KR102163235B1 - Molecular marker based on chloroplast sequence for discriminating Angelica decursiva from Angelica species and uses thereof - Google Patents

Abstract

The present invention relates to a molecular marker based on a chloroplast sequence for discriminating Angelica decursiva from Angelica genus plants and a use thereof. The molecular marker of the present invention may be useful for preventing the mixing of raw materials of Angelica genus plants distributed in the Korean herbal medicine market and for quality control of the plants of Angelica genus produced.

Description

Molecular marker based on chloroplast sequence for discriminating Angelica decursiva from Angelica species and uses thereof

The present invention relates to a chloroplast sequence-based InDel (Insertion/Deletion) molecular marker for discriminating Angelica decursiva from plants of the genus Angelica and its use.

Body herb ( Angelica decursiva ) is a plant of the genus Angelica decursiva that blooms purple in July-September with a height of 80-150 cm. Young sprouts are used for food, and are sometimes grown for ornamental use in parks and gardens. The root has the herbal name of Jeonho. The roots of body herbs contain substances such as nodakenin, spongesterol, mannitol, estragole, and limonene, which are furocoumarins, and antipyretic, antitussive, and expectorant. It is effective for colds, coughs, and asthma. Korea has the body with herbs, Angelica gigas (A. gigas), ildanggwi (A. acutiloba), guritdae (A. dahurica) various (Angelica species) plants, such as Angelica in the distribution, which is used as a medicinal herb and edible. In Korea, the leaves are soft and the scent is less than that of the angelica, so it is widely used for food, but sometimes it is misused as the herbal name "Angelica," which refers to the dried roots of the angelica ( A. gigas ). In addition, in the case of body sprouts, the dried roots are used for antipyretic, jinhae, and geodam under the herbal name "Jeonho". As such, in Korea, various kinds of Angelicae plants are used as herbal medicinal materials and edibles for various purposes, but in the herbal medicine market where the roots are dried and processed into slices, the identification of raw materials through the naked eye is limited, so an accurate raw material identification system is required. .

Methods for discriminating medicinal plants can be broadly divided into (1) morphological discrimination, (2) physicochemical discrimination, and (3) discrimination using DNA molecular markers. Discrimination based on the morphological characteristics of plants is generally divided into external features such as the structure and shape of the firearm of the plant to be identified, and the shape of the above and underground parts. The morphological discrimination of plants is difficult to distinguish between species of near-continuous seedlings, and there are many cases of quantitative traits rather than qualitative traits, and variations may occur depending on the cultivation environment, as well as the occurrence of mixed species by other foods. It is difficult to distinguish. In particular, medicinal plants are processed and distributed in a variety of ways, such as peeling, sectioning, and drying, depending on the medicinal site, so it is difficult to distinguish them unless you are an expert. In the case of discrimination by physicochemical component analysis, it takes a lot of time and effort for analysis, and there is a limitation in discrimination because the pharmacological composition may change depending on the cultivation environment and growth conditions of medicinal plants. Molecular biological plant discrimination technology by DNA analysis is recognized as a tool to solve the above problems, but DNA genome does not change due to changes in the environment, and it is also processed and distributed to discriminate herbal medicines that cannot easily identify plant raw materials. It can be usefully used.

Molecular marker is a method that detects polymorphism using the technology of Polymerase Chain Reaction.It is basically simple and fast, and is not affected by the results from various environmental factors such as the cultivation environment, the stage of plant development, and the subjectivity of the researcher. Does not. The InDel marker is used by searching for a nucleotide sequence inserted or deleted in the nucleotide sequence of DNA as a molecular marker. cpInDel refers to the InDel site present in the chloroplast DNA site and is relatively evenly distributed in the chloroplast genome. In addition, since it is present at a specific gene site and is not part of the codon that determines the type of amino acid, it is not subject to natural selection, and exhibits a characteristic of co-dominance in phenotype.

On the other hand, Korean Patent No. 1811539 discloses a'method for discriminating angelica varieties using an InDel marker', and Korean Patent Publication No. 2018-0080915 discloses'a primer set for determining the species of angelica and using the same. Although the'method of discrimination' is disclosed, there is no description of the molecular marker based on the chloroplast sequence for discriminating body sprouts from the Angelicae genus of the present invention and the use thereof.

The present invention is derived from the above requirements, the present invention is a variety of herbal and edible four kinds of plants of the genus Angelica gigas , Angelica gigas , Ilangelica ( A. acutiloba), Guritdae ( A. dahurica ) And by comparing the chloroplast genome information of the body sprout ( A. decursiva ), a molecular marker based on the InDel polymorphism specifically inserted only in the chloroplast sequence of the body sprout was developed, and using the molecular markers, As a result of analyzing a sample of the herb genetic resource, it was confirmed that only body sprouts can be specifically identified among the four kinds of Angelicae genus plants, thereby completing the present invention.

In order to solve the above problems, the present invention provides a primer set for discriminating body sprouts ( Angelica decursiva ) from plants of the genus Angelica, including oligonucleotide primer sets of SEQ ID NOs: 1 and 2.

In addition, the present invention is the primer set; And it provides a kit for discriminating body sprouts from plants of the genus Angelicae, comprising a reagent for performing an amplification reaction.

In addition, the present invention comprises the steps of separating genomic DNA from a sample of the genus Angelicae; Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set to amplify a target sequence; And detecting the product of the amplification step.

The present invention develops InDel markers that specifically show polymorphism in body sprouts among four kinds of plants in the genus Angelica using PCR technology and identifies the pattern of the amplified band through electrophoresis, so that body sprouts ( Angelica decursiva ) Was made to be able to identify. Accordingly, the molecular marker of the present invention may be usefully used in preventing the mixing of raw materials of the genus Angelicae plants distributed in the domestic herbal medicine market and controlling the quality of the plants of the genus Angelicae produced.

Fig. 1 is a locus in which a base is specifically inserted in a body sprout ( Angelica decursiva ). Angelica gigas ; Angelica decursiva ; Body herbs, Angelica acutiloba ; Angelica dahurica ; Copper plate.
2 is an analysis result using a Fragment Analyze ^TM Automated CE System of a PCR amplified product using an Ade_D_CpInDel marker. A. gigas ; Angelica, A. acutiloba ; Angelica, A. dahurica ; Beret , A. decursiva ; Body herbs.
3 is a gel electrophoresis image of the analysis results using the Fragment Analyze ^TM Automated CE System of PCR amplified products using the Ade_D_CpInDel marker.

In order to achieve the object of the present invention, the present invention provides a primer set for discriminating body sprouts ( Angelica decursiva ) from plants of the genus Angelica, comprising an oligonucleotide primer set of SEQ ID NOs: 1 and 2.

In the primer set according to the present invention, the plants of the genus Angelica may be Angelica gigas , Angelica gigas , A. acutiloba, and A. dahurica .

The primer of the present invention may include an oligonucleotide consisting of segments of 15 or more, 16 or more, 17 or more contiguous nucleotides in the sequence of SEQ ID NOs: 1 and 2, and the primers are It may also include an addition, deletion or substitution of nucleotide sequence.

The oligonucleotide primer set of SEQ ID NOs: 1 and 2 according to the present invention is a primer set capable of amplifying a 13bp base specifically inserted only in the chloroplast sequence of body sprouts, although it is not identified in Angelica Angelica, Angelica japonica, and Koridae. It is a set of primers that can specifically distinguish only body sprouts from plants such as Angelica Angelica, Angelica Angelica, and Koridae.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and can serve as an initiating point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present specification, the oligonucleotide used as a primer may also comprise a nucleotide analogue, e.g., phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or It may include an intercalating agent.

The present invention also, the primer set; And it provides a kit for discriminating body sprouts ( Angelica decursiva ) from plants of the genus Angelica, including a reagent for performing an amplification reaction.

In one embodiment of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, but are not limited thereto.

In one embodiment of the present invention, the kit may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare reverse transcription and PCR buffers, and the reaction conditions presented. The guide includes a brochure in the form of a brochure or flyer, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Separating genomic DNA from a sample of the genus Angelicae;

Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of the present invention to amplify a target sequence; And

It provides a method of discriminating the body sprouts ( Angelica decursiva ) from the plant of the genus Angelica, including; detecting the product of the amplification step.

The method of the present invention includes the step of isolating genomic DNA from a sample of a plant of the genus Angelicae. The sample of the plant of the genus Angelicae is not limited thereto, but may be a product processed in the form of a root of a plant that is suspected of being a body sprout, an angelicae, an angelicae or copper. The method for separating the genomic DNA may use a method known in the art, for example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using the oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods of amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. amplification system), strand displacement amplification or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling material. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer when amplifying the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, for labeling using a radioactive material, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radiolabeled. The set of oligonucleotide primers used to amplify the target sequence is as described above.

In one embodiment of the present invention, the method for determining body sprouts in the genus Angelicae includes the step of detecting the product of the amplification step, and the detection of the product of the amplification step is DNA chip, gel electrophoresis, capillary tube It may be performed through electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods of detecting the amplification product, capillary electrophoresis may be performed. For capillary electrophoresis, for example, an ABi sequencer can be used. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. In addition, when performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the fluorescence measurement method is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Plant resource collection and DNA extraction

Four species of Angelica gigas ( A. gigas ), Angelica ( A. acutiloba), Gori ( A. dahurica ) and body sprouts ( A. decursiva ) used in the experiment were seeds from the National Academy of Horticultural Science and National Arboretum. The pre-sale was stored in a cryogenic freezer at -80°C. For DNA extraction, seeds were crushed using TissueLyser II (Qiagen, Valencia, CA, USA), an ultrafast crushing/homogenizing device, and then DNA was extracted using the CTAB method and eluted in Tris-EDTA buffer.

2. DNA amplification using PCR

Diluted DNA of Angelica Angelicae, Angelicae, Goridae and Body sprouts extracted using the CTAB method with 5 ng/µl, 2 µl of DNA (10 ng of DNA), 2 µl of primer mixture (1 µl of 0.2 M forward primer, 0.2 M reverse primer) 1 µl), 10 µl of Taq mixture, and 6 µl of distilled water were mixed to prepare a 20 µl PCR reaction mixture. The PCR process was fully denatured at 95° C. for 5 minutes; The process of denaturation 95°C for 30 seconds, annealing 51°C for 30 seconds, and extension 72°C for 60 seconds was repeated a total of 34 times; Final elongation was carried out under conditions of 72°C for 10 minutes.

3. Chloroplast-based InDel marker used in PCR

The primer set for amplification of the chloroplast-based InDel marker used in the PCR was used in the US national It was collected from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov). Thereafter, comparative analysis was performed using CLC Main Workbewnch program version 8.0.1, and a locus into which a base was specifically inserted in the body sprout ( Angelica decursiva ) was selected (Fig. 1), and a primer set capable of amplifying this was selected. And, Angelica decursiva_discrimination_chloroplast_InDel (hereinafter, Ade_D_CpInDel) marker was developed.

Primer sequence information of Ade_D_CpInDel marker Primer name Sequence (5'→3') Ade_D_CpInDel Fwd GTGGCTTCCTTCGTTTATATG (SEQ ID NO: 1) Ade_D_CpInDel Rev CTACCCAGCCAACTTTCA (SEQ ID NO: 2)

Example 1. Polymorphism reading of Indel markers showing polymorphism using PCR

Using the developed molecular marker Ade_D_CpInDel, it was verified whether it is possible to discriminate body sprouts from plants of the genus Angelicae. PCR was performed using 3 resources, 12 resources, respectively, of Korean Angelica Angelica, Angelica Angelica, Goridae, and Body sprouts. To confirm the PCR amplification product, Fragment Analyze ^TM Automated CE System (Advanced Analytical Technologies, Inc. Ames. USA) was used.

As a result, as disclosed in Figs. 2 and 3, a product of 211 bp was confirmed in Angelica gigas ( A. gigas ), Angel Angelfish ( A. acutiloba) and Gori ( A. dahurica ), whereas a product of 211 bp was confirmed, while body sprout ( A. decursiva ) In, a specific band of 224bp was identified, confirming that only the body sprout plant can be specifically identified among the four plants of the genus Angelicae.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Molecular marker based on chloroplast sequence for discriminating Angelica decursiva from Angelica species and uses thereof <130> PN19319 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gtggcttcct tcgtttatat g 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctacccagcc aactttca 18

Claims (7)

A primer set for discriminating body sprouts ( Angelica decursiva ) from Angelica gigas , A. acutiloba, and A. dahurica , including the oligonucleotide primer set of SEQ ID NOs: 1 and 2. delete The primer set of claim 1; And a kit for discriminating body sprouts ( Angelica decursiva ) from Angelica gigas , A. acutiloba, and A. dahurica , including reagents for performing an amplification reaction. The kit according to claim 3, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. Separating genomic DNA from a sample of the genus Angelicae;
Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of claim 1 to amplify a target sequence; And
Detecting the product of the amplification step; Containing, Angelica gigas ), Angelica gigas ( A. acutiloba), and a body sprout ( A. dahurica ) from the body sprouts ( Angelica decursiva ). delete The method of claim 5, wherein the detection of the product of the amplification step is performed through DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement.

Images