KR102511995B1 - Primer set for discriminating Adenophora triphylla var. japonica Hara, Adenophora remotiflorus Miquel and Codonopsis lanceolata (Siebold Zucc.) Trautv DNA Barcode and uses thereof - Google Patents

Abstract

The present invention relates to a set of primers for discriminating herbal medicine residues, mosses and deodeok using DNA barcodes, and uses thereof.
The primer set provided by the present invention is a genetic marker based on a nucleotide sequence representing a single nucleotide polymorphism (SNP) in the rbcL gene present in the chloroplast genome, and is PCR for genomic DNA of a sample using the genetic marker. By performing, it is possible to simultaneously discriminate between moss, moss and deodeok simply based on the size of the PCR product.

Description

Primer set for discriminating herbal medicine residue, moss and deodeok using DNA barcode and its use {Primer set for discriminating Adenophora triphylla var. japonica Hara, Adenophora remotiflorus Miquel and Codonopsis lanceolata (Siebold Zucc.) Trautv DNA Barcode and uses its}

The present invention relates to a set of primers for discriminating herbal remnants, mosses and deodeok using DNA barcodes, and uses thereof, in order to distinguish from ramie and deodeok, which are similar herbal remnants of herbal medicine.

It is described as the root of Adenophora triphylla var. japonica Hara or four ginseng ( Adenophora stricta Miq. (Campanulaceae)) in the Herbal Medicine (Cerber Medicine) Specifications. It is used for dry throat, dry cough, phlegm, seawater, asthma, etc. by replenishing the essence to enrich the lungs, cooling the heat and removing phlegm due to the effect of expectoration. It is used for constipation symptoms such as dry mouth, dry throat, and hard stool due to lack of gastric yin.

Mossidae ( Adenophora remotiflorus Miquel ), a plant of the same genus of Zandae, is called haeng-yeopchae, haeng-yeop, and ginseng in oriental medicine. . The root of Mosidae is a bell-shaped whole flower, and it is very morphologically similar to the back of a lampshade (Sasaeng), which has a corolla that splits into 5 at the end.

In addition, there are plants of the genus Codonopsis (Deodeok) as similar herbal medicines and mixed products distributed as ginseng. Deodeok ( Codonopsis lanceolata (Siebold & Zucc.) Trautv.) belongs to the genus Bellflower and the monotonic group rather than the genus Zandae, but in many ancient documents such as Hangyakjipseongbang (1433) and Donguibogam (1613), the origin plant of Zandae (Ssam) is recorded as Deodeok. This has led to continued confusion in the literature on the plant of origin. In this way, there is confusion such as Mosidae and Deodeok being used or distributed as jandae (four ginsengs), and it is required to reestablish the origin plant for jandae (four ginsengs).

As a technology for distinguishing herbal medicines similar to zandae, Korean Patent Registration No. 10-1912194 "Molecular marker and primer set for distinguishing deodeok and zandae and their uses" and Korean Patent Registration No. 10-1912933 "Deodeok and zandae" Molecular Marker and Primer Set for Distinction and Their Use” is insertion/deletion marker (InDel, insertion/deletion) marker, that is, insertion of nucleotide sequence between breeds through DNA sequencing analysis at a specific location to discriminate between gnats and deodeoks. Or, it relates to a technology that can differentiate between a chinensis and a deodeok by developing a PCR primer based on a deletion and a difference in PCR product size. In this patent, the InDel marker can discriminate between a chinensis and a deodeok, but it cannot distinguish a moss. In addition, since insertion/deletion does not occur in all varieties, if there is no insertion/deletion site between the moss and the moss, it is not possible to simultaneously identify the moss, moss, and deodeok using this technology.

In addition, Republic of Korea Patent Publication No. 10-1948389 「Method for Discriminating Deodeok and Deodeok Using SSR Marker」 is a simple sequence repeat (SSR) marker, that is, repetition of a short base sequence, to discriminate deodeok and deodeok. It relates to a technique for discriminating a residue by confirming the genetic polymorphism of a deodeok and a residue using a method of analyzing the genetic diversity represented by the made part. This patent is a technology that can only distinguish between jandae and deodeok, and cannot distinguish between jandae and mosidae. In addition, after extracting genomic DNA from plants, the DNA is amplified by PCR, and then PCR amplification is performed once again with SSR marker-based primers to proceed with a total of two PCR steps.

Accordingly, the present inventors conducted a direct comparative analysis of DNA in order to discriminate the exact authenticity of medicinal plants distributed under the name of Zandae (Sasam), and single nucleotide polymorphism (SNP) present in genomic DNA of Zandae, Mosidae and Deodeok. , single nucleotide polymorphism), the present invention was completed by confirming that it was possible to simultaneously discriminate moss, moss, and deodeok with a single analysis by producing a primer set capable of discriminating species.

Republic of Korea Patent Registration No. 10-1912194 Republic of Korea Patent Registration No. 10-1912933 Republic of Korea Patent Registration No. 10-1948389

An object of the present invention is to provide a set of primers for discrimination of herbal medicine residues, moss and deodeok.

Another object of the present invention is to provide a kit for discriminating moss, moss and deodeok including the primer set.

Another object of the present invention is to provide a method for determining herbal medicine residues, moss and deodeok.

In order to achieve the above object, the present invention includes a primer set represented by SEQ ID NOs: 1 to 3 ( Adenophora triphylla var. japonica Hara), mother-of-pearl ( Adenophora remotiflorus Miquel) and deodeok ( Codonopsis lanceolata (Siebold & Zucc .) Trautv.) Provides a set of primers for discrimination.

In the present invention, it is characterized in that it includes the primer set.

In the present invention, the kit is characterized in that it includes a thermostable DNA polymerase, dNTPs and a buffer.

In addition, the present invention comprises the steps of a) separating genomic DNA from suspected samples of moss, moss and deodeok; b) mixing primer sets represented by SEQ ID NOs: 1 to 3; c) performing an amplification reaction using the isolated genomic DNA as a template and using the primer set; and d) analyzing the amplification product obtained in the amplification reaction.

In the present invention, it is characterized in that the suspected sample of ramie, ramie and deodeok is a product processed into the roots, fragments and powders of plants suspected of ramie, ramie and deodeok.

In the present invention, the step of analyzing the amplification product is characterized in that it is performed through gel electrophoresis, fluorescence measurement, and UV measurement.

The primer set provided by the present invention is a genetic marker based on a nucleotide sequence representing a single nucleotide polymorphism (SNP) within the rbcL gene present in the chloroplast genomes of chinensis, moss and deodeok, using the genetic markers of the present invention Therefore, if PCR is performed on the genomic DNA of the sample, it is possible to simply discriminate the residue from Mosidae and Deodeok at the same time based on the size of the PCR product.

Figure 1 shows samples of Sample Nos. 1 to 7 using a primer set comprising the nucleotide sequences of SEQ ID NOs: 1 to 3 of the present invention ( Adenophora triphilla var. japonica Hara), mother's time ( Adenophora remotiflorus Miquel) and deodeok ( Codonopsis lanceolata ( Siebold & Zucc.) Trautv.) shows the results of performing multiplex PCR on standard samples.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclatures used herein are those well known and commonly used in the art.

Throughout the present specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.

According to one embodiment of the present invention, the present invention includes a primer set represented by SEQ ID NOs: 1 to 3 ( Adenophora triphylla var. japonica Hara), mother-of-pearl ( Adenophora remotiflorus Miquel) and deodeok ( Codonopsis lanceolata (Siebold & Zucc .) Trautv.) It relates to a primer set for discrimination.

The primer set may include oligonucleotides composed of fragments of 17 to 30 consecutive nucleotide sequences in SEQ ID NOs: 1 to 3.

The primer set represented by SEQ ID NOs: 1 and 2 is a nucleotide sequence commonly present in the rbcL gene of the chloroplast genome of Zandi, Moss and Deodeok, which can be confirmed in the PCR process. A set of primers for the control group.

In addition, the primer set represented by SEQ ID NO: 3 may include added, deleted or substituted sequences.

The primer represented by SEQ ID NO: 3 is not confirmed in Mosquito and Deodeok, but is a nucleotide sequence that is specifically present in the rbcL gene of the chloroplast genome of Zandi, and the primer sets represented by SEQ ID NOs: 2 and 3 are It is a primer that can specifically distinguish residues.

According to one embodiment of the present invention, the present invention provides a kit for discriminating moss, moss and deodeok including the primer set.

The kit may further include reagents for performing an amplification reaction. The reagent may include, but is not limited to, a thermostable DNA polymerase, dNTPs, and a buffer.

According to one embodiment of the present invention, the present invention comprises the steps of a) isolating genomic DNA from a suspected sample of moss, moss and deodeok; b) mixing primer sets represented by SEQ ID NOs: 1 to 3; c) performing an amplification reaction using the isolated genomic DNA as a template and using the primer set; And d) it relates to a method for discriminating between moss and deodeok including the step of analyzing the amplification product obtained in the amplification reaction.

The suspected sample of ramie, ramie and deodeok may be a product processed into roots, fragments and powders of plants suspected of ramie, ramie and deodeok.

The method for isolating genomic DNA in the step of isolating genomic DNA from the suspected samples of moss, moss and deodeok can use a method known in the art, for example, the CTAB method, and DNeasy plant mini kit (Qiagen).

A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set.

Analyzing the amplification product may be performed through gel electrophoresis, fluorescence measurement, and UV measurement, but is not limited thereto. As one of the methods for analyzing the amplification product, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product.

The discrimination method is characterized by using a multiplex polymerase chain reaction (PCR) analysis technique capable of simultaneously reacting with the primer sets represented by SEQ ID NOs: 1 to 3 under one analysis condition.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it is to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. It will be self-evident.

<Example 1> Standard sample preparation and DNA extraction of chindae, ramie and deodeok

Adenophora triphilla var. japonica Hara used in the experiment was distributed as standard herbal medicine powder from Donguibogam Material Bank and stored in a deep-freezer at -80 ° C (sale number: D160705159). In addition, the seedlings ( Adenophora remotiflorus Miquel) and deodeok ( Codonopsis lanceolata (Siebold & Zucc.) Trautv.) used in the experiment were distributed from the Wildlife Genetic Resources Bank of the National Institute of Biological Resources by collection site and stored in a deep-freezer at -80 ° C. . The residue was distributed in powder form, and genomic DNA was extracted using the DNeasy plant mini kit (Qiagen) according to the manufacturer's manual, eluted in nuclease free water, and the extracted DNA was stored frozen at -20 ° C for use.

Table 1 below shows the distribution numbers of distributed resources.

sample number parcel number sales agency ??number of people gathering place One D160705159 Donguibogam Material Bank Adenophora triphilla var. japonica Hara Jilin, China 2 NIBRGR0000608309 National Institute of Biological Resources Wildlife Genetic Resources Bank Adenophora remotiflorus Miquel Gangwon-do Pyeongchang 3 NIBRGR0000608310 Gyeongsangbuk-do Yeongju 4 NIBRGR0000608311 Gurye, Jeollanam-do 5 NIBRGR0000605152 Codonopsis lanceolata (Siebold & Zucc.) Trautv. Jeollabuk-do Jangsu 6 NIBRGR0000416909 Namhae, Gyeongsangnam-do 7 NIBRGR0000432482 Chungcheongnam-do Budget

<Example 2> Chloroplast-based rbcL SNP marker for discriminating chinensis, hairy stage and deodeok

In order to confirm single nucleotide polymorphism (SNP) in the chloroplast gene, sequencing of the rbcL gene of Zandae, Mosidae and Deodeok was performed. After that, the NCBI nucleotide blast program was used to compare and analyze the rbcL gene sequences of mosses, mosses, and deodeok to identify SNP regions where specific nucleotide sequences other than those of mosses and deodeok exist. In addition, a primer set capable of amplifying the SNP region specifically present in the rbcL gene of the bed was prepared to develop rbcL SNP markers capable of discriminating between the bed, the bed, and the deodeok, and are shown in Table 2 below.

sequence number Primer name Base sequence (5`→3`) Size (bp) One rbcL_Con(F) TCGTCCCCTATTGGGATGTA 497 2 rbcL_Con(R) CTACGGTCCCGGAGTGAATA 497, 225 3 rbcL_tSNP(F) CAGAGAGTTGGGAGTTCCTAGCA 225

<Example 3> Gene marker amplification using polymerase chain reaction (PCR)

Dilute the genomic DNA of the stalk extracted using the DNA prep kit and the DNA of the seedlings and the deodeok to 10 ng/uL, mix 1uL of DNA, 9uL of primer (Table 2) and distilled water mixture, and 10uL of 2X TOPsimple™ DyeMIX to make 20uL of A PCR reaction mixture was prepared. The PCR process was initial denaturation at 94° C. for 4 minutes; The process of denaturation at 95°C for 30 seconds, annealing at 56.5-61.5°C for 30 seconds, and extension at 72°C for 1 minute was repeated a total of 35 times; Final extension was performed under conditions of 72° C. and 10 minutes. PCR amplification products were electrophoresed on a 1% agarose gel and confirmed using a UV illuminator (bio-rad, chemidoc).

<Example 4> Distinguishment of moss, moss and deodeok using rbcL SNP marker

In order to confirm that the developed genetic marker, the rbcL SNP marker, can discriminate between moss, moss and deodeok, multiplex PCR analysis was performed using DNA samples of moss, moss and deodeok as templates.

As a result, as shown in FIG. 1, bands of 225 bp and 497 bp were confirmed in the residue, and bands of 497 bp were confirmed in the moss and deodeok, confirming that the herbal medicines of moss and deodeok were distinguished from the residue. In addition, it was confirmed that the rbcL SNP markers were distinguished from the mother-of-pearl and deodeok regardless of the collection site.

Having described specific parts of the present invention in detail above, it will be clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> GFC Life Science Co., Ltd. <120> Primer set for discriminating Adenophora triphylla var. japonica Hara, Adenophora remotiflorus Miquel and Codonopsis lanceolata (Siebold & Zucc.) Trautv DNA Barcode and uses its <130> P20268 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> rbcL_Con(F) <400> 1 tcgtccccta ttgggatgta 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> rbcL_Con(R) <400> 2 ctacggtccc ggagtgaata 20 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> rbcL_tSNP(F) <400> 3 cagagagttg ggagttccta gca 23

Claims (6)

Zandae ( Adenophora triphylla var. japonica Hara), Mosidae ( Adenophora remotiflorus Miquel) and Deodeok ( Codonopsis lanceolata (Siebold & Zucc.) Trautv.) discrimination primer set including the primer set represented by SEQ ID NOs: 1 to 3.
A kit for discriminating moss, moss and deodeok containing the primer set of claim 1.
The kit according to claim 2, wherein the kit comprises a thermostable DNA polymerase, dNTPs and a buffer.
a) isolating genomic DNA from suspected samples of chinensis, moss and deodeok; b) mixing primer sets represented by SEQ ID NOs: 1 to 3; c) performing an amplification reaction using the isolated genomic DNA as a template and using the primer set; and d) analyzing the amplification product obtained in the amplification reaction.
The method of claim 4, wherein the suspected sample of moss, ramie and deodeok is a product processed into the root, fragment form and powder of a plant suspected of moss, moss and deodeok. method.
The method of claim 4, wherein the step of analyzing the amplification product is performed through gel electrophoresis, fluorescence measurement, and UV measurement.

Images