KR102093382B1 - Marker for Discrimination of Platycodon grandiflorum and Codonopsis lanceolata - Google Patents

Abstract

The present invention relates to a molecular marker for distinguishing Platycodon grandiflorum roots and Codonopsis lanceolata roots. In performing PCR on a genomic DNA of a sample using the molecular marker, Platycodon grandiflorum roots and Codonopsis lanceolata roots can be simultaneously distinguished based on the size of a PCR product. The molecular marker consists of sequence number 3 and 4.

Description

Marker for Discrimination of Platycodon grandiflorum and Codonopsis lanceolata}

The present invention relates to a molecular label for simultaneously distinguishing bellflower and deodeok.

Bellflower ( Platycodon ) belonging to the Campanulaceae family grandiflorum ) and deodeok ( Codonopsis lanceolata ) have a similar root shape, which can cause confusion at the distribution and sales stage after collection. This makes it impossible for actual consumers to purchase the desired product, and in actual use, damage to the consumer is indicated by using a cheap bellflower instead of deodeok, such as grilled deodeok red pepper paste. Therefore, it is necessary to develop a molecular marker capable of discriminating bellflower and deodeok roots.

The Korea Food and Drug Safety Evaluation Institute has developed and released a pair of primers for discrimination based on the chloroplast psb I gene sequence and a pair of primers for discrimination of deodeok (Food and Drug Safety Evaluation Institute (2011) Fake Food Identification Test Order (I)- Utilization of genetic analysis method, pp.31-33; Korea Institute of Food and Drug Safety Evaluation (2014) Application for authenticity identification of raw materials used in food-use of genetic analysis, pp. 158-170). However, since the primer uses specific sequences for each of the bellflower and the duck, it is not possible to simultaneously distinguish the bellflower and the duck, and there is a disadvantage in that the analysis must be repeated twice for one sample. In addition, Hwang (2017) developed molecular markers using partial chloroplast genes for molecular labeling discrimination between bellflowers and deodeok, and some molecular labeling studies have been conducted to distinguish bellflower collection species from Chinese imported bellflowers.

In order to solve the above problems, the present inventors have developed a molecular marker capable of distinguishing bellflower and deodeok at a time using a full-length chloroplast genomic sequence.

Republic of Korea Registered Patent No. 10-1752658

An object of the present invention is to provide a primer set capable of simultaneously distinguishing bellflower and deodeok.

Another object of the present invention is to provide a method for simultaneously distinguishing bellflower and deodeok.

In order to achieve the above object, one aspect of the present invention SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; And primer set of SEQ ID NO: 5 and 6; provides a primer set for distinguishing the bellflower and deodeok.

As used herein, the term "bellflower ( Platycodon grandiflorum ) "is a perennial plant with bellflower, which is taken in spring and autumn to eat raw or eat as herbs. The main component of bellflower is saponin, which is used as a medicine after peeling or drying the roots.

As used herein, "The Duck ( Codonopsis lanceolata ) "is a perennial plant with campanula and grows in a place where there is not much sunlight and high ambient humidity. The root of the deodeok is similar in shape to a bellflower and contains saponin abundantly, making it a bitter taste.

As used herein, the term "primer" is a short nucleic acid sequence having a free 3 'hydroxyl group at the free 3' end, which can form a complementary template and a base pair. Refers to a nucleic acid sequence that functions as a starting point for copying. Primers can initiate DNA synthesis at appropriate temperatures in the presence of an appropriate buffer, a reagent for the polymerization reaction, four different nucleotide triphosphates and a DNA polymerase or reverse transcriptase. The specific length and sequence of the primers depend on the conditions of primer use, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

As used herein, the term “complementary” means that the primer is sufficiently complementary to selectively hybridize to the target nucleic acid sequence under certain annealing or hybridization conditions, and is substantially complementary (substantially complementary). And completely complementary, preferably means completely complementary.

In one embodiment of the present invention, the primer set may be a marker that amplifies the Indel site. The term "Insertion Deletion" refers to a site where insertion or deletion of a base occurs in a bellflower genome, and is used as a molecular index for distinguishing a bellflower from a bellflower in the present invention. In / del or Indel may be used interchangeably herein.

In one embodiment of the present invention, when amplifying genomic DNA of bellflower and deodeok using the primer set, PCR products of different sizes are generated, thereby distinguishing the bellflower and deodeok in one analysis.

Another aspect of the invention

⒜ separating genomic DNA from the target sample;

⒝ Using the isolated genomic DNA as a template, SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; And performing an amplification reaction using a primer set selected from the group consisting of primer sets represented by SEQ ID NOs: 5 and 6; And

⒞ providing a method of distinguishing bellflower from deodeok, comprising identifying the amplified product of step ⒝.

In one embodiment of the present invention, the target sample of the murine refers to the tissue of a plant capable of separating genomic DNA, and seeds, roots, leaves, stems, flower tissues (flowers) of the bellflower and deodeok, or derived from the tissue All organs and cells, callus, and the like. As a method of separating genomic DNA from a target sample, a DNA extraction kit can be used, and methods known in the art can be easily modified and used by those skilled in the art.

In the present invention, the method for amplifying genomic DNA in step ⒝ includes polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system (transcription) -based amplification system, strand displacement amplification or amplification via Q replicase or any other suitable method for amplifying nucleic acid molecules known in the art can be used, and known in the art The method can be appropriately modified by those skilled in the art. In one embodiment of the present invention, a target sequence was amplified using a polymerase chain reaction.

In addition, the amplified nucleic acid sequence may further label a detectable labeling material. The labeling material may be selected from the group consisting of enzymes, ligands, colorants, microparticles, radioactive isotopes, fluorescence, and phosphorescent materials, but is not limited thereto. Enzymes used as detection markers include acetylcholinesterase, alkaline phosphatase, β-D-galactosidase, horseradish peroxidase, β-lactamase, and biotin derivatives as ligands. The coloring material includes acridinium ester and isoluminol derivatives, and the microparticles include colloid, gold, and colored latex, and the radioactive isotopes ³⁷ Co, ³ H, ¹²⁵ I, ¹²⁵ I-Bonton (Hunter) reagents, etc., and fluorescent materials include Cy3, Cy5, fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (tetramethylrhodamine isothiocyanate, RITC) ), Alexa, 4,4, -difluoro-4-boro-3a, 4a-diaza-s-indacene (BODIPY), Texas Red or biotin.

The step (c) is a step of distinguishing the bellflower from the deodeok, which includes identifying the amplification product of step (b). The method of identifying the amplification product may be performed by electrophoresis of the amplification product. Specific examples of electrophoresis may be an automatic electrophoresis device (including chip and capillary type), acrylamide gel, non-modified gel, non-reducing high-speed liquid chromatography (HPLC), or agarose gel electrophoresis, but is not limited thereto. .

In one embodiment of the invention, SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; And amplifying the genomic DNA of the target sample using a primer set selected from the group consisting of the primer sets shown in SEQ ID NOs: 5 and 6, so that the size of the amplification products of bellflowers and deodecs are different, so it is possible to distinguish bellflowers from deodeok at once. .

Another aspect of the present invention provides a kit and composition for distinguishing a bellflower from a bellflower containing the primer set.

The kit and composition may further include a reagent for performing a nucleic acid amplification reaction. The reagent may include a heat-resistant DNA polymerase, dNTPs and a buffer for the polymerase chain reaction, but is not limited thereto. Here, the buffer may be required for the PCR reaction, which has a composition commonly known in the art, and may include, for example, Tris-HCl, MgCl2, KCl, and the like. The DNA polymerase can synthesize complementary DNA by linking dNTPs complementary to the template nucleic acid to a primer bound to the template nucleic acid.

When PCR is performed on the genomic DNA of a sample using the molecular label of the present invention, bellflower and deodeok can be simultaneously identified based on the size of the PCR product.

Figure 1 shows the full-length chloroplast dielectric structure of Deodeok.
Figure 2 shows the results of genomic DNA PCR performed on the Jangbaek bellflower and deodeok standard samples using the molecular label of the present invention (L, size markers; 1 to 5, Jangbaek bellflower standard samples; and 6 to 10, deodeok standard samples ).
Figure 3 shows the results of genomic DNA PCR performed on the jangbaek bellflower and deodeok sales samples using the molecular label of the present invention (11 to 14, bellflower sales sample; 15 to 19, deodeok sales sample; 20, hemp sales sample; And 21, ginseng sales sample).

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to illustrate one or more embodiments by way of example, and the scope of the present invention is not limited to these examples.

Example  1: Bellflower and deodeok Full length (full-length) chloroplast genome analysis

Genomic DNA was isolated from a method known in the art at Deukdeok (voucher no. IT239919; provided by National Academy of Horticultural Science). Separating genomic DNA Illumina MiSeq platform (Illumina, United States) by sequence analysis (sequencing), and, 5.9 Gb of NGS data (next generation sequencing data) to dnaLCW (de novo assembly of low coverage whole-genome shotgun) method (Kim et al., Sci Rep. 2015; 5: 15655.) to complete the full-length chloroplast genome sequence of Deodeok (FIG. 1). The length of the full-length chloroplast genome sequence of Deodeok is 170,075 bp, and the structure of a common chloroplast genome [long single copy section (LSC) 85,241 bp; IRA (inverted repeat region A) 38,387 bp; -SSC (short single copy section) 8,060 bp and IRB (inverted repeat region B) 38,387 bp]. In addition, Deodeok's full-length chloroplast genome encodes a total of 111 genes, including 77 protein-coding genes, 30 tRNA genes, and 4 rRNA genes. Deodeok's full-length chloroplast genome sequence was registered in GenBank with a one-year open grace period (2018.4 ~ 2019.3) (GenBank Accession number: MH251613).

The full length chloroplast genome sequence of bellflower (voucher no.IT105900; provided by the National Academy of Horticultural Science) was obtained in the same manner as above. This data was compared with the full-length chloroplast genome sequence of albino bellflower (Hong et al., 2017, GenBank Accession number: KX352464). As a result, it was confirmed that there are two types of chloroplast genomes in the bellflower (tandem repeat: 171,818bp; bellflower IT105900: 172,604bp).

Example  2: Molecular label design for bellflower and deodeok

The sequences of the full-length chloroplast genomes of bellflower (IT105900) and deodeok (IT239919) were aligned with the sequences of programs such as MAFFT and BlastZ, and compared to analyze the regions of mutation between the two sequences. As a result, 9,221 single nucleotide polymorphism (SNP) and 1,160 InDel sites were identified in the full-length chloroplast genome sequence of bellflower (IT105900) and deodeok (IT239919).

Three co-dominant markers that can distinguish bellflower (IT105900) and deodeok (IT239919) at the same time were selected by selecting three places in which the base sequence differed by at least 30 bp. At this time, care was taken not to design a molecular marker in the transition region between the chloroplast genome of the Changbaek bellflower and the bellflower IT105900. The designed molecular labels are listed in Table 1.

Marker ID Primer sequence order
number Product size (bp)
Bellflower / Deodeok Indel size (bp) Location M1 F TCATATAGGCCCGAGTTGGA One 271/224 47 ycf15 ~ ndhB R ATGACAAGGGGTCGTTTGAG 2 M2 F TGGAATCTGGGTTCTTCTCCT 3 227/363 136 rps12 ~ trnV - GAC R AACCGCATGGATAAGCTCAC 4 M3 F GACCGTAGGTGCGATGATTT 5 217/253 36 trnI - GAU ~ trnA - UGC R CCGCCTGGACAATTAGACAT 6

Example  3: Molecular label verification for bellflower and deodeok

The molecular label for classifying bellflower and deodeok designed in Example 2 was verified.

3-1. Bellflower and deodeok standard sample

Genomic DNA is extracted from 5 standard samples (roots) of Changbaek bellflower and Deodeok (National Agricultural Genetic Resource Center, http://genebank.rda.go.kr/), and genomes are obtained using M1 to M3 molecular labels. DNA PCR was performed. PCR conditions are as follows.

Molecular label M1

Genomic DNA amount used: 20 ng

PCR reactant composition: 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole forward primer, 0.4 pmole reverse primer and 1.5 M betaine

PCR temperature conditions: 95 ° C for 5 minutes, (95 ° C for 20 seconds, 60 ° C for 20 seconds, 72 ° C for 20 seconds) x30 cycles, 75 ° C for 7 minutes

Molecular label M2

Genomic DNA amount used: 20 ng

PCR reactant composition: 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole forward primer and 0.4 pmole reverse primer

PCR temperature conditions: 95 ° C for 5 minutes, (95 ° C for 20 seconds, 60 ° C for 20 seconds, 72 ° C for 20 seconds) x25 cycles, 75 ° C for 7 minutes

Molecular label M3

Genomic DNA amount used: 20 ng

PCR reactant composition: 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 0.4 pmole forward primer, 0.4 pmole reverse primer and 1.0 M betaine

PCR temperature conditions: 95 ° C for 5 minutes, (95 ° C for 20 seconds, 58 ° C for 20 seconds, 72 ° C for 20 seconds) x30 cycles, 75 ° C for 7 minutes

The PCR product was stained by electrophoresis on a 2.5% agarose gel, and the size difference of the PCR product was confirmed by an ultraviolet illuminator. In addition, the base sequence of each PCR product was confirmed by direct ABI sequencing.

As a result of the confirmation, it was found that the PCR products having different molecular markers M1 and M3 differing by the predicted indel size were amplified in all of the standard samples (FIG. 2). In addition, as a result of sequencing of the PCR product, it was confirmed that the same sequence as confirmed in the full-length chloroplast genome was amplified by PCR.

The molecular marker M2 was amplified in PCR samples of the predicted size in the bellflower standard sample, but amplified in PCR samples of other PCR products that differed slightly in size from the predicted PCR product (FIG. 2). It is presumed that two types of PCR products appeared in Deodeok because Deodeok has heterologous chloroplast genomes of different lengths in the region between rps12 and trnV-GAC genes. However, all of the PCR products of Deodeok amplified from the M2 molecular label of Deodeok showed a clear difference from the PCR products of Doraji (Figure 2). Therefore, the M2 molecular label is a molecular label that can be distinguished from the bellflower even if the deodeok possesses the heterologous chloroplast gene.

3-2. Sales of bellflower and deodeok

4 types of commercially available bellflower roots and 5 species of deodeok roots were purchased to obtain genomic DNA, and genomic DNA PCR was performed using M1 to M3 molecular labels. In addition, genomic DNA was extracted from the roots of ginseng (Cheonpoong varieties) and hemp, and PCR and electrophoresis were performed under the same conditions as 3-1. Table 2 shows the samples used for the analysis.

Analysis number Picking area state Sales name Bellflower 11 Hoengseong, Gangwon-do Root + soil 2018 Hoengseong, Gangwon-do Yakdoji / Namuldoji 1kg 12 Andong, Gyeongbuk Root + soil Herbal bellflower 1kg Herbal bellflower Yakdolar Domestic 13 Jeju Island Root + soil Organic certified top quality bellflower directly from Jeju 2kg 14 Jeonnam Root [Namdo Market] Honest farmers, Deokdeok's Kanderuk 150g / Kandoraj 150g The Duck 15 Hoengseong, Gangwon-do Root + soil Father and son of Gangwon-do high-land deodeok (1kg) 16 Jeonnam Root [Namdo Market] Honest farmers, Deokdeok's Kanderuk 150g / Kandoraj 150g 17 Geumsan, Chungnam Root + soil Geumsam deodeok (large) 1kg / medium / extra large / wangteok / kanderok / pressed deodeok 18 Jeju Island Root + soil High quality Jeju Island soil dug 1Kg / Domestic 19 China Root Peeled deodeok 1kg / Perfect care hemp 20 Andong, Gyeongbuk Root + soil Rainy season product (single phase) 2kg Andongma / Market young farmers / buyong Ginseng 21 Seoul National University Suwon Ginseng Packaging leaf

As a result of the analysis, as shown in FIG. 3, PCR products of the same size as the standard sample appeared in both the bellflower and deodeok roots sold, which indicates that the samples of the bellflower and deodeok market analyzed in this study are not mixed and are being sold properly. Could.

When the molecular label of the present invention is applied to the roots of hemp and ginseng, the molecular label M1 amplifies a PCR product of a size similar to the bellflower in ginseng, and the molecular label M3 amplifies a PCR product of a size similar to the bellflower from ginseng and hemp. Did. On the other hand, the molecular label M2 did not amplify the PCR products from ginseng and hemp (FIG. 3).

Through the results of the studies so far, it has been confirmed that M1 to M3 can be used as novel molecular markers capable of simultaneously discriminating bellflower and deodeok based on the size of PCR products.

So far, the present invention has been focused on the preferred embodiments. Those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered in terms of explanation, not limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be interpreted as being included in the present invention.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Marker for Discrimination of Platycodon grandiflorum and          Codonopsis lanceolata <130> P18R12C1115 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> M1-F primer <400> 1 tcatataggc ccgagttgga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> M1-R primer <400> 2 atgacaaggg gtcgtttgag 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> M2-F primer <400> 3 tggaatctgg gttcttctcc t 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> M2-R primer <400> 4 aaccgcatgg ataagctcac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> M3-F primer <400> 5 gaccgtaggt gcgatgattt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> M3-R primer <400> 6 ccgcctggac aattagacat 20

Claims (5)

A primer set for distinguishing a bellflower ( Platycodon grandiflorum ) consisting of SEQ ID NOs: 3 and 4 and a codonopsis lanceolata .
⒜ separating genomic DNA from the target sample;
⒝ taking the isolated genomic DNA as a template and performing an amplification reaction using a primer set consisting of SEQ ID NOs: 3 and 4; And
⒞ identifying the amplified product of step ⒝, the method of distinguishing bellflower from deodeok.
The method according to claim 2, wherein the target sample is derived from seeds, roots, leaves, stems, and flower tissues of bellflower and deodeok.
A kit for distinguishing a bellflower from a bellflower comprising the primer set of claim 1.
A composition for distinguishing a bellflower from a bellflower comprising the primer set of claim 1.

Images