CN108517373B

CN108517373B - InDel labeled primer pair for distinguishing five pepper cultivars and application thereof

Info

Publication number: CN108517373B
Application number: CN201810499212.7A
Authority: CN
Inventors: 郭广君; 王述彬; 潘宝贵; 刘金兵; 刁卫平; 戈伟; 高长洲
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2021-10-19
Anticipated expiration: 2038-05-23
Also published as: CN108517373A

Abstract

The invention discloses an InDel labeled primer pair for distinguishing five pepper cultivars and application thereof. An Indel-labeled primer pair for distinguishing five pepper cultivars consists of a forward primer shown by SEQ ID NO.1 and a reverse primer shown by SEQ ID NO. 2. Performing PCR expansion by using the genomic DNA of five pepper cultivars; if the molecular marker band of 133bp exists, the capsicum is annual capsicum; if 135bp exists, the pepper is shrubbery pepper; if the molecular marker band of 138bp exists, the Chinese pepper is obtained; if a molecular marker band of 141bp exists, the capsicum is a ptosis capsicum; and if the molecular marker band of 148bp exists, the gene is the pimiento. The mark can be used for distinguishing five cultivars of pepper and hybrids thereof, provides molecular basis for division of pepper cultivars, and provides a more reliable and accurate identification method for identification of distant hybrids.

Description

InDel labeled primer pair for distinguishing five pepper cultivars and application thereof

Technical Field

The invention relates to an InDel labeled primer pair for distinguishing five pepper cultivars and application thereof, belonging to the field of agricultural biotechnology engineering.

Technical Field

Capsicum is one of the very important vegetable crops in solanaceae, and originates in the central and south america. Because the pepper has the functions of vegetables and seasonings, the pepper has extremely high economic value worldwide. There are 31 identified species of capsicum, including five capsicum cultivars, each of which is: annual peppers (Capsicum annuum L.), chinese peppers (Capsicum chinense Jacq.), shrub peppers (Capsicum frutescens L.), drooping peppers (Capsicum baccatum L.), and soft-haired peppers (Capsicum pubescens Ruiz & Pavon). There are many morphological differences in traits among 5 cultivars, such as the most obvious colors of flowers and seeds.

The traditional plant classification is based on the morphological characteristics of plants, i.e. according to the characteristics of organs such as stems, leaves, flowers and fruits. Although the morphological method is simple and intuitive, the method is easily influenced by the environment and has low repeatability; it is difficult to classify between genotypes with closely related traits by phenotypic observation. The molecular marker has good stability, large information amount, high analysis efficiency, high genetic polymorphism and wide application foundation. Insertion/deletion polymorphisms (indels) are length polymorphic variations due to the insertion/deletion of nucleotide fragments in the DNA sequence at an allelic site between different individuals. The polymorphism frequency of the InDel marker is second to that of the SNP marker and is far higher than that of the SSR marker in the whole genome. The InDel marker polymorphism can achieve the purpose of genotyping through simple steps of Polymerase Chain Reaction (PCR), agarose gel electrophoresis or non-denaturing polyacrylamide gel electrophoresis and the like. The InDel marker is a co-dominant marker and is widely applied to the fields of high-resolution map construction, association analysis, gene positioning, germplasm resource polymorphism analysis and the like.

The invention can distinguish five cultivars of the pepper by utilizing one InDel mark, and has great application value in research aspects such as the phytology classification of pepper cultivar germplasm, the identification of hybrid seeds and the like.

Disclosure of Invention

The invention aims to rapidly and accurately distinguish 5 pepper cultivars by using 1InDel marker, perform phytological classification on new pepper germplasm and identify interspecific hybrids of five cultivars.

The purpose of the invention can be realized by the following technical scheme:

an InDel labeled primer pair for distinguishing five pepper cultivars consists of the following primers:

forward primer sequence: GACCCCACTTTGTGGGAATA (SEQ ID NO.1)

Reverse primer sequence: TGCTTGCCAGGGATATTTTT (SEQ ID NO.2)

The method for distinguishing five pepper cultivars by using the primers comprises the following steps:

1) extracting pepper genome DNA;

2) performing PCR amplification on pepper genome DNA by using the primer;

a. and (3) PCR reaction system: 50 ng/. mu.l of DNA template 0.5. mu.l; 0.5. mu.l of 10. mu. mol/L primer pair; 10 × PCR buffer 1.0 μ l; 25mmol/L MgCl21.0. mu.l; 0.25 μ L of 10mmol/L dNTPs; 5U/. mu.l Taq DNA Polymerase 0.1. mu.l; ddH2O 6.65. mu.l; or 0.5 mul of 50 ng/mul of DNA template is adopted; 0.5. mu.l of 10. mu. mol/L primer pair;

GreenMaster Mix 5μl；ddH2O 3μl；

b. reaction procedure: pre-denaturation at 94 ℃ for 3 min; 30 cycles of 94 ℃ denaturation for 20sec, 55 ℃ annealing for 30sec, and 72 ℃ extension for 40sec per cycle; finally, extension is carried out for 7min at 72 ℃;

3) performing polyacrylamide gel electrophoresis on the PCR extension product, and if a molecular marker band of 133bp exists, determining that the PCR extension product is annual hot pepper (Capsicum annuum); if a 135bp molecular marker band exists, the band is shrubbery pepper (Capsicum frutescens); chinese pepper (Capsicum Chinese) if there is 138bp molecular marker band; if a molecular marker band with 141bp exists, the Capsicum is ptopetalum (Capsicum baccatum); and if the molecular marker band of 148bp exists, the molecular marker band is the paprika (Capsicum Pubescens).

Advantageous effects

The invention has the advantages that: the InDel marker is convenient to operate and simple in banding pattern, 5 pepper cultivars and interspecies hybrids thereof can be distinguished by 1 marker, and manpower, material resources and financial resources are greatly saved in the aspects of classification of new germplasm and identification of hybrids.

Drawings

FIG. 1 amplification results of InDel marker InDel-2-3b-25 in 10 cultivar materials

M is Marker; 1 and 2: capsicum annuum species; 3 and 4: capsicum fraction species; 5 and 6: capsicum Chinese species; 7 and 8: capsicum baccatum species; 9 and 10: materials of the Capsicum Pubescens variety.

FIG. 2 amplification results of InDel marker InDel-2-3b-22 in 55 cultivar materials

M is Marker; 1-9: capsicum annuum species; 10-20: capsicum fraction species; 21-36: capsicum Chinese species; 37-50: capsicum baccatum species; 51-55: materials of the Capsicum Pubescens variety.

Detailed Description

1. Test material

The two materials for re-sequencing comprise G29, belong to Capsicum annuum, are high-generation inbred line materials and are from vegetable research institute of agricultural academy of sciences of Jiangsu province; PBC688, belonging to Capsicum frutescens, was introduced from Asian vegetable centers. 55 pepper material portions for verifying the marker accuracy, all derived from the international Plant Germplasm System (NPGS), belong to 5 pepper cultivars, respectively, as detailed in table 1.

TABLE 155 parts of Material for verification of marking accuracy

InDel marker development

And (5) comparing the re-sequencing data with a reference genome to search an InDel locus. The reference genome version was peper.V.1.55, download the website http:// peppergenome.snu.ac.kr/download.php. Annual peppers (Capsicum annum) G29 and shrubber peppers (Capsicum frutescens) PBC688 were sequenced using the illumina HiSeqTM2500 sequencing platform. The position of the clear Reads on the reference genome was mapped using the bwa software alignment. According to the positioning result of Clean Reads in a reference genome, preprocessing such as deduplication (Mark duplicates) is performed by using Samtools, Local duplication (Local duplication) and Base quality value correction (Base redundancy) is performed by using GATK so as to ensure the accuracy of the detection result, and then mutation detection and calibration are performed by using GATK so as to select a reliable InDel site. According to the predicted InDel site, based on the genome sequence of the pepper, the lengths of 150bp bases on both wings of the InDel site are taken, and the total length of 301bp is used for primer design. Primer design is carried out by adopting Primer 3.0, the design range of an upstream Primer is 1-145 bp, the design range of a downstream Primer is 155-301 bp, the size of a product is 100-250 bp, and the annealing temperature is 52-60 ℃.

3. Extraction of genomic DNA

Placing the pepper leaves into a 1.5ml centrifuge tube, quickly freezing and grinding the pepper leaves into powder by using liquid nitrogen, immediately adding 700 mu l of 2% CTAB extraction buffer solution preheated to 65 ℃, extracting in a water bath at 65 ℃ for 30min, and slightly inverting the sample test tube for 3 times during the period. Add 700. mu.l chloroform: the isoamyl alcohol is extracted at a ratio of 24:1, mixed and extracted for 5min gently, and centrifuged at 12000r/min for 5 min. 400 mul of supernatant was aspirated and transferred to a new centrifuge tube, 800 mul of precooled absolute ethanol was added, the mixture was shaken gently and centrifuged at 12000r/min for 5 min. Pouring off anhydrous ethanol, taking care not to pour out the white DNA precipitate, adding 800. mu.l 75% ethanol for washing 2 times, pouring off 75% ethanol, placing the precipitate at the bottom of the centrifuge tube, air drying the tube at room temperature, adding 100. mu.l sterile deionized water (ddH) containing RNAse A₂O: RNase A50: 1), water bath at 37 ℃ for 1h to dissolve DNA and remove RNA, and stored at-20 ℃ until use.

Analysis of InDel molecular markers

A. InDel marker polymorphism screening among 2 parts of heavy sequencing materials

According to the predicted InDel sites, 1605 InDel site design primers are selected on the basis of uniform distribution in the whole genome. Polymorphism analysis of 1605 InDel markers with 2 duplicate sequenced materials showed 1556 markers (97%) with clear amplified bands, with 1255 markers (78%) polymorphic across 2 materials.

B. InDel marker polymorphism screening among 5 pepper cultivars

To further verify the universality of the InDel markers among 5 pepper cultivars, 2 materials were randomly selected from each pepper cultivar material, and 288 InDel markers were analyzed for polymorphisms. The results showed that 194 InDel markers were polymorphic in at least 2 species, with InDel-2-3b-25 having distinct bands in 5 species (FIG. 1), indicating that the markers could differentiate 5 cultivar materials at once.

Verification of the accuracy of Indel-2-3b-25 marker

To further verify that the marker Indel-2-25 can completely distinguish 5 cultivar materials. 55 parts of pepper material, including 9 parts of c.annuum, 11 parts of c.frutescens, 16 parts of c.chinensis, 14 parts of c.baccatum and 5 parts of c.pubescens, introduced from the american national germplasm resources pool were randomly selected. The results show that Indel-2-3b-25 can completely distinguish the material of the above 5 cultivars (FIG. 2 and Table 1). The mark can classify 5 cultivar materials at a time, and can be used for the botanical classification of 5 cultivars of pepper and the identification of interspecific hybrids.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> an InDel labeled primer pair for distinguishing five pepper cultivars and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaccccactt tgtgggaata 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgcttgccag ggatattttt 20

Claims

The application of Indel labeled primer pairs shown in SEQ ID NO.1 and SEQ ID NO. 2in distinguishing five pepper cultivars is characterized in that extracted pepper genome DNA is used as a template, the Indel labeled primer pairs shown in SEQ ID NO.1 and SEQ ID NO.2 are used for PCR amplification, polyacrylamide gel electrophoresis is carried out on PCR amplification products, and annual peppers (Capsicum annuum) are obtained if 133bp molecular marker bands exist; if a 135bp molecular marker band exists, the band is shrubbery pepper (Capsicum frutescens); chinese pepper (Capsicum Chinese) if there is 138bp molecular marker band; if a molecular marker band with 141bp exists, the Capsicum is ptopetalum (Capsicum baccatum); and if the molecular marker band of 148bp exists, the molecular marker band is the paprika (Capsicum Pubescens).
2. An Indel marking method for distinguishing five pepper cultivars is characterized by comprising the steps of taking extracted pepper genome DNA as a template, carrying out PCR amplification by using Indel marking primers shown in SEQ ID NO.1 and SEQ ID NO.2, carrying out polyacrylamide gel electrophoresis on PCR amplification products, and obtaining annual pepper (Capsicum annuum) if a molecular marking band of 133bp exists; if a 135bp molecular marker band exists, the band is shrubbery pepper (Capsicum frutescens); chinese pepper (Capsicum Chinese) if there is 138bp molecular marker band; if a molecular marker band with 141bp exists, the Capsicum is ptopetalum (Capsicum baccatum); and if the molecular marker band of 148bp exists, the molecular marker band is the paprika (Capsicum Pubescens).
3. The Indel marking method for distinguishing five pepper cultivars according to claim 2, wherein the PCR reaction system: 50 ng/. mu.l of DNA template 0.5. mu.l; 10. mu. mol/L of 0.5. mu.l of the primer set forth in claim 1; 10 × PCR buffer 1.0 μ l; 25mmol/L MgCl₂ 1.0μl；10mmol/L dNTPs 0.25μl；5U/μl Taq DNA Polymerase 0.1μl；ddH₂O6.65 μ l; or 0.5 mul of 50 ng/mul of DNA template is adopted; 10. mu. mol/L of0.5 mul of primer pair; 2 XGoTaq GreenMaster Mix 5 mul; ddH₂O3 mu l; reaction procedure: pre-denaturation at 94 ℃ for 3 min; 30 cycles of 94 ℃ denaturation for 20sec, 55 ℃ annealing for 30sec, and 72 ℃ extension for 40sec per cycle; finally, extension was carried out at 72 ℃ for 7 min.