KR20230143303A - InDel molecular marker for discriminating sex of Actinidia arguta and uses thereof - Google Patents

Abstract

The present invention relates to the InDel molecular marker for sex determination of Actinidia Actinidia and its use. The InDel molecular marker of the present invention is capable of determining sex regardless of the ploidy or growth stage of the Actinidia actinidia genetic resource, so breeding using Actinidia genetic resource In the process, it can be useful for early selection of female tree lines that produce fruits and seeds or male tree lines that become pollinators.

Description

InDel molecular marker for discriminating sex of Actinidia arguta and uses thereof}

The present invention relates to the InDel molecular marker for sex determination of Actinidia chinensis and its use.

Actinidia arguta is a representative dioecious plant belonging to the Actinidia genus of the Actinidia family. It is divided into male and female trees according to the XY sex determination system. Actinidia usually produces fruit by planting only female trees, but it cannot bear fruit on its own unless it receives pollen from nearby male trees or is artificially pollinated, and even if there are only male trees, it does not bear fruit.

Actinidia has a long childhood, but the sex cannot be distinguished through morphological characteristics such as leaf or branch shape during childhood, and must be confirmed by the appearance of flower organs. Therefore, it is difficult to select female or male tree lines in the early stages of breeding. This is one of the important issues in the breeding of Actinidia. Actinidia is a species with strong cold resistance and high potential utility value due to its high content of vitamins, minerals, and dietary fiber. High-quality kiwi can be produced through breeding using Actinidia as a cross parent, and the decrease in genetic diversity caused by the uniformity of cultivated species can also be resolved.

Marker-assisted selection is a method that can predict phenotypes in the early stages of breeding using molecular markers developed based on DNA sequences associated with breeding target traits. Selection using molecular markers has the advantage of being inexpensive and shortening the breeding period by selecting individuals with the target trait before the trait is expressed. InDel (Insertion and deletion) is a length polymorphism caused by insertion or deletion of a base sequence, and is a mutation that exists abundantly in the genome. The InDel molecular marker, developed based on the base sequence of the region where InDel is located, can distinguish individuals through a simple process of polymerase chain reaction (PCR) and gel electrophoresis, and has excellent reproducibility. To date, InDel molecular markers associated with useful agricultural traits have been developed in various plants such as rice and tomato.

The sex chromosome of Actinidia plants is known as chromosome 25, and the molecular markers for sex determination of Actinidia plants developed to date were developed based on the base sequences of the cultivated species A. chinensis and A. deliciosa . However, the previously developed sex determination molecular markers have low inter-species transferability, so it is necessary to develop species-specific sex determination molecular markers for Actinidia plants.

Meanwhile, Korean Patent No. 1716021 discloses ‘Primer for distinguishing between male and female ginkgo trees and method for distinguishing between male and female ginkgo trees’, and Korean Patent No. 0685518 discloses ‘Primer for determining male and female asparagus and method for determining male and female asparagus. ' is disclosed, but there is no description about the InDel molecular marker for sex determination of Actinidia of the present invention and its use.

The present invention was derived from the above requirements, and the present inventors aligned the genome sequences of the female tree K5-10-5 and the male tree K5-3-7 of Actinidia with the reference genome 'Hongyang' ( Actinidia chinensis ) sequence and By analyzing the InDel polymorphism between and male trees, we developed an InDel marker based on the deletion of the male base sequence around 15,865,259 bp of chromosome 25, the sex chromosome of Actinidia. The present invention was completed by confirming that circles could be accurately identified.

In order to solve the above problems, the present invention provides a primer set for sex determination of Actinidia arguta, including the oligonucleotide primer set of SEQ ID NOs: 1 and 2.

Additionally, the present invention provides a kit for determining the sex of Actinidia chinensis, which includes a primer set and reagents for performing an amplification reaction.

In addition, the present invention includes the steps of isolating genomic DNA from a sputum sample; Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set according to the present invention to amplify the target sequence; and detecting the product of the amplification step. It provides a method for determining the sex of Actinidia tree including a step.

Since the InDel molecular marker of the present invention can determine gender regardless of the ploidy or growth stage of Actinidia genetic resources, early selection of female tree lines that bear fruits and seeds or male tree lines that become pollinators during the breeding process using Actinidia genetic resources. It may be useful for .

Figure 1 shows the results of PCR performed on genetic resources of female (A) and male (B) Actinidia plants using the InDel marker of the present invention.

In order to achieve the object of the present invention, the present invention provides a primer set for sex determination of Actinidia chinensis, including the oligonucleotide primer set of SEQ ID NOs: 1 and 2.

In the primer set of the present invention, the primer set of SEQ ID NOs: 1 and 2 is a primer set that can amplify a region containing a 20 bp base deletion region in the male tree sequence by comparing the genome sequences of female and male Actinidia. . Specifically, by comparing the genome sequences of female and male Actinidia chinensis with the sequence of the reference genome (Hongyang, Actinidia chinensis ; GenBank assembly accession No. GCA_009663005.1), the sequence of chromosome 25, the sex chromosome of Actinidia chinensis, was compared to 15,865,259 based on the reference genome. This is a primer set created based on the region where 20 bp bases (ATTGGAAACAAGTTGTGGAA), corresponding to 15,865,279 bp, were deleted from the sequence of the male tree. The base deletion region is located in an intergenic region.

The primer may include an oligonucleotide consisting of a segment of 15 or more, 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequences of SEQ ID NOs: 1 and 2, depending on the sequence length of each primer. there is. For example, the primer (20 oligonucleotides) of SEQ ID NO: 1 may include an oligonucleotide consisting of a segment of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides within the sequence of SEQ ID NO: 1. . In addition, the primer may also include sequences added, deleted, or substituted in each base sequence of SEQ ID NOs: 1 and 2 that can bind to the amplification site. The oligonucleotide primer of SEQ ID NO: 1 is a forward primer, and the oligonucleotide primer of SEQ ID NO: 2 is a reverse primer.

In the present invention, “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength.

In the present specification, the oligonucleotide used as a primer may include a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or may contain an insert It may contain an intercalating agent.

The present invention also provides a kit for sex determination of Actinidia chinensis, which includes primer sets of SEQ ID NOs: 1 and 2 and reagents for performing an amplification reaction.

In the kit for determining the sex of Actinidia of the present invention, reagents for performing the amplification reaction may include, but are not limited to, DNA polymerase, dNTPs, and buffer.

The kit for determining the sex of Actinidia chinensis of the present invention may additionally include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Isolating genomic DNA from the Actinidia tree sample;

Using the isolated genomic DNA as a template and performing an amplification reaction using the primer sets of SEQ ID NOs: 1 and 2 according to the present invention to amplify the target sequence; and

It provides a method for determining the sex of Actinidia Actinidia, including the step of detecting the product of the amplification step.

The method of the present invention includes the step of isolating genomic DNA from an Actinidia chinensis sample. Methods known in the art for isolating the genomic DNA may be used, for example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. The target sequence can be amplified by performing an amplification reaction using the isolated genomic DNA as a template and an oligonucleotide primer set according to an embodiment of the present invention as primers. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. amplification system, strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used.

In the method according to one embodiment of the present invention, the Actinidia vine sample may be, but is not limited to, a (vine) stem, leaf, root, fruit, or seed of Actinidia vine, and in the present invention, a sample of the tip of the Actinidia vine stem is used. used.

In one embodiment of the present invention, the method for determining the sex of Actinidia chinensis includes the step of detecting a product of the amplification step, and the detection of the product of the amplification step is performed using a DNA chip, gel electrophoresis, capillary electrophoresis, or radioactivity measurement. , may be performed through fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can be performed using, for example, the ABi Sequencer. Additionally, gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, the fluorescence measurement method is to perform PCR by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorometer. can do. In addition, the radioactivity measurement method involves adding a radioisotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then using a radioactivity measurement device, such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

In the method for determining the sex of Actinidia Actinidia according to one embodiment of the present invention, when PCR is performed using the primer set of SEQ ID NOs: 1 and 2 using Actinidia Actinidia genomic DNA as a template, if a band of 133 bp is detected, it is a female Actinidia tree. Therefore, if both 113 bp and 133 bp bands are detected, it can be identified as Actinidia eucalyptus.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Extraction of genomic DNA from Actinidia tree

The genetic resources of 29 Actinidia trees used in the experiment were provided by the Namhae Branch of the National Institute of Horticultural and Herbal Science (Table 1). The leaves collected from 29 Actinidia apex vines were washed with distilled water, individually packaged, and stored at -70°C. Genomic DNA was extracted using the Plant DNeasy Mini Kit (Qiagen, Germany), and the concentration and purity of the extracted genomic DNA was confirmed using a DS-11 Spectrophotometer (DeNovix, USA), and was quantified at 10 ng/㎕. .

Actinidia tree genetic resources used in the present invention scientific name gender genetic resources Actinidia
arguta female K5-2-3, K5-2-13, K5-2-18, K5-4-7, K5-10-1, K5-10-5, K5-12-6, Chiak male K5-2-22, K5-3-3, K5-3-6, K5-3-7, K5-3-8, K5-3-12, K5-3-13, K5-3-18, K5- 4-8, K5-5-1, K5-5-12, K5-5-14, K5-6-10, K5-9-1, K5-9-8, K5-11-1, K5-11- 2, K5-11-3, K5-11-8, K5-13-6, K5-14-1

Example 2. Genome resequencing results of Actinidia chinensis genetic resources and selection of candidate InDel markers for sex determination of Actinidia chinensis

Resequencing of female tree K5-10-5 and male tree K5-3-7 was performed using Illumina Hiseq After sequencing, the adapter sequences of the reads were removed using cutadapt, and quality trimming was performed to purify the reads into high-quality reads using the DyanmicTrim and LengthSort programs in the SolexaQA package. The cleaned reads that went through the preprocessing process were mapped to the reference genome 'Hongyang' ( Actinidia chinensis ) using the BWA program. SAMtools was used to search raw InDels and extract consensus sequences. To compare and analyze the InDel polymorphism between female and male trees, an integrated InDel matrix between samples was created, and InDels showing polymorphism were searched for the InDel matrix between male and female trees created above. The resequencing results of female tree K5-10-5 and male tree K5-3-7 are shown in Table 2 below.

Resequencing results of female and male Actinidia trees Sex Accession No. of
mapped reads Mapping coverage(%) Depth of
coverage(×) No. ofInDels
(Insertion/Deletion) Female K5-10-5 121,651,936 73.28 32.02 949,717 / 1,096,116 Male K5-3-12 110,717,833 73.03 28.16 943,285 / 1,090,455

Among the InDels between the genetic resources of female and male trees that underwent resequencing, 6,396 InDels located on chromosome 25, the sex chromosome, were selected, and then, considering the XY sex determination system, InDels that were homozygous in female trees and heterozygous in male trees were selected. were selected by filtering. Among these, 23 candidate InDels with an InDel size of 20 bp or more were selected so that polymorphism could be determined by agarose gel electrophoresis.

After extracting 600 bp of the flanking sequence of the 23 candidate InDels selected above, Primer3 was used to determine that there was no primer sequence in the targeted InDel region, the size of the PCR amplification product was 100 bp or more, and the primer sequence was The primer was designed to be 20 bp and the GC content of the primer sequence was close to 50%. During the primer design process, two InDels for which primers that did not meet the above conditions were not produced were excluded from subsequent experiments, and a total of 21 InDels were selected.

Example 3. Final selection and verification of InDel markers for sex determination of Actinidia Actinidia

To select the final InDel for sex determination of Actinidia among the 21 InDels selected above, PCR was performed using a primer set based on 21 InDels targeting the Actinidia tree genetic resources in Table 1. The PCR reaction was made by mixing 10 μl of Tag polymerase, 4 μl of DNA (10 ng/μl), 2 μl each of forward and reverse primers (10 pmole/μl), and 2 μl of tertiary distilled water to make a total of 20 μl. PCR pre-denaturation 95°C for 3 minutes; Denaturation at 95°C for 30 seconds, annealing at 60°C for 1 minute, and extension at 72°C for 1 minute were repeated a total of 34 times; Final extension was performed at 72°C for 3 minutes. After completion of PCR, 2% agarose gel electrophoresis was performed to confirm the polymorphism of the amplification product.

As a result, among the 21 candidate InDels, the primer set CBk25id01 (Table 3), which was created based on a 20 bp base deletion region in the male tree sequence near 15,865,259 bp of chromosome 25 (Table 3), accurately identified various female and male Actinidia genetic resources. It was confirmed that they could be distinguished (Figure 1). The PCR amplification product of the female Actinidia tree sample showed a band of 133 bp, and the PCR amplification product of the male Actinidia tree sample showed bands of both 133 bp and 113 bp.

Primer set information of the present invention Primer name Sequence (5'→3') (SEQ ID NO) Size (bp) CBk25id01 F: GTTGTTCACCCATCCAAACA (1) 133 (female) R: TTTAAGGGAATGAGCCGAAC (2) 113/133 (male)

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> InDel molecular marker for discriminating sex of Actinidia arguta and uses it <130> PN22090 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gttgttcacc catccaaaca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tttaagggaa tgagccgaac 20

Claims (5)

A primer set for sex determination of Actinidia arguta , including the oligonucleotide primer set of SEQ ID NOs: 1 and 2. A kit for sex determination of Actinidia arguta , comprising the primer set of claim 1 and reagents for performing an amplification reaction. The kit according to claim 2, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs, and buffer. Isolating genomic DNA from the Actinidia tree sample;
Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of claim 1 to amplify the target sequence; and
A method for determining the sex of Actinidia arguta , comprising the step of detecting a product of the amplification step. The method of claim 4, wherein the detection of the amplification product is performed using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.