KR100590728B1 - Microsatellite dna associated with economic traits in hanwoo and primer for detecting same - Google Patents

Abstract

 The present invention relates to microsatellite DNA and its analytical primer sets which are associated with economic traits of Hanwoo. In particular, the present invention provides a microsatellite DNA region showing the economic traits of a Korean cattle and a primer set capable of detecting the same, so that the genetic ability can be accurately and easily evaluated according to the growth stage of the domestic cattle, and also distinguishing excellent individuals. This can be useful for the selection of excellent breeders and for the management of high quality breeding stocks.

Hanwoo, repeat base, genetic marker, economic trait

Description

MICROSATELLITE DNA ASSOCIATED WITH ECONOMIC TRAITS IN HANWOO AND PRIMER FOR DETECTING SAME}

Figure 1 shows the results of PCR of DNA obtained from 269 cows using the primers of SEQ ID NO: 1 and 2.

[TECHNICAL FIELD OF THE INVENTION]

The present invention relates to a microsatellite DNA and a primer set for analysis thereof, which are related to the economic traits of Hanwoo, and more particularly, SEQ ID NO: 1 and sequence prepared to search for the repeat base sequence of the native microsatellite DNA of Hanwoo The present invention relates to a primer set consisting of No. 2 and a method of selecting Hanwoo having excellent economic traits by analyzing the presence or absence of a DNA marker associated with a Hanwoo economic trait using the primer set.

[Private Technology]

As a unique genetic resource in Korea, Hanwoo is a product of Korean history that has been maintained for hundreds of years. Since 1970, since the mechanization of agriculture and the industrial value of agriculture have diminished, Hanwoo has played an important role as a beef for supplying beef that suits the tastes of Korean consumers. In recent years, the importance and value of Korean beef have increased as well as the maintenance and preservation of genetic resources as well as the maintenance and preservation of genetic resources as well as the opening of beef imports following the changes in the international market economy of the WTO and FDA.

Most studies on cows in developed countries, which are exporters of beef, are mostly based on genetic research. The development of new genetic research techniques and the discovery of genes related to economic traits are carried out by biotechnology to improve domestic cattle. ought. In particular, it has been found that the repeat base sequence of microsatellite DNA, which is about 40% of the bovine genome is repeated, many studies on such a repeat base sequence has been made, and the creation of a genetic map through these Quantitative trait loci (QTL) have been achieved (Ruyter-Spira et al., 1996; Fridolfsson et al., 1997; Yang et al., 1998, 1999; Lahbib-Mansais et al., 1999; Grosse et al., 2000).

Economic traits mean economically valuable traits among many traits of many domestic animals including Korean cattle, and in the case of Korean cattle, economic traits can be classified into three types: growth traits, carcass traits, and breeding traits. When subdivided in Korean cattle, growth traits include live weight, wean weight, 6 months old, 12 months old, 18 months old, factory weight and body shape. It can be divided into chest, chest, chest, rectangle, anterior tube, sciatic width, and horn width.The carcass shape includes carcass weight, backfat thickness, abdominal muscle cross-sectional area, intramuscular fat and carcass rate, and the fertilization shape contains fertilization rate, ovulation rate, The stillbirth rate, etc., and in addition, Hanwoo has a variety of traits. Since the traits of Hanwoo are expressed by the genes owned by the individual, identifying the genes for certain traits and selecting and using Hanwoo, which has a good ability, will have a great effect in improving the ability of the Korean beef. will be. However, although it is difficult to identify genes involved, the improvement of Hanwoo using genes is not an easy method at this time because several genes are involved at the same time.

On the other hand, microsatellite is a repetitive DNA group that repeats 2 to 6 nucleotide sequences, and is non-coding DNA sequence evenly distributed in the genome and exhibiting very high polymorphism. (Jajc I and Sampson J (1999) Utility of canine microsatellites in revealing the relationships of pure bred dogs.J Hered 90: 104-107). Diversity is recognized between individuals according to the number of repeat units in a particular locus (Koreth J, O'Leary JJ and McGee JO (1996) J Pathol 178: 239-248.). When polymerase chain reaction (PCR) is carried out using a primer designed in an adjacent region, a polymorphism is observed in the length of the PCR product, and the DNA polymorphism can be detected. Polymorphism detection markers using microsatellites are called microsatellite markers (O. Parnaud, et al., Mol. Gen. Genet. 252: 597-607, 1996). Like other genes, microsatellites are delivered to children according to Mendel's genetic law and can be amplified using PCR, and co-dominant when electrophoresed.

In particular, microsatellite can be amplified from 2 to up to 8 primers simultaneously due to its small size (Chamberlain JS et al., (1988) Nucleic Acids Res 16: 11141-11156). This saves time and money, and results in high sensitivity and accuracy. Thus, such microsatellites are highly valuable in the field of molecular breeding of livestock and can be used not only to prevent degeneration by inbreeding but also to select specific traits. However, pure polymorphisms such as Korean cattle have rarely been subjected to genetic polymorphism analysis using the microsatellite method, and there are no reports of genetic allele frequencies.

In order to solve the problems of the prior art, an object of the present invention is to provide a microsatellite DNA having a linkage between the economic quality of Hanwoo.

It is also an object of the present invention to provide a primer set for detecting the microsatellite DNA.

In addition, an object of the present invention is to provide a method capable of selecting a Hanwoo having an excellent economic trait by analyzing the microsatellite DNA.                         

In addition, an object of the present invention is to provide a method for quality analysis of Korean beef using microsatellite DNA of Hanwoo.

In order to achieve the above object, the present invention is a nucleotide sequence consisting of cytosine and adenine is repeated 12 to 23 times, the sequence of SEQ ID NO: 7 at the 5 'end, the sequence of SEQ ID NO: 8 at the 3' end, or Provided are microsatellite DNAs having economic trait specificity of Hanwoo including its complementary nucleotides.

In another aspect, the present invention provides a primer set for detecting native microsatellite DNA of Hanwoo consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 1 (TgTggTCATgCTCTTCTCCA) and a primer comprising a nucleotide sequence of SEQ ID NO: 2 (AAAACTCTgCCgACTCgTgT).

In another aspect, the present invention provides a method for selection of a Korean beef having an excellent economic trait comprising identifying a genetic marker comprising a repeat base sequence of the specific microsatellite DNA associated with economic traits of the Hanwoo gene using the primer set.

In another aspect, the present invention (a) performing PCR with the primer set on the chromosome of Hanwoo, (b) analyzing the size of the gene marker amplified by the PCR, (c) the analysis in step (b) Analyzing the economic traits of Hanwoo having a genetic marker of the size and (d) analyzing the specific economic traits of the size of the genetic markers through the results of (b) and (c) Provided is a quality analysis method of Korean beef using light DNA.

Hereinafter, the present invention will be described in detail.

The present invention relates to microsatellite DNA showing polymorphism according to the economic trait characteristics of Hanwoo and an economic trait analysis method of the Korean beef using the same.

Microsatellite DNA exhibiting polymorphism according to the economic characteristics of the Korean beef of the present invention includes a sequence in which thymine-guanine is repeated or a sequence in which cytosine-adenine is repeated. That is, the microsatellite DNA contains (TG) n or (CA) n, where n is a natural number of 12 to 23. In addition, the microsatellite DNA may further include a repetitive sequence, that is, a sequence of SEQ ID NO: 5 at the 5 ′ end of (TG) n (tctgtctgtattggtgtggaaagtcc), and further include a sequence of SEQ ID NO: 6 at the 3 ′ end (cgcgcgtgtatg). In addition, the repetitive sequence (CA) n is the sequence of SEQ ID NO: 7 at the 5 'end (catacacgcgcg) or the sequence of SEQ ID NO: 8 at the 3' end (ggactttccactccaatacagacaga).

The microsatellite DNA of the present invention can be used as a genetic marker representing the economic traits of Hanwoo. Accordingly, the present invention provides a method for quality analysis of Korean beef using microsatellite DNA of Hanwoo.

Hanwoo quality analysis method of the present invention, (a) performing PCR with the primer set for microsatellite DNA analysis on the chromosome of Hanwoo, (b) analyzing the size of the gene marker amplified by the PCR, (c) analyzing the economic traits of Hanwoo with the genetic markers of the size analyzed in step (b) and (d) the specific economic traits by size of the genetic markers through the results of (b) and (c) Analyzing may include.

In step (a), the primer set may comprise 10 to 50 bp of each contiguous polynucleotide located at a 5 to 100 bp site adjacent to the 3 'and 5' sites of the microsatellite DNA. Examples of the primer set include, but are not limited to, a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1 and a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 2. PCR can be performed according to a conventional PCR method.

In step (b), the PCR product amplified by PCR is called a gene marker, and the size of the gene marker is performed by a conventional method such as electrophoresis using an agarose gel or acrylamide gel, and then the developed DNA fragments are fluorescent. It can be confirmed through dyeing. The size analysis method of the PCR product in the above step can be carried out by those skilled in the art to which the present invention pertains, and can include all conventional methods other than the method described as an example.

In one embodiment of the present invention, PCR was carried out using primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 to identify gene markers having sizes of 104 bp, 110 bp, 112 bp, 115 bp, 118 bp, 120 bp, 122 bp, 124 bp, and 126 bp. That is, the site amplified by the primer set is a site where polymorphism exists.

Step (c) is a step of analyzing the economic traits of Hanwoo categorized by the size of the genetic marker in step (b). Economic traits can be selected from the group consisting of growth traits, carcass traits and breeding traits, which can be easily analyzed by conventional economic trait analysis methods. The growth traits may be subdivided into live weight, weaning weight, 6 months old weight, 12 months old weight, 18 months old weight, weight at shipment and body shape, and the body shape is specifically length, height, cruciate weight, breakdown, thorax, It can be divided into thoracic width, thoracic heart, yaw width, anterior tube position, sciatic width and width. The carcass morphology may be subdivided into carcass weight, backfat thickness, intestinal muscle cross-sectional area, intramuscular fat and carcass rate, and the breeding trait may be subdivided into fertilization rate, ovulation rate and stillbirth rate.

Step (d) is to determine whether there is a common economic trait characteristic in the Hanwoo population having a specific size genetic marker based on the result of (c), and there is a correlation between the size of the genetic marker and the economic trait characteristic. In this case, by analyzing only the size of the genetic markers of the cattle, it is easy to identify the economic characteristics of the cattle, as well as to improve the individual population of the cattle to have the desired economic characteristics.

In the present invention, when analyzed by the primer set of SEQ ID NO: 1 and 2, the economic trait of Hanwoo having a genetic marker of 120 bp or 115 bp size was analyzed, and as a result, the genetic marker of 120 bp is characterized by high intramuscular fat of Hanwoo The gene marker of 115 bp was observed in the trait of high back fat thickness of Korean cattle. In other words, when PCR was performed using the primer sets of SEQ ID NOs: 1 and 2, when a 120 bp genetic marker was observed, the sample Hanwoo had a high intramuscular fat trait, and when the 115 bp genetic marker was observed, the sample Hanwoo was equal fat. It could be determined that it is an excellent variety having a thick trait.

Thus, the present invention uses a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2, to repeat the repeat base sequence of specific microsatellite DNA associated with the economic trait of the Hanwoo gene Provided is a method for selection of Korean cattle with excellent economic traits, including identifying genetic markers. Preferably, the selection method includes (a) performing PCR on the chromosome of Hanwoo with the primer set, and (b) screening Hanwoo having a size of 120 bp or 115 bp. It may include the step. Specific PCR conditions and methods can be carried out in accordance with conventional PCR methods.

The unique microsatellite DNA of the present invention and the economic trait analysis method using the same can be used to accurately and easily evaluate the genetic ability of the cattle, regardless of the timing of the growth of the cattle, discrimination of excellent individuals, excellent breeders It can be useful for the selection and management of high quality meat group.

Hereinafter, examples of the present invention will be described. The following examples are only for illustrating the present invention and the present invention is not limited to the following examples.

Example 1 Preparation of Primer Using Hanwoo's Native Microsatellite DNA

1-1. Laboratory animals

The National Agricultural Cooperative Federation's 269 26-28th Korean Native Cattle Protest Group, which were raised for 705 days, were used.The important economic characteristics of Korean cattle were Marbling score, Daily gain, and Backfat thickness. And records of the M. longissimus dorsi area were used.

1-2. Microsatellite DNA Analysis

An Improved Approach for Construction of Bacterial Artificial Chromosome Libraries. 1998. Genomics 52 : 1-8) was used to construct a BAC clone containing a total of 150,000 different regions of Hanwoo chromosome. Hanwoo chromosomal DNA partially digested with EcoR I and Hind III restriction enzymes was inserted into pBACe3.6 vector and pIndigoBAC-5 vector, respectively, and transfected into bacterial competent cells using an electrophorator. It was transformed. Among the transformants, only the BAC clones containing the chromosomal DNA of Hanwoo on LB solid medium (sodium chloride 10g, tryptone yeast 5g, tryptone peptone 10g, bacto-agar 15g, deionized H ₂ O 1L) were selectively separated into glycerol stocks. (glycerol stock) was made in the form and stored at -80 ℃.

Two universal sequencing primers, RP2 priemr (SEQ ID NO: 3): 5'-GAGCCAATATGCGAGAAC ACCCGAGAA-3 'and T7 primer (SEQ ID NO: 4): 5'-AATACGACTCACTATA-3' synthesized by Macrogen Co., Ltd. 5 'and 3' terminal sequences were analyzed for a total of 2,794 clones (5,588 sequencing reaction). As a result, the base sequence of the Korean cattle chromosome of about 3.3 million base pairs (3.3 Giga base) was identified, and the base sequence of the microsatellite DNA was analyzed using a computer program in the Bioinformatics Laboratory of the Institute of Biotechnology, Illinois State University. It was. This secured a region having a repeat base sequence of (CA) _n in the microsatellite DNA of Hanwoo.

1-3. Primer production

For genetic analysis through PCR and correlation analysis with economic traits according to polymorphism of each microsatellite sequence, PCR primers that recognize only nucleotide sequences around (CA) n are prepared by Primer3 program (http: // www). .broad.mit.edu / cgi-bin / primer / primer3_www.cgi). The base sequence of the primer is represented by SEQ ID NO: 1 and SEQ ID NO: 2. Table 1 below shows the DNA base sequence including the (CA) ₂₀ repeat base sequence identified using the primer. At this time, italicized is the prepared primer, the underlined base sequence means (CA) ₂₀ repeat base sequence.

Table 1

Primer Name order HWYU2CA-53 TgTggTCATgCTCTTCTCCA TCTgTCTgTATTggTgTggAAAgTCC TgTgTgTgTgTgTgTgTgTgTgTgTgTgTgTgTgTgTgTg CgCgCgTgTATg AAAACTCTgCCgACTCgTgT

Example 2 Analysis of Correlation between DNA Polymorphism of Korean Cattle and Korean Cattle with Excellent Economic Characteristics

When PCR was performed with the primer of Example 1, DNA polymorphism of Korean cattle was confirmed. FIG. 1 shows PCR results of DNAs obtained from 269 cows using primers of SEQ ID NOs: 1 and 2, and PCR products of 104bp, 110bp, 112bp, 115bp, 118bp, 120bp, 122bp, 124bp, and 126bp are identified. It became. This means that there is polymorphism at the site amplified by the primer for each Korean cattle.

In order to analyze the correlation between the polymorphism and Hanwoo economic traits, a quantitative trait loci (QTL) was performed (Kuhn et al. Animal Genetics 30: 333-40. (1999); Stone et al. Plant & Animal Genome Ⅶ Conference 17-21. (1999); Stone et al. Journal of Animal Science 77 (6): 1379-1384. (1999)).

Table 2 shows the economic trait characteristics of Hanwoo according to the size of the microsatellite DNA at the polymorphic region of 115 bp or 120 bp.In the case of 46 individuals with 120 bp alleles, the intramuscular fat profile was higher than those with no alleles (223 heads). Was significantly higher than that of. In the 115bp allele, there was a significant difference in backfat thickness.

Table 2

Microsatellite allele Economic characteristics bp Presence of DNA marker Number of objects Intramuscular fat map Daily weight gain (g) Back fat thickness (mm) Fillet cross section (cm ² ) 115 Yes 60 6.57 + 0.45 670 + 10 7.52 +  0.38 ^a 71.63 + 1.11 No 209 7.48 + 0.31 674 + 5 6.48 + 0.18 ^b 74.08 + 0.57 120 Yes 46 8.89 +  0.74 ^a 666 + 11 6.87 + 0.51 74.65 + 1.36 No 223 6.95 + 0.27 ^b 675 + 5 6.68 + 0.17 73.30 + 0.54 Overall / average 269 7.28 + 0.26 673 + 4 6.71 + 0.16 73.54 + 0.51 ^a , ^b : The allele's ability to have DNA markers differs at a 99% significance level

Table 3 shows the distribution of intramuscular fat for Hanwoo with allele 115 bp or 120 bp. The population with 120bp allele was 50% of high-grade meat grade, which was improved compared to the average 31% of the Hanwoo population. It can be seen that it has a trait. That is, the microsatellite site analyzed by the primer of Example 1 can be used as a genetic marker to determine the high grade meat grade of Hanwoo.

Table 3

Allele Range of marbling degree Grade 1 or higher (high grade%) bp Number of individuals 1+ (16-19) 1 (10-15) 2 (4-9) 3 (1-3) 115 60 0 (0%) 16 (27%) 31 (52%) 13 (22%) 60 (27%) 120 46 6 (13%) 17 (37%) 12 (26%) 11 (24%) 46 (50%) gun 269 13 (5%) 69 (26%) 126 (47%) 61 (23%) 82 (31%) Grade 1 or higher: refers to individuals with a meat grade of 1+ and 1.

Thick 1.04mm thick back fat compared to Korean beef, which does not contain 115bp size, has the negative effect of reducing meat mass, but due to the physiological characteristics of thickening the back fat at high weight at all times and thickening the back fat to increase intramuscular fat The decrease in meat (meat except bone and by-products) can be said to be very valuable in terms of economic value.

Table 4 shows the results of quantitative locus analysis of Hanwoo including both 115 bp and 120 bp sizes. The Lod value was statistically significant when the value was 3.0 or more. In the quantitative trait locus analysis, the Lod value of the intramuscular fat was 9.99 and the Lod value was also measured at the back fat thickness.

Lod values were performed by QTL (quantitative trait loci) analysis and marker assisted selection (MAS). Based on the QTL analysis, MAS related to intramuscular fat score was analyzed using the loci with a Lod score of 3.0 or higher.

Table 4

primer Lod value Intramuscular fat map Daily weight gain (g) Back fat thickness (mm) Fillet cross section (cm ² ) Primer of Example 1 9.99 4.38 9.69 6.48

As described above, the primer set for searching for the repeat base sequence of the native microsatellite DNA of the present invention, using the presence or absence of DNA markers appearing in the 120bp and 115bp alleles for analysis, growth of Hanwoo It is possible to evaluate the genetic ability accurately and easily at any time of the process, which can be useful for the identification of good individuals, the selection of good breeders, and the selection of stock management for high-quality meat groups.

Attach sequence list electronic file  

Claims (7)

A repeating sequence (CA) n, wherein (CA) means a sequence in which cytosine and adenine are alternately repeated one by one, n means a natural number of 12 to 23, and the repeating sequence is a 5 'terminus. A microsatellite DNA having economic trait specificity of Hanwoo having a polynucleotide, or a polynucleotide complementary thereto, which is present between the sequence of SEQ ID NO: 7 and the sequence of SEQ ID NO: 8 at the 3 'end. A primer set for detecting native microsatellite DNA of Hanwoo, comprising a primer having a nucleotide sequence of SEQ ID NO: 1 and a primer having a nucleotide sequence of SEQ ID NO: 2. 3. The primer set of claim 2, wherein said primer set identifies an allele of size 120 bp or 115 bp. A method of selecting a Hanwoo with superior economic trait, comprising identifying a genetic marker comprising a repeat base sequence of microsatellite DNA having economic trait association of the Hanwoo gene using the primer set of claim 2. The method of claim 4, wherein the selection method is (a) performing PCR with the primer set on the chromosome of Hanwoo; And (b) selecting a Korean cattle with a genetic marker having a size of 120 bp and / or 115 bp of the gene marker amplified by PCR. (a) performing PCR with the primer set of claim 2 or 3 on the chromosome of Hanwoo; (b) analyzing the size of the genetic marker amplified by the PCR; (c) analyzing the economic traits of Hanwoo having a genetic marker of the size analyzed in step (b); And (d) analyzing specific economic traits by size of the genetic markers based on the results of (b) and (c); Hanwoo quality analysis method using a microsatellite DNA of Hanwoo comprising a. 7. The method of claim 6, wherein the economic trait is selected from the group consisting of growth traits, carcass traits, and breeding traits.

Images