KR100816476B1 - Microsatellite dna primer related to economic traits in hanwoo - Google Patents
Microsatellite dna primer related to economic traits in hanwoo Download PDFInfo
- Publication number
- KR100816476B1 KR100816476B1 KR1020060128045A KR20060128045A KR100816476B1 KR 100816476 B1 KR100816476 B1 KR 100816476B1 KR 1020060128045 A KR1020060128045 A KR 1020060128045A KR 20060128045 A KR20060128045 A KR 20060128045A KR 100816476 B1 KR100816476 B1 KR 100816476B1
- Authority
- KR
- South Korea
- Prior art keywords
- hanwoo
- size
- analyzing
- primer set
- korean native
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
Description
도 1은 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머의 대립유전자 패턴을 나타낸 것이다.Figure 1 shows the allele pattern of the present invention HWYU2TA-165 microsatellite DNA primer.
본 발명은 한우의 경제형질과 연관성 있는 마이크로새틀라이트 DNA 프라이머에 관한 것이다. 더욱 상세하게는, 본 발명은 한우의 세균인공염색체(BAC) 클론의 말단 염기서열에서 밝혀진 한우의 고유한 경제형질 마이크로새틀라이트 DNA 프라이머에 관한 것이다.The present invention relates to microsatellite DNA primers associated with economic traits of Hanwoo. More specifically, the present invention relates to a unique economical microsatellite DNA primer of Hanwoo, which is found in the terminal sequencing of the BAC clone of Hanwoo.
우리나라의 고유한 유전자원으로서 한우는 역용(일소)으로 수백 년 동안 유지되어 온 한민족 역사의 산물이다. 1970년 이후부터 농업의 기계화와 농업의 산업적 가치가 위축됨에 따라 한우는 우리나라 소비자들의 입맛에 맞는 쇠고기를 공급하는 육용우로 중요한 역할을 하고 있다. 최근에는 WTO와 FTA의 국제 시장경제의 변화에 따른 쇠고기 수입개방과 더불어 유전자원의 유지와 보존뿐만 아니라 우리나라 소비자들의 입맛에 맞는 고급육 생산 원으로서 한우의 중요성과 가치는 더욱 높 아지고 있다.As a unique genetic resource in Korea, Hanwoo is a product of Korean history, which has been maintained for hundreds of years. Since 1970, since the mechanization of agriculture and the industrial value of agriculture have diminished, Hanwoo has played an important role as a beef for supplying beef that suits the tastes of Korean consumers. In recent years, the importance and value of Korean beef have become even more important as the source of beef imports in response to changes in the international market economy of the WTO and FTA, as well as the maintenance and preservation of genetic resources, as well as the source of high-quality meat for the tastes of Korean consumers.
쇠고기 수출국인 선진국에서 소에 대한 연구는 대부분 유전자연구에 기초한 개량으로 새로운 유전자연구기술의 개발과 자국의 축우를 개량하기 위해서 경제형질에 연관된 유전자의 발굴이 생명공학(biotechnology) 기술에 의해 이루어지고 있다. 특히 소의 유전체(genome) 중 40%정도가 염기서열이 반복적으로 이뤄진 반복염기서열로 밝혀져 이러한 반복염기서열에 대한 연구가 많이 이뤄지고 있고 이들을 통한 유전자지도의 작성과 QTL(quantitative trait loci)이 이뤄지고 있다(Ihara et al., 2004; Mizoshita et al., 2004).In developed countries, which are exporters of beef, cattle research is mostly based on genetic research, and the development of new genetic research techniques and the discovery of genes related to economic traits are being carried out by biotechnology technology to improve domestic cattle. . In particular, about 40% of bovine genomes have been identified as repetitive nucleotide sequences with repeated nucleotide sequences, and many researches on these repetitive nucleotide sequences have been carried out, and gene mapping and quantitative trait loci (QTL) have been made through them. Ihara et al., 2004; Mizoshita et al., 2004).
마이크로새틀라이트(microsatellite)는 2 내지 6개 정도의 염기서열이 반복되는 DNA군으로, 게놈 내에 골고루 분포하고 높은 다형성을 나타내는 비암호화 DNA 서열(non-coding DNA sequence)에 해당한다. 특정 좌위에서 반복단위의 반복수에 따라 개체간의 다양성이 인정되는데, 반복수에 품종간 다형이 있는 경우에 인접영역에 설계한 프라이머를 이용하여 중합효소연쇄반응(PCR)을 행하면, PCR 산물 길이에 다형이 관찰되고, DNA 다형을 검출하는 것이 가능하다. Microsatellite is a group of DNA repeating about 2-6 nucleotide sequences, and corresponds to a non-coding DNA sequence that is evenly distributed in the genome and exhibits high polymorphism. The diversity of individuals is recognized according to the number of repeats of the repeating unit at a specific locus. If there is a polymorphism between the breeds, the PCR product length is determined by PCR using a primer designed in the adjacent region. Polymorphisms are observed and it is possible to detect DNA polymorphisms.
특히, 마이크로새틀라이트는 크기가 작기 때문에 2개 내지 8개까지의 프라이머를 동시에 증폭할 수 있으므로 유전자의 다형성을 분석하는데 시간과 비용을 줄일 수 있으며 민감성과 정확성이 높은 결과를 얻을 수 있다. 이와 같은 마이크로새틀라이트는 가축의 분자육종분야에 이용가치가 높으며 근친교배에 의한 퇴화방지, 특정형질을 선택하는 것에도 이용될 수 있다.In particular, microsatellite can be amplified from two to eight primers at the same time because of its small size, thereby reducing the time and cost of analyzing the polymorphism of the gene and obtaining high sensitivity and high accuracy. Such microsatellites are highly useful in the field of molecular breeding of livestock and can be used to prevent degeneration due to inbreeding and to select specific traits.
경제형질은 한우를 포함하는 가축들이 가지고 있는 수많은 형질 중에서 경제 적으로 가치가 있는 형질을 의미한다. 한우의 경우는 성장형질, 도체형질 및 번식형질의 3가지로 분류할 수 있다. 이를 다시 세분화하면, 성장형질에는 생시체중, 이유시체중, 6개월령체중, 12개월령체중, 18개월령체중, 출하시체중 및 체형이 있고, 도체형질에는 도체중, 등지방두께, 배장근단면적, 근내지방도 및 도체율이 있고, 번식형질에는 수정율, 배란율, 사산율 등이 이에 속한다. 이와 같이 한우의 형질은 개체가 갖고 있는 유전자에 의해 표현되는 것이므로 어떤 형질에 대한 유전자를 밝혀내어 능력이 우수한 유전자를 갖고 있는 한우를 선발하여 사용하면 한우의 능력을 개량하는데 큰 효과가 있을 것으로 사료된다. 그러나 우수한 유전자를 밝혀내는 것도 어려우며, 형질에 여러 유전자가 동시에 관여하기 때문에 현재로써는 유전자를 이용한 한우 개량은 쉽게 이루어질 수 없다.Economic traits mean economically valuable traits among the many traits of domestic animals, including Hanwoo. Korean cattle can be classified into three types: growth traits, carcass traits, and breeding traits. Subdivided it again, growth traits include live weight, weaning weight, 6 months old weight, 12 months old weight, 18 months old weight, factory weight and body shape, and carcass traits are carcass weight, backfat thickness, intestinal muscle area, and muscle There are adipose and carcass rates, and breeding traits include fertilization rate, ovulation rate and stillbirth rate. As the traits of Hanwoo are expressed by the genes of the individual, it is expected that the identification of the genes for certain traits and the selection and use of Hanwoo, which has excellent genes, will have a great effect in improving the abilities of Hanwoo. . However, it is also difficult to identify excellent genes, and because many genes are involved in traits at the same time, it is not easy to improve Hanwoo using genes at this time.
한우의 유전적 능력을 평가하는 종래기술로는 본 발명자들에 의해 대한민국 특허등록번호 10-590728호에 공지된 바 있으나, 본 발명은 한우의 우수 개체 판별 및 우수 종축 선발에서 가장 큰 부분을 차지하는 근내지방도(marbling score) 측정면에서 민감성 및 우수성을 나타내었다.Conventional techniques for evaluating the genetic ability of Hanwoo has been known by the inventors in Korean Patent Registration No. 10-590728, but the present invention is the closest part that occupies the largest part in the identification of the best individuals and selection of excellent breeders of Hanwoo Sensitivity and superiority were shown in terms of measuring the marbling score.
따라서 본 발명의 목적은 한우의 BAC 클론의 말단 염기서열에서 밝혀진 한우의 고유한 반복염기서열을 포함하는 마이크로새틀라이트 DNA 프라이머를 제공하는데 있다.It is therefore an object of the present invention to provide a microsatellite DNA primer comprising a unique repeat base sequence of Hanwoo, which is found in the terminal nucleotide sequence of a BAC clone of Hanwoo.
본 발명의 상기 목적은 한우 BAC DNA를 분리하고 한우 마이크로새틀라이트 DNA 염기서열을 분석한 다음 한우 마이크로새틀라이트 DNA 프라이머를 제작한 후 상기 한우 마이크로새틀라이트 DNA 프라이머의 검정 및 경제형질을 분석함으로써 달성하였다.The object of the present invention was achieved by separating the Hanwoo BAC DNA, analyzing the Hanwoo microsatellite DNA sequence, and then preparing the Hanwoo microsatellite DNA primer and analyzing the assay and economic traits of the Hanwoo microsatellite DNA primer. .
본 발명은 서열번호1 내지 2의 염기서열을 포함하는 한우 마이크로새틀라이트 DNA 프라이머를 제공한다.The present invention provides a Hanwoo microsatellite DNA primer comprising the nucleotide sequence of SEQ ID NO: 1 to 2.
또한 본 발명은 (a) 한우의 염색체에 대하여 서열번호 1 내지 2의 염기서열을 갖은 프라이머 세트를 이용하여 중합연쇄반응하는 단계; (b) 상기 (a) 단계에서 중합연쇄반응에서 분석된 유전자 마커의 크기를 분석하는 단계; (c) 상기 (b) 단계에서 분석된 크기의 유전자 마커를 갖는 한우의 경제형질을 분석하는 단계 및 (d) 상기 (b) 및 (c)의 결과로 유전자 마커의 크기별 특이적인 경제형질을 분석하는 단계를 포함하는 한우의 마이크로새틀라이트 DNA를 이용한 한우 품질 분석방법을 제공한다.In another aspect, the present invention (a) a polymerase chain reaction using a primer set having a nucleotide sequence of SEQ ID NO: 1 to 2 for the chromosome of Hanwoo; (b) analyzing the size of the gene marker analyzed in the polymerization chain reaction in step (a); (c) analyzing the economic traits of Hanwoo with the genetic markers of the size analyzed in step (b) and (d) analyzing the specific economic traits by size of the genetic markers as a result of (b) and (c) It provides a method for quality analysis of Korean beef using microsatellite DNA of Hanwoo comprising the step of.
본 발명은 한우 경제형질 마이크로새틀라이트 DNA 프라이머 1차 검정시에서는 30차에서 33차 한우 후대검정집단 240두 중에서 가계가 서로 다른 근대지방도가 1등급 이상인 개체 10두와 3등급인 개체 10두를 사용하였으며, 2차 검정에서는 240두 모두를 사용하였다. In the first assay of the Hanwoo Economic Microsatellite DNA Primer, 10 individuals with grade 1 or higher and 10 individuals with grade 3 were used. In the second test, both 240 were used.
본 발명에서 분석형질은 한우의 중요한 경제형질, 즉 생체중(Weight), 냉도체중(Carcass cold weight), 일당증체량(Average Daily gain), 등지방두께(Backfat thickness), 등심단면적(longissimus dorsi muscle area), 근내지방도(Marbling score)의 기록으로 분석하였다.In the present invention, analytical traits are important economic traits of Korean cattle, namely, weight, carcass cold weight, average daily gain, backfat thickness, and longissimus dorsi muscle area. ), And analyzed by the record of Marbling score.
본 발명에서 한우의 마이크로새틀라이 DNA 염기서열 분석시 유니버셜 시퀀싱 프라이머로 M13R과 T7을 사용하였다.In the present invention, M13R and T7 were used as universal sequencing primers in analyzing the microsatellite DNA sequence of Hanwoo.
본 발명에서 대립유전자란, 대립 형질을 지배하는 한 쌍의 유전자를 의미하며 염색체 위의 같은 유전자 자리에 위치하며, 서로 우성과 열성 관계에 있는 것이 보통이다.In the present invention, an allele means a pair of genes that dominate alleles, and is located at the same locus on a chromosome and is generally in recessive relationship with each other.
본 발명에서 유전자좌란 영어로 loci라고 하며 유전자 자위(locus)의 복수형을 의미하는 것으로 상동염색체상에서 양쪽의 유전자 자위를 합쳐서 유전자좌라고 한다.In the present invention, the locus is called loci in English and means a plural form of locus, and the locus of both genes on the homologous chromosome is called a locus.
본 발명에서 이형접합체율(H)은 특정 마커(marker)에 대하여 무작위로 개체를 선발하였을 때 그 마커에 대하여 이형접합체일 경우의 확률을 나타내며 그 값을 0에서 1사이의 값으로 나타낸 것으로써 이형접합체율의 값이 클수록 마커 다형성이 크고 유용성이 높다는 것을 알 수 있다.In the present invention, the heterozygote ratio (H) represents the probability of being a heterozygote for the marker when the individual is randomly selected for a specific marker, and the value is expressed as a value between 0 and 1. It can be seen that the greater the value of the conjugate ratio, the greater the marker polymorphism and the higher the usefulness.
본 발명에서 다양성정보상수(PIC)는 부모로부터 자손에 전달되는 대립유전자를 구별해 낼 수 있는 확률을 주어진 부, 모, 자손의 유전자형을 가지고 측정하였다.Diversity information constant (PIC) in the present invention was determined with the genotype of the parent, parent, and offspring the probability of distinguishing alleles transmitted from the parent to the offspring.
본 발명에서 하디-와인버그 평형(Hardy-Weinberg Equilibrium)이란, 외적인 요인이 작용하지 않는다면 유전자와 유전자형 빈도 모두가 변하지 않고 평형을 이루게 되는 것으로 이것을 만족하는 집단은 대립유전형질의 독립성이 성립하게 된다. 따라서 유전자좌 내에서의 독립성 검정은 X2 통계량을 이용한 적합도 검정으로 각 유전자형 범주에 대한 실제 관측빈도와 기대빈도를 이용하여 계산하였다.In the present invention, the Hardy-Weinberg Equilibrium is an equilibrium in which all of the genes and genotypes do not change without external factors. Therefore, the independence test in the locus was a goodness-of-fit test using the X2 statistic and was calculated using the actual observation frequency and the expected frequency for each genotype category.
본 발명은 한우 마이크로새틀라이트 DNA 염기서열을 분석하는 단계; 한우 마이크로새틀라이트 DNA 프라이머 검정하는 단계 및 한우 마이크로새틀라이트 DNA 프라이머의 경제형질을 분석하는 단계로 구성된다.The present invention comprises the steps of analyzing the Hanwoo microsatellite DNA sequence; Comprising the Hanwoo microsatellite DNA primer assay and analyzing the economic characteristics of the Hanwoo microsatellite DNA primer.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
실시예Example 1: 한우 1: Hanwoo BACBAC 염기서열 분석 Sequencing
한우 BAC 클론을 2X LB 배지(클로람페니콜 12.5㎍/㎖ 포함) 1.4㎖이 담겨있는 96 웰에 접종시키고, 37℃ 교반 배양기에서 320rpm, 24시간 배양하였다. 한우 BAC DNA 추출은 몬타지 BAC96 미니프렙 키트(Millpore)를 사용하여 추출하였다. 추출한 DNA(플라스미드)를 전기영동하여 DNA의 상태와 농도를 확인한 후 유니버셜 프라이머인 T7, M13R 프라이머와 함께 PCR(therocyler) 반응을 수행하였다. Hanwoo BAC clone was inoculated into 96 wells containing 1.4 ml of 2X LB medium (including 12.5 μg / ml of chloramphenicol) and incubated for 24 hours at 320 rpm in a 37 ° C. incubator. Hanwoo BAC DNA extraction was performed using the Montage BAC96 miniprep kit (Millpore). The extracted DNA (plasmid) was electrophoresed to confirm the state and concentration of DNA, and then PCR (therocyler) reaction was performed with T7 and M13R primers.
상기 중합연쇄반응 후 ABI 3730 DNA 시퀀서에 로딩(loading)하여 시퀀싱하고 얻어진 DNA 시퀀스는 분석프로그램을 이용하여 벡터에 해당하는 DNA 시퀀스 부분을 삭제하고, 검증된 확실한 염기서열(high quality sequence)만을 체계적으로 정리, 보관하였다. 두 개의 유니버셜 시퀀스 프라이머(M13R과 T7)를 이용해 5'과 3' 말단 염기서열을 수득하였다. 이렇게 얻어진 한우 염기서열로 한우의 마이크로새틀라이트 DNA 염기서열을 분석하였다.After the polymerase chain reaction, loading and sequencing the loaded ABI 3730 DNA sequencer is performed by using an analysis program to delete the DNA sequence corresponding to the vector, and systematically confirming only the high quality sequence verified. Organized and stored. Two universal sequence primers (M13R and T7) were used to obtain 5 'and 3' terminal sequences. The microsatellite DNA sequence of Hanwoo was analyzed with the obtained Hanwoo nucleotide sequence.
실시예Example 2: 한우 2: Korean beef 마이크로새틀라이트Microsatellite DNADNA 프라이머primer 제작 making
상기 실시예 1의 중합연쇄반응으로 유전분석 및 마이크로새틀라이트 염기서열의 다형화에 따른 경제형질과의 상관관계 분석을 위하여 본 발명의 한우 고유(TA)n 반복염기서열을 밝히기 위하여 Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)를 사용하여 서열번호 1 내지 2의 프라이머를 제작하였으며 본 발명의 발명자들은 본 발명 프라이머를 HWYU2TA-165로 명명하였다. 하기 [표 1]은 서열번호 1과 2를 이용하여 동정한(TA)n 반복염기서열을 포함하는 DNA 염기서열을 나타내고 있다. 이때, 이탤릭체로 된 것은 제작된 프라이머 서열번호 1과 2이고, 밑줄 친 염기서열은 (TA)n 반복염기서열을 의미한다.In order to clarify the Hanwoo native (TA) n repeat base sequence of the present invention for the correlation analysis with the economic trait according to the genetic analysis and polymorphism of the microsatellite sequence by the polymerization chain reaction of Example 1 Primer3 software (http: //frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) were used to prepare primers of SEQ ID NOS: 1-2 and the inventors of the present invention named the primers of the invention HWYU2TA-165. Table 1 below shows the DNA base sequence including the (TA) n repeat base sequence identified using SEQ ID NOs: 1 and 2. In this case, italics are prepared primers SEQ ID NO: 1 and 2, the underlined base sequence means (TA) n repeat base sequence.
서열번호 1: TTCCCACCTTTACTGTGCTCTGSEQ ID NO: TTCCCACCTTTACTGTGCTCTG
서열번호 2: GGATTTTCAAGTAGGGTCACCASEQ ID NO: GGATTTTCAAGTAGGGTCACCA
본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머를 사용하여 얻어진 한우의 DNA 다형현상은 [도 1]과 같다. 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머의 156 bp 대립유전자는 근내지방도가 1등급이상인 집단에서 60%의 출현율을 나타내었으며 3등급인 집단에서는 40%의 출현율을 나타내었다. DNA polymorphism of Hanwoo obtained using the present invention HWYU2TA-165 microsatellite DNA primer is shown in FIG. The 156 bp allele of the HWYU2TA-165 microsatellite DNA primer of the present invention exhibited a prevalence of 60% in the group with intramuscular fat level 1 or higher and 40% in the group with grade 3 grade.
실험예 1: 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머의 검정 Experimental Example 1 Assay of the Invention HWYU2TA-165 Microsatellite DNA Primer
본 발명 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머의 다형성을 나타내는 방법으로 마커의 이형접합체율(heterozygosity, H)을 측정하는 방법과 다양성정보상수(polymorphism information content, PIC)값을 측정하는 방법을 사용하였다.As a method for indicating polymorphism of the HWYU2TA-165 microsatellite DNA primer, a method of measuring heterozygosity (H) of a marker and a method of measuring polymorphism information content (PIC) value are used. It was.
이형접합체율은 특정 마커에 대하여 무작위로 개체를 선발하였을 때 그 마커에 대하여 이형접합체일 경우의 확률을 나타내는 값으로 하기 식을 이용하여 0에서 1사이의 값으로 나타내었다. The heterozygote ratio is a value representing the probability of a heterozygote when a subject is randomly selected for a specific marker and is expressed as a value between 0 and 1 using the following equation.
다양성정보상수(PIC)는 부모로부터 자손에 전달되는 대립유전자를 구별해 낼 수 있는 확률을 주어진 부, 모, 자손의 유전자형을 측정한 것으로 하기 식으로 측정하였다.Diversity Information Constant (PIC) is a measure of the genotype of a given parent, parent, and offspring to determine the probability of distinguishing alleles transmitted from parent to offspring.
하디-와인버그 평형(Hardy-Weinberg Equilibrium)은 유전자좌 내에서의 독립성 검정 X2 통계량을 이용한 적합도 검정으로 각 유전자형 범주에 대한 실제 관측빈도와 기대빈도를 이용하여 하기 식으로 측정하였다.Hardy-Weinberg Equilibrium is a goodness-of-fit test using the independence test X2 statistic in the locus, which was measured by the following equation using actual observation frequency and expected frequency for each genotype category.
본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머에서 DNA 마커 적합성 검정은 [표 2]에서와 같이, 이형접합체율이 84.5%였으며, 다양성정보상수(PIC)는 82.7%로 나타났다. 또한 하디-와인버그법칙이 성립한 것은 대립유전자들 간의 독립성이 검정되었다는 것을 의미하였다.DNA marker conformity assay of the present invention HWYU2TA-165 microsatellite DNA primer, heterozygote ratio was 84.5%, diversity information constant (PIC) was 82.7% as shown in [Table 2]. The establishment of Hardy-Weinberg's law also meant that independence between alleles was tested.
실험예 2: 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머의 경제형질 분석Experimental Example 2: Economic trait analysis of the present invention HWYU2TA-165 microsatellite DNA primer
한우의 DNA 추출은 phenol-chloroform 방식(Sambrook and Russell, 2001)을 사용하였으며, 추출된 DNA들은 정량분석을 통해 1.5 내지 1.8 ㎍/㎕의 농도를 가지는 DNA를 사용하였다. Hanwoo DNA extraction was performed using the phenol-chloroform method (Sambrook and Russell, 2001). The extracted DNA was quantitatively analyzed using DNA having a concentration of 1.5 to 1.8 ㎍ / μl.
중합연쇄반응은 20ng 제노믹 DNA, 각 5 pmol 프라이머(forward and reverse primer), 0.2 mM dNTPs, 1× PCR buffer, 1 unit Taq polymerase를 혼합하여 총 10 ㎕가 되도록 멸균 증류수를 첨가하였으며 94℃에서 5분간, 94℃에서 30초간, 58℃에서 30초간, 72℃에서 1분간을 29회 반복 수행한 후 72℃에서 30분간 1회 반응하였다.Polymerization chain reaction was a mixture of 20ng genomic DNA, 5 pmol primer (forward and reverse primer), 0.2 mM dNTPs, 1 × PCR buffer, 1 unit Taq polymerase and added sterile distilled water to a total of 10 μl. For 30 minutes at 94 ° C., 30 seconds at 58 ° C., and 1 minute at 72 ° C. was repeated 29 times, followed by one reaction at 72 ° C. for 30 minutes.
상기 반응 후 PCR 산물들은 포르마미드(formamide)가 포함된 buffer 6㎕와 혼합하여 변성시킨 후 6% 시퀀싱 폴리아크릴아미드 젤로 Hoefer SQ3 Sequencer(Hoefer Pharmacia Biotech Inc., San Francisco, CA USA)에서 1,900 volts, 50 mA, 75 W로 1시간 30분 내지 2시간 전기영동을 하였다. After the reaction, PCR products were mixed with 6 μl of formamide-containing buffer, denatured, and then 1,900 volts in a Hoefer SQ3 Sequencer (Hoefer Pharmacia Biotech Inc., San Francisco, CA USA) with 6% sequencing polyacrylamide gel. , 50 mA, 75 W was subjected to electrophoresis for 1 hour 30 minutes to 2 hours.
본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머 부위를 탐색했을 때 156bp의 대립유전자(allele)가 존재하는 개체의 성적은 [표 3]에 나타낸 것과 같이, 개체유전자가 나타나지 않은 집단보다 근내지방도와 등심단면적에서 유의적으로 높은 성적으로 분석되었다. 등심단면적에서 156bp 대립유전자를 가지는 개체는 가지지 않는 개체보다 2.26㎠ 높았으며 근내지방도에서는 1.58㎠의 차이를 나타내었다.When the HWYU2TA-165 microsatellite DNA primer site of the present invention was searched, the results of the individuals with alleles of 156 bp showed intramuscular fat and loin cross-sectional area than those without the individual genes, as shown in [Table 3]. Significantly higher grades were analyzed in. Individuals with 156bp alleles in the loin cross section were 2.26 cm 2 higher than those without the 156bp allele and 1.58 cm 2 in intramuscular fat.
또한 본 발명 HWYU2TA-165 마이크로새틀라이트 DNA 프라이머는 한우 쇠고기가 수입 쇠고기와 차별화할 수 있는 형질인 근내지방도를 측정하는 근내지방도 등급이 1.58등급 차이일 경우 하기 [표 4]에 나타낸 것과 같이 고급육등급(1+와 1등급) 비율이 24.7%로 한우 집단의 평균 14.6%에 비해 10.1%정도를 개량할 수 있는 유전적 표식으로 활용할 수 있다.In addition, the present invention HWYU2TA-165 microsatellite DNA primer is a high grade meat grade as shown in the following [Table 4] when the intramuscular fat grade for measuring the intramuscular fat degree, which is a trait that can be differentiated from the imported beef is Hanwoo beef (Table 4) The ratio of 1+ and 1) is 24.7%, which can be used as a genetic marker that can improve 10.1% compared to the average 14.6% of the Korean cattle.
이상의 실시예 및 실험예를 통하여 설명한 바와 같이 한우의 고유한 마이크로새틀라이트 DNA를 탐색하기 위하여 제작된 본 발명 HWYU2TA-165 프라이머는 156 bp 대립유전자에서 나타나는 유전자 마커(DNA marker)의 유무를 분석함으로써 한우의 우수개체의 판별, 우수 종축의 선발 및 고급육 집단의 사양관리의 선정에 뛰어난 효과가 있으므로 한우 축산산업상 매우 유용한 발명인 것이다.As described in the above Examples and Experimental Examples, the HWYU2TA-165 primer of the present invention prepared to search for unique microsatellite DNA of Hanwoo was analyzed by analyzing the presence or absence of a DNA marker in the 156 bp allele. It is a very useful invention for the livestock industry in Hanwoo because it has an excellent effect on the identification of excellent individuals, selection of excellent breeders and selection of stock management for high-quality breeding populations.
서열목록 전자파일 첨부 Attach sequence list electronic file
Claims (4)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020060128045A KR100816476B1 (en) | 2006-12-14 | 2006-12-14 | Microsatellite dna primer related to economic traits in hanwoo |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020060128045A KR100816476B1 (en) | 2006-12-14 | 2006-12-14 | Microsatellite dna primer related to economic traits in hanwoo |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR100816476B1 true KR100816476B1 (en) | 2008-03-26 |
Family
ID=39411581
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020060128045A KR100816476B1 (en) | 2006-12-14 | 2006-12-14 | Microsatellite dna primer related to economic traits in hanwoo |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR100816476B1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20050061145A (en) * | 2003-12-18 | 2005-06-22 | 학교법인 영남학원 | A new primer set and a selective method of hanwoo using said primer set |
| KR20050061811A (en) * | 2003-12-18 | 2005-06-23 | 학교법인 영남학원 | A new primer set and a selective method of hanwoo using said primer set |
| KR20060044093A (en) * | 2004-11-11 | 2006-05-16 | 영남대학교 산학협력단 | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same |
-
2006
- 2006-12-14 KR KR1020060128045A patent/KR100816476B1/en not_active IP Right Cessation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20050061145A (en) * | 2003-12-18 | 2005-06-22 | 학교법인 영남학원 | A new primer set and a selective method of hanwoo using said primer set |
| KR20050061811A (en) * | 2003-12-18 | 2005-06-23 | 학교법인 영남학원 | A new primer set and a selective method of hanwoo using said primer set |
| KR20060044093A (en) * | 2004-11-11 | 2006-05-16 | 영남대학교 산학협력단 | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same |
Non-Patent Citations (2)
| Title |
|---|
| NCBI GenBank Accession No.AC186846 |
| NCBI GenBank Accession No.XM_604573 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101432164B1 (en) | Novel haplotype marker for discriminating level of meat quality of Pig and use thereof | |
| CN109929935B (en) | Method for identifying pig backfat thickness based on rs80995809 locus genotyping and application thereof | |
| KR101929391B1 (en) | Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof | |
| WO2018218857A1 (en) | Myh4 gene molecule marker for improved pork quality and use thereof in porcine genetic improvement | |
| KR101418402B1 (en) | Novel SNP marker for discriminating level of loinmuscle area of Pig and use thereof | |
| CN107164463A (en) | It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits | |
| KR100804310B1 (en) | 4 DNA marker of adipocyte-fatty acid binding protein gene related the intramuscular fat content in beef cattle | |
| KR101723185B1 (en) | A polynucleotide for predicting marbling score in Hanwoo and diagnosing method using the same | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| KR100816476B1 (en) | Microsatellite dna primer related to economic traits in hanwoo | |
| CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
| KR102001528B1 (en) | Gene marker for discrimination of Korean Native pig and use thereof | |
| KR101289484B1 (en) | Method of genetic test for diagnosis of marbling trait in Korean cattle | |
| KR101307008B1 (en) | Diagnosis method of high meat producing Hanwoo using the DNA marker associated with marbling score | |
| EP1660675B1 (en) | Polymorphism of the igf2 gene and improving production characteristics of cattle | |
| KR101878539B1 (en) | Nucleotide polymorphism markers for Foxglove aphid resistance in soybean and the use thereof | |
| KR101663404B1 (en) | Single nucleotide polymorphism marker in TDRKH gene for diagnosis of meat quality in Hanwoo and method for diagnosis of meat quality in Hanwoo using same marker | |
| KR100590728B1 (en) | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same | |
| CN116676400B (en) | Molecular marker, primer, kit, method and application related to intramuscular fat traits of pigs | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| KR101417389B1 (en) | Development of genetic marker related to maturity score in Hanwoo | |
| CN116334235B (en) | SERCA2 gene molecular marker related to chicken carcass traits and application thereof | |
| KR101307087B1 (en) | Diagnosis method of high quality meat using the SNP marker in Hanwoo | |
| Choroszy et al. | Polymorphism of selected microsatellite DNA sequences in Simmental cattle chosen for identification of QTLs for meat traits. | |
| KR100561101B1 (en) | A new primer set and a selective method of Hanwoo using said primer set |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20130107 Year of fee payment: 6 |
|
| FPAY | Annual fee payment |
Payment date: 20140106 Year of fee payment: 7 |
|
| FPAY | Annual fee payment |
Payment date: 20150120 Year of fee payment: 8 |
|
| FPAY | Annual fee payment |
Payment date: 20160113 Year of fee payment: 9 |
|
| LAPS | Lapse due to unpaid annual fee |