 μM of the reverse primer of SEQ ID NO: 2, or 20 μM of the forward primer of SEQ ID NO: 3 and 20 μM of SEQ ID NO: 4 Reverse primers.

In the identification method of the pine wood and the pinus koraiensis according to the present invention, the amplification of step (b) is performed after denaturation at 94 ° C for 30 seconds, primer binding at 60 ° C for 30 seconds, 72 ° C For 30 seconds, and then a final polymerization process at 72 &lt; 0 &gt; C for 10 minutes can be performed.

In the identification method of the pine wood and pine wood of the present invention, the reaction product for digesting the amplification product by treating the restriction enzyme of the step (c) is 1 x reaction buffer solution and 0.5 unit restriction Enzymes.

In the identification method of the Pine and Pinus koraiensis according to the present invention, the treatment of the restriction enzyme may include a step of activating at 37 캜 for 3 hours and then deactivating at 65 캜 for 20 minutes.

In the identification method of the pine and snow pine trees of the present invention, the sample may be seedlings of pine trees and seedlings of snow pine trees.

The identification method of the Pine wood and the Pinus koraiensis according to the present invention can be distinguished from the Pinus koraiensis and Pinus koraiensis at the seedling stage by using the above-mentioned Pinus koraiensis and Pinus koraiensis.

In addition, the present invention provides a kit for identifying pine trees and snow pine trees comprising the primer set composition.

In the kit for identifying Pinus koraiensis and Pinus koraiensis according to the present invention, the Pinus koraiensis and Pinus koraiensis can be seedlings.

The kit for identifying pine trees and snow pine trees of the present invention can identify pine trees and snow pine trees at the seedling stage by using nanny from pine tree seedlings and snow pine tree as a sample.

The constituents contained in the kit for identifying Pinus koraiensis and Pinus koraiensis according to the present invention and the method for producing the same are all suited to the use of the constituent components and the manufacturing method included in a conventional kit, and a detailed description thereof will be omitted.

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited to these examples.

&Lt; Example 1 > (Extraction and purification of template DNA)

Samples for the extraction and purification of template DNA were obtained from native populations of Daechong - bong area of Mt.

200 mg of leaf samples collected from shrubs of Pinus koraiensis (Pinus densiflora) with a diameter of 13 cm and a diameter of 13 cm and a width of 15 m with a diameter of 25 cm were weighed and placed in a 2 ml microtube together with ceramic beads. DNeasy Plant Mini Kit 400 μl of Buffer AP1 (QIAGEN) and 4 μl of RNase A were added, followed by shaking for 10 minutes at a rate of 30 times / sec using a Tissue Lyser (QIAGEN) to disrupt the leaf sample.

DNA was extracted and purified according to the manufacturer's instructions using DNeasy Plant Mini Kit (QIAGEN).

The final concentration of extracted DNA was diluted to 5 ng / ㎕.

&Lt; Example 2 > (Design of primer)

The nucleotide sequence of the region to be amplified was determined using the pine tree chloroplast sequence (GenBank accession No.AY228468) and the pine tree chloroplast sequence (GenBank accession No.JN854168), and the primer was designed using Primer3 software.

The primer size ranged from 18 to 22 mers, the Tm ranged from 57 ° C to 63 ° C, one GC clamp, and the primer amplified products ranged from 400bp to 450bp.

Table 1 shows the nucleotide sequences of KP-cp14 and KP-cp15 as the primer set compositions of the present invention. The primer sequence combinations are regarded as the combination of the reverse complementary nucleotide sequences and the same primer nucleotide sequence combination do.

Primer set composition The nucleotide sequence (5 → 3) Forward primer Reverse primer KP-cp14  AGCAGCGGTGTAGCATCAG (SEQ ID NO: 1)  CTCCGCAGTTTCAGGATCTC (SEQ ID NO: 2) KP-cp15  CTAGGTGCGAAAAACCAACC (SEQ ID NO: 3)  TCCGGTCTATTGCTCTTTCC (SEQ ID NO: 4)

&Lt; Example 3 > Polymerase chain reaction (PCR)

Using the primer set compositions KP-cp14 and KP-cp15 designed in Example 2, amplification products were generated by performing PCR (PCR) on pine wood and pine wood samples.

The composition of the PCR reaction mixture is as follows.

The PCR reaction solution contained 25 ng of each of pine wood and pine tree genomic DNA, 1 × buffer solution, 20 μM primer, 0.2 mM dNTPs, 2.5 mM MgCl 2 and 0.125 unit Taq DNA polymerase (RBC) per 50 μl.

After the initial denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, primer binding at 60 ° C for 30 seconds, and polymerization at 72 ° C for 30 seconds were repeated 45 times, followed by final polymerization at 72 ° C for 10 minutes Respectively.

Example 4 Production of Cleavage Products by Restriction Fragment Polymorphism (RFLP) Technique

The amplification product generated in Example 3 was treated with a restriction enzyme to generate a cleavage product of the amplification product.

At this time, as the restriction enzyme is a restriction enzyme cutting of was used, the HinP1 I amplification product of Example 3 above primer sets composition KP-cp14 amplification product has Mse I, primer set composition of KP-cp15, respectively, PCR amplification products For the composition of the reaction product, a mixture consisting of 1 × reaction buffer and 0.5 units of restriction enzyme was added per 5 μl of the PCR amplification product.

The Mse I restriction enzyme digestion of the HinP1 I was carried out as the process that was active at 37 ℃ for 3 hours and deactivate at 65 ℃ for 20 minutes.

&Lt; Example 5 > Amplification products and fractions of cleavage products

5 μl of the amplification product generated in Example 3 was removed, and 3 μl of loading dye was mixed. Then, 2% agarose gel electrophoresis was performed. A 100 bp ladder (Fermentas Co., 50 μg / The fractions were simultaneously fractionated to confirm the size of the amplified product fragments. The results are shown in FIG. 1 and FIG.

In addition, 5 mu l of loading dies were mixed with the cleavage product produced in Example 4, followed by 2% agarose gel electrophoresis. A 100 bp ladder (Fermentas, 50 mu g / The result of checking the size of the fragment is shown in FIG. 2 and FIG.

As shown in FIG. 1, when DNA fragments were observed by electrophoresis on agarose gel, a DNA fragment of about 440 bp was commonly observed in both pine and snow pine trees.

As shown in FIG. 3, when DNA fragments were observed by electrophoresis on agarose gel, DNA fragments of about 420 bp were commonly observed in the pine and snow pine trees.

Furthermore, as shown in Figure 2, the primer set composition is by observing the fraction patterns by electrophoresis the Mse I cleavage product of the amplification products using the KP-cp14 from the agarose gel, the pine eye cleavage product of approximately 240bp and 200bp DNA While the cleavage product DNA fragment was not observed in the Pinus koraiensis, and a PCR amplification product of about 440 bp was observed.

As shown in FIG. 4, when the fragment of HinP1 I cleavage product of the amplification product using the primer set composition KP-cp15 was electrophoretographed by agarose gel, the DNA fragments of about 260 bp and 160 bp were observed in the pine wood In contrast, the cleavage product DNA fragment was not observed in the Pinus koraiensis, and the PCR amplification product of about 420 bp was observed.

The sizes of the DNA fragments observed in the above are visually observed values based on the DNA size markers of the electrophoresis. From the nucleotide sequences used for the primer synthesis, the sizes of the base sequences amplified by the primers and the restriction enzymes The approximate size can be estimated based on the calculated length based on the recognition site.

When visually observing the DNA fragments through the electrophoresis, it is possible to display a slightly different value according to the observer by visual observation, but it is considered that the target DNA region is amplified and cleaved as long as there is no large error can do.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, the invention is not limited thereto. Those skilled in the art, on the contrary, And such changes or modifications fall within the scope of the present invention.

According to the present invention, since the pine wood and the snow pine can be stably and reliably distinguished by using the primer set composition for identifying the pine wood and the snow pine tree, the present invention can be utilized as a primer set composition for scientifically assuring the identification of pine wood and snow pine .

In addition, when the above method of the present invention is used, since the pine trees and the snow pine trees can be objectively and scientifically distinguished at the stage of seedlings under three years of age, they can be effectively used for screening seeds for recovery of snow pine trees.

<110> Republic of Korea (Korea Forest Research Institute) <120> Method of distinguishing the Korean pine from the dwarf stone          피인 using molecular marker <130> 9886 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer of KP-cp14 <400> 1 agcagcggtg tagcatcag 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of KP-cp14 <400> 2 ctccgcagtt tcaggatctc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of KP-cp15 <400> 3 ctaggtgcga aaaaccaacc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of KP-cp15 <400> 4 tccggtctat tgctctttcc 20

Claims (11)

A primer set consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, or a primer set of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4. A method for identifying pine trees and snow pine trees using the primer set composition of claim 1. 3. The method of claim 2,
(a). Extracting template DNA from the sample;
(b). Amplifying the template DNA extracted in the step (a) by a polymerase chain reaction using the primer set composition;
(c). Treating the amplification product produced in step (b) with a restriction enzyme to cleave the amplification product; And
(d). And fractionating the cleavage product produced by the step (c). 4. The method according to claim 3, wherein the reaction solution for the polymerase chain reaction comprises 25 ng of the genomic DNA of the genus Pine, 25 ng of the genomic DNA of the pine tree, 1 x buffer, 0.2 mM dNTPs, 2.5 mM MgCl ₂ , 0.125 units of DNA polymerase, 20 μM of the forward primer of SEQ ID NO: 1, 20 μM of the reverse primer of SEQ ID NO: 2, 20 μM of the forward primer of SEQ ID NO: 3 and 20 μM of the reverse primer of SEQ ID NO: 4 Identification of Pinus koraiensis and Pinus koraiensis. 4. The method according to claim 3, wherein the amplification of step (b) comprises: denaturation at 94 DEG C for 30 seconds, primer binding at 60 DEG C for 30 seconds, and polymerization at 72 DEG C for 30 seconds after the initial denaturation step at 94 DEG C for 5 minutes And repeating 45 times, followed by final polymerization at 72 캜 for 10 minutes. [Claim 4] The method according to claim 3, wherein the reaction product for digesting the restriction enzyme of step (c) comprises 1 x reaction buffer solution and 0.5 unit restriction enzyme per 5 l of the PCR amplification product Identification of Pinus koraiensis and Pinus koraiensis. 4. The method of claim 3 wherein the restriction enzyme is a method of identifying and pine Pinus pumila, it characterized in that the Mse I or HinP1 I. 4. The method according to claim 3, wherein the treatment of the restriction enzyme comprises activating at 37 DEG C for 3 hours and then inactivating at 65 DEG C for 20 minutes. 4. The method according to claim 3, wherein the sample is seedlings of Pinus koraiensis and Pinus koraiensis. A kit for identifying pine trees and snow pine trees comprising the primer set composition of claim 1. [Claim 11] The kit for identifying pine trees and snow pine trees according to claim 10, wherein the pine trees and snow pine trees are seedlings.

Images