KR101099624B1 - Specific primer for discrimination of aborted anthers in Citrus tree and uses thereof - Google Patents

Abstract

The present invention relates to a specific primer set for identifying male sterile citrus trees and uses thereof, and more particularly, to a male sterile citrus tree discriminating primer set comprising the oligonucleotide primer sets of SEQ ID NOs: 2 and 3. A kit for determining a male sterile citrus tree comprising, a method for early identification of a male sterile citrus tree using the primer set, and a SCAR molecular marker for determining a male sterile citrus tree amplified by the primer set. .

Citrus fruits, male sterility, primers, RAPD, SCAR

Description

Specific primer for discrimination of aborted anthers in Citrus tree and uses approximately}

The present invention relates to a specific primer of male sterile citrus tree and its use, and more particularly, to a male sterile citrus discrimination primer set including oligonucleotide primer sets of SEQ ID NOs: 2 and 3, and male sterility including the primer set. A kit for discriminating citrus trees, a method for early discrimination of male sterile citrus trees using the primer set, and a SCAR molecular marker for discriminating male sterile citrus trees amplified by the primer set.

One of the most important breeding goals for the citrus fruits and vegetables market and the processing industry is to produce fruit without seeds. Seeds of citrus fruit occur as a result of citrus flower fertilization. However, if citrus flowers lose their ability to produce infertile pollen or to produce normal pollen, the citrus tree will be unitary. This male infertility is dominated by two or more genes by nuclear gene expression or gene-cytoplasmic interactions in Wenzhou Citrus, Hearing Dogs and Encore, and surgery is in the form of yarn and the drug degenerates. In recent years, new varieties of citrus fruits with high quality and no seeds have been introduced in Japan. Most of them are hybridized from breeding parents with male sterility. However, these traits cannot be detected early because they can only be identified in the first flowering stage after the infancy of 4-10 years after hybridization. In order to improve these difficulties, attempts to break the childhood through annular peeling, branching, growth hormone spraying, precocious flowering, and the insertion of the Arabidopsis LEAFY gene have little effect. In addition, hybridization breeding is time-consuming and expensive to assess the expression of key horticultural traits. Therefore, if the molecular markers associated with the target horticultural traits are used, the progeny of hybridization can be easily evaluated, and early selection can effectively overcome the weaknesses of hybrid sarcomas.

Korean Patent Publication No. 2009-0085839 discloses a primer set for selecting tobacco mosaic virus resistant pepper varieties, but is different from the primer set of the present invention.

The present invention is derived from the above requirements, the present invention produced a primer specific for the discrimination of male sterile citrus trees through PCR-RAPD analysis, and the PCR reaction on the citrus, the result of normal operation Early diagnosis can be found to increase the efficiency of breeding and to complete the present invention.

In order to solve the above problems, the present invention provides a specific primer set that can be used to determine male sterile citrus trees.

The present invention also provides a kit for determining a male sterile citrus tree comprising the primer set.

The present invention also provides a method for early discrimination of male sterile citrus trees using the primer set.

The present invention also provides a SCAR molecular marker for discriminating male sterile citrus trees amplified by the primer set.

According to the present invention, it is possible to early diagnose the presence or absence of pollen development of the stamen, which is a trait that can be identified in the flowering stage after 4-10 years or more in childhood in citrus fruits by using genomic DNA of leaves within 1 year after seed sowing. In addition, early selection of seedless citrus fruits due to male infertility that results in degeneration of abnormal pollen (sterile pollen) or pollen due to deterioration of surgery during hybridization, can reduce the effort and cost of generation progress and breeding. .

In order to achieve the object of the present invention, the present invention provides at least 15 oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. Provided is a primer set for male sterility citrus tree discrimination comprising one or more oligonucleotides selected from the group consisting of oligonucleotides consisting of segments of consecutive nucleotides.

The oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO: 2. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of fragments of at least 16, at least 17, at least 18, at least 19, at least 20 consecutive nucleotides in the sequence of SEQ ID NO.

The primer set of the present invention may preferably comprise an oligonucleotide primer set of SEQ ID NOs: 2 and 3. In addition, the primers may include sequences added, deleted or substituted with the nucleotide sequences of SEQ ID NO: 2 and SEQ ID NO: 3.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

Oligonucleotide primer sets according to the present invention; And a kit for determining a male sterile citrus tree, comprising a reagent for performing an amplification reaction.

In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers and the like. In addition, the kits of the present invention may further comprise a user guide describing the optimal reaction performance conditions. The guide is a printed document that explains how to use the kit, such as how to prepare a PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

In order to achieve another object of the present invention, the present invention

Separating genomic DNA from citrus fruits;

Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using a primer set according to the present invention; And

It provides a method for identifying a male sterile citrus tree early, comprising the step of detecting the amplification product. Preferably, the citrus fruit may be a breeding fruit citrus fruit using a mating breed as a parent breed or a breeding animal as a breeding breed as a hearing breed, but is not limited thereto.

The method includes the step of separating genomic DNA from citrus samples. As a method for separating genomic DNA from the sample, a method known in the art may be used. For example, the CTAB method may be used, or a wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using an oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. The oligonucleotide primer set used to amplify the target sequence is as described above.

The present invention also provides a SCAR molecular marker for discriminating male sterile citrus trees amplified by the primer set. The marker may preferably consist of the nucleotide sequence of SEQ ID NO: 1.

The SCAR molecular marker refers to a DNA molecular marker amplified by a primer set for discriminating male infertility citrus trees, in the case of male fertility, DNA is amplified to detect a band during electrophoresis, and in the case of male infertility, DNA is amplified. Bands cannot be detected.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  One: PCR - RAPD  Analysis and Selection of Singular Bands

Citrus fruits have varieties with traits that deteriorate the stamens of flowers, making it impossible to produce sterile pollen or pollen. It was conceived that the progeny of such traits can be used to design primers that specifically identify male sterility.

Citrus spp. Of male infertility and C. sunki of male fertility, and the 1,000 F1 individuals that crossed and nurtured them. Embryonic 150 individuals were used for PCR-RAPD (random amplified polymorphic DNA) and SCAR (sequence characterized amplified region) molecular markers.

 Surgical degeneration of the flowers was evaluated by careful examination of 10 flowers per tree at the time of flowering in three repetitions. The main criterion for male sterile trees was degeneration of a filamentous stamen with undeveloped pollen bags on mature flowers.

Genomic DNA was extracted from Promega's plant tissue DNA prep cartridge using Automatic Nucleic Acid Extractor MX-16 (Compacbio Sciences Co.) from pulmonary tissues pulverized with liquid nitrogen. The extraction state of DNA was observed by electrophoresis on 1.2% agarose gel, and the amount of DNA was measured by directly staining with ethidium bromide (EtBr) by arranging lambda DNA (Lambda DNA) in a series of concentrations.

PCR-RAPD analysis was modified with the method of Li and Quiros (2001, Theoretical and Applied Genetics, 103, 455-461) and 197 primers were used. PCR reaction solution was mixed with Accupower PCR premix (Bioneer, Korea) (dNTP 250uM, MgCl ₂ 1.5mM, Taq DNA polymerase 1 unit, Tris-HCl 10mM, KCl 40mM) by adding 25ng template DNA and 50pM primer. Was prepared in 20 μl. PCR products were subjected to initial DNA denaturation at 94 ° C. for 5 minutes using a PCR Thermal Cycler Dice Gradient TP600 (TaKaRa, Japan) model, followed by re-denaturation at 94 ° C. for 1 minute, followed by annealing of the primer at 35 ° C. for 1 minute. After annealing), a series of processes that were extended at 72 ° C. for 2 minutes was repeated 45 times in one cycle and finally reacted at 72 ° C. for 10 minutes. The amplified DNA product was subjected to electrophoresis for 40 minutes at 100V on a 1.2% agarose gel using 1 × TAE buffer, and then stained with ethidium bromide to elute specific bands by UV transilluminator.

Example  2: Male Fertility  Singular band Cloning and  Sequencing

PCR was performed with selected markers to clone male fertility specific bands, and then the product was electrophoresed on a 1.2% low melting agarose gel and then the specific bands were cut out on a UV transilluminator. The obtained agarose gel was transferred to a microtube, and then buffered, and then dissolved in a water bath at 42 ° C. for 10 minutes to completely dissolve the DNA. The DNA was purely separated using a Wizard PCR Prep DNA purification system (Promega, USA). The isolated DNA was finally dissolved in sterile water and used for cloning (Soltis and Soltis, 1997, American Journal of Botany, 84 (4), 504-522).

Specific band DNA amplified by PCR was cloned into the Topo Cloning kit pCR 2.1-Topo vector (Invitrogen Co.). The PCR product was cloned into pCR 2.1-Topo and then transformed back into Topo Supercompetent Cells (E. coli). White colonies were selected after incubation at 37 ° C. for 18 hours using LB medium containing 40 mg / mL X-gal and 50 ng / mL ampicillin. The selected white colonies were shaken at 250 rpm for 8 hours at 37 ° C using liquid 2 × YT medium. Plasmids from the cultured Escherichia coli were isolated and purified using Wizard PCR Prep DNA purification system (Promega). The isolated plasmid DNA was treated with restriction enzyme EcoR I for 1 hour at 37 ° C., and then cloned onto 1.2% agarose gel. DNA sequences were determined using an automatic DNA sequencer (ABI 3730XL, Applied Biosystems. Foster. CA, USA) (FIG. 3, SEQ ID NO: 1).

Example  3: SCAR Of primer  Production department Male Infertility  Specific Detection for the Classification of Citrus Fruits Of primer  Applicability Check

DNA fragments that have been cloned and sequenced have been characterized and analyzed using the Gene Search and Blast programs of the National Center for Biotechnology Information (NCBI) and Clustal W, a multiple alignments program. The homology between them was compared, and based on this result, SCAR primers of 19-22 base length were prepared (Table 1). In order to examine the potential of citrus male fertility screening markers, the prepared SCAR primers were subjected to PCR by distinguishing between surgical degeneration and normal surgical strains during the hybridization of dogs and tangerines, and dogs and tangerines, and the same reaction solution as in PCR-RAPD. Was used. The PCR reaction denatured the DNA for 5 minutes at 94 ° C., and then amplified a total of 35 times at 1 minute at 94 ° C., 1 minute at 35 ° C., and 2 minutes at 72 ° C., and then formed dimers at 72 ° C. for 10 minutes. It was. These PCR products were stabilized at 4 ° C., followed by electrophoresis for 40 minutes at 100 V on a 1.2% agarose gel, followed by ultraviolet irradiation to identify amplified DNA bands. At this time, about 1.4kb in size of DNA bands were amplified in individuals in which the stamens of citrus flowers were normally developed, and DNA bands were not amplified in individuals (male sterility) in which the pollen of the surgery was degraded (FIG. 1 and 2).

Table 1. SCAR  Used for analysis Of primer  Sequence

primer Sequence (5'-3 ') pMS33U GGGCAAGTATCGCAACCCCT (SEQ ID NO: 2) pMS1462L CTTGAGAGGTGTAGTATAAGT (SEQ ID NO: 3)

1 is a real dog obtained by hybridizing using the pollen of the plant with the model of the 'green dog' having the nature of pollen degenerate using the primer pMS33U + pMS1462L and the 'citrus' normally has the nature of surgery surgery, Among them, the degenerated and normal individuals were selected, and then the lobe DNA was extracted and PCR amplified.

Lane M: molecular size marker, lane PMS: dog, lane PMF: tangerine

Lanes 1, 3, 5, 7, 9, 11: dog tangerine hybridization posterior pollen degeneration

Lanes 2, 4, 6, 8, 10, 12, 14: dog tangerine hybridization progeny normal pollen object

Figure 2 is a primer using the primer pMS33U + pMS1462L pollen degenerate and 'byeongtang' with the nature of normal surgery development, and the real dog obtained by hybridizing using the pollen of the bottle as a model Among them, the degenerated and normal individuals were selected, and then the lobe DNA was extracted and PCR amplified.

Lane M: molecular marker, lane K: dog, lane B: tangerine

Lanes 1-6: dog bottle tangerine hybridization normal pollen individuals

Lanes 7-14: dog bottle tangerine hybridization pollen degeneration

Figure 3 shows the DNA sequence of a specific nucleotide band in which the surgery is common to normal individuals among the real subjects obtained by hybridization using the pollen of the tangerine, which is modeled after the 'citrus' hearing in which the surgery normally develops.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Specific primer for discrimination of aborted anthers in Citrus          tree and uses according <130> PN09271 <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 1487 <212> DNA <213> Citrus sunki <400> 1 tgagtccaaa ccgggcgggg ggcctcccga gggggcaagt atcgcaaccc ctctcgacga 60 aacgggaaaa ataatgcggg agaccctgga cccatttttc ggccaaaaag ggccaaaatc 120 cttgcgccaa atttcgagtt ttcgggccgg cgtgggattt ttggctgata ttgttagcca 180 caggctcttt ggccaaattt cgcctttgtg ccagccactt agattttgca gagagttagc 240 ctcatgaaaa agcacaagtc cactccgagg cccgagctag cctcctttcg gagccatcac 300 acaagtcttt gtgccagagt tagcctcagg cattggagca agtgtgctgc ctttgtgcca 360 gccacttaga ttttgccgag agttagcctc gtgaaaaaac acaagtccac tccgagcctt 420 gggcgggggc agtccgtgcg ggcgtgtgcg ccgcaggggg ctaacctccg gcgggttccg 480 aacaagagaa gacggtgcga gtgagggggg agggacgaat ctgagcgacg tagggctgaa 540 tctcagtgga tcgtggcagc aaggccactc tgccacttac aataccccgt cgcgtattta 600 agtcgtctgc aaaggattct acccgccgct cgatgggaat tacgattcaa ggcggccgcc 660 gcggcccttc cgccgcgggg gcttggccta cgacacgtgc ctctggggac cgggaggtcc 720 ctactgcggg tcggcaaacg ggcggcgggc gcacgcgtcg ctctagcccg gattctgact 780 tagaggcgtt cagtcataat ccagcgcacg gtagcttcgc gccactggct tttcaaccaa 840 gcgcgatgac caattgtgcg aatcaacggg ttcctctcgt actaggttga attactatta 900 cgacgcagtc atcagtangt aaaactaacc tgtctcacga cggtctaaac ccagctcacg 960 ttccctattg gtgggtgaac aatccaacac ttggtgaatt ctgcttcaca atgataggaa 1020 gagccgacat cgaaggatca aaaagcaacg tcgctatgaa cgcttggctg ccacaagcca 1080 gttatccctg tggtaacttt tctgacacct ctagcttcaa attccgaagg tctaaaggat 1140 cgataggcca cgctttcaca gttcgtattc gtactgaaaa tcagaatcaa acgagctttt 1200 acccttttgt tccacacgag atttctgttc tcgttgagct catcttagga cacctgcgtt 1260 atcttttaac agatgtgccg ccccagccaa actccccacc tgacaatgtc tttcgcccgg 1320 atcggccccc gtgagggggc cttgggtcca aaaagagggg cagtgccccg cctccgattc 1380 acggaataag taaaataacg ttaaaagtag tggtatttca ctttcgccgt ttccggctcc 1440 cacttatact acacctctca agtcatttca caaattcgta cgcagtc 1487 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMS33U primer <400> 2 gggcaagtat cgcaacccct 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pMS1462L primer <400> 3 cttgagaggt gtagtataag t 21  

Claims (9)

At least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 2 and A primer set for discriminating a male sterile citrus tree, comprising one or more oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of 15 or more consecutive nucleotides in the sequence of SEQ ID NO. The primer set according to claim 1, wherein the male infertile citrus tree comprises a set of oligonucleotide primers of SEQ ID NOs: 2 and 3. A primer set according to claim 1; And a reagent for performing an amplification reaction. The kit of claim 3, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. Separating genomic DNA from citrus fruits; Amplifying a target sequence by using the isolated genomic DNA as a template, and performing an amplification reaction using a primer set according to claim 1 or 2; And Detecting the amplified product, the method for early discrimination of male sterile citrus trees. 6. The method of claim 5, wherein the citrus fruit is a mating fruit using a breeding model of a dog or a mating breed of a breeding animal. The method of claim 5, wherein the detection of the amplification product is carried out through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. SCAR molecular marker for discriminating male sterile citrus trees amplified by a primer set according to claim 1. 9. The SCAR molecular marker according to claim 8, wherein the marker consists of the nucleotide sequence of SEQ ID NO: 1.

Images