KR100590728B1 - Microsatellite dna associated with economic traits in hanwoo and primer for detecting same - Google Patents
Microsatellite dna associated with economic traits in hanwoo and primer for detecting same Download PDFInfo
- Publication number
- KR100590728B1 KR100590728B1 KR1020040091892A KR20040091892A KR100590728B1 KR 100590728 B1 KR100590728 B1 KR 100590728B1 KR 1020040091892 A KR1020040091892 A KR 1020040091892A KR 20040091892 A KR20040091892 A KR 20040091892A KR 100590728 B1 KR100590728 B1 KR 100590728B1
- Authority
- KR
- South Korea
- Prior art keywords
- hanwoo
- economic
- traits
- primer
- sequence
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/151—Modifications characterised by repeat or repeated sequences, e.g. VNTR, microsatellite, concatemer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
본 발명은 한우의 경제형질과 연관성 있는 마이크로새틀라이트 DNA 및 이의 분석용 프라이머 세트에 관한 것이다. 특히 본 발명은 한우의 경제형질을 나타내는 마이크로새틀라이트 DNA 부위 및 이를 검출할 수 있는 프라이머 세트를 제공하여, 한우의 성장과정 시기에 따라 정확하고 간편하게 유전적 능력을 평가할 수 있으며, 또한 우수 개체의 판별, 우수 종축의 선발 및 고급육 집단의 사양관리 선정에 유용하게 활용 가능하다. The present invention relates to microsatellite DNA and its analytical primer sets which are associated with economic traits of Hanwoo. In particular, the present invention provides a microsatellite DNA region showing the economic traits of a Korean cattle and a primer set capable of detecting the same, so that the genetic ability can be accurately and easily evaluated according to the growth stage of the domestic cattle, and also distinguishing excellent individuals. This can be useful for the selection of excellent breeders and for the management of high quality breeding stocks.
한우, 반복염기서열, 유전자 마커, 경제형질Hanwoo, repeat base, genetic marker, economic trait
Description
도 1은 서열번호 1 및 2의 프라이머를 사용하여 269두의 한우로부터 수득한 DNA를 PCR한 결과이다.Figure 1 shows the results of PCR of DNA obtained from 269 cows using the primers of SEQ ID NO: 1 and 2.
[발명이 속하는 기술분야][TECHNICAL FIELD OF THE INVENTION]
본 발명은 한우의 경제형질과 연관성 있는 마이크로새틀라이트 DNA 및 이의 분석용 프라이머 세트에 관한 것으로, 더욱 상세하기로는 한우 고유의 마이크로새틀라이트 DNA의 반복염기서열을 탐색하기 위해 제작된 서열번호 1 및 서열번호 2로 이루어지는 프라이머 세트 및 상기 프라이머 세트를 이용한 한우 경제형질 연관 유전자 마커(DNA marker) 유무를 분석함으로써 우수한 경제형질을 지닌 한우를 선발하는 방법에 관한 것이다. The present invention relates to a microsatellite DNA and a primer set for analysis thereof, which are related to the economic traits of Hanwoo, and more particularly, SEQ ID NO: 1 and sequence prepared to search for the repeat base sequence of the native microsatellite DNA of Hanwoo The present invention relates to a primer set consisting of No. 2 and a method of selecting Hanwoo having excellent economic traits by analyzing the presence or absence of a DNA marker associated with a Hanwoo economic trait using the primer set.
[종래기술][Private Technology]
우리나라의 고유한 유전자원으로서 한우는 역용(일소)으로 수백년 동안 유지 되어 온 한민족 역사의 산물이다. 1970년 이후부터 농업의 기계화와 농업의 산업적 가치가 위축됨에 따라 한우는 우리나라 소비자들의 입맛에 맞는 쇠고기를 공급하는 육용우로 중요한 역할을 하고 있다. 최근에는 WTO와 FDA의 국제 시장경제의 변화에 따른 쇠고기 수입개방과 더불어 유전자원의 유지와 보존뿐만 아니라 우리나라 소비자들의 입맛에 맞는 고급육 생산원으로서 한우의 중요성과 가치는 더욱 높아지고 있다.As a unique genetic resource in Korea, Hanwoo is a product of Korean history that has been maintained for hundreds of years. Since 1970, since the mechanization of agriculture and the industrial value of agriculture have diminished, Hanwoo has played an important role as a beef for supplying beef that suits the tastes of Korean consumers. In recent years, the importance and value of Korean beef have increased as well as the maintenance and preservation of genetic resources as well as the maintenance and preservation of genetic resources as well as the opening of beef imports following the changes in the international market economy of the WTO and FDA.
쇠고기 수출국인 선진국에서의 소에 대한 연구는 대부분 유전자연구에 기초한 개량으로, 새로운 유전자 연구기술의 개발과 자국의 축우를 개량하기 위해서 경제형질에 연관된 유전자의 발굴이 생명공학(biotechnology) 기술에 의해 이루어지고 있다. 특히 소의 유전체(genome) 중 40% 정도의 염기서열이 반복적으로 이루어지는 마이크로새틀라이트(microsatellite) DNA의 반복염기서열로 밝혀져 이러한 반복염기서열에 대한 연구가 많이 이루어지고 있고, 이들을 통한 유전자지도의 작성과 양적형질 좌위(quantitative trait loci, QTL)가 이루어지고 있다(Ruyter-Spira et al., 1996; Fridolfsson et al., 1997; Yang et al., 1998, 1999; Lahbib-Mansais et al., 1999; Grosse et al., 2000).Most studies on cows in developed countries, which are exporters of beef, are mostly based on genetic research. The development of new genetic research techniques and the discovery of genes related to economic traits are carried out by biotechnology to improve domestic cattle. ought. In particular, it has been found that the repeat base sequence of microsatellite DNA, which is about 40% of the bovine genome is repeated, many studies on such a repeat base sequence has been made, and the creation of a genetic map through these Quantitative trait loci (QTL) have been achieved (Ruyter-Spira et al., 1996; Fridolfsson et al., 1997; Yang et al., 1998, 1999; Lahbib-Mansais et al., 1999; Grosse et al., 2000).
경제형질은 한우를 비롯한 많은 가축들이 가지고 있는 수많은 형질 중에서 경제적으로 가치가 있는 형질을 의미하는 것으로, 한우의 경우에는 성장형질, 도체형질 및 번식형질과 같은 3가지로 경제형질을 분류할 수 있다. 한우에서 다시 세분화하면, 성장형질에는 생시체중, 이유시체중, 6개월령체중, 12개월령체중, 18개월령체중, 출하시체중 및 체형이 있고, 체형은 다시 구체적으로 체장, 체고, 십자 부고, 고장, 흉위, 흉폭, 흉심, 요각폭, 전관위, 좌골폭 및 곤폭으로 나눌 수 있고, 도체형질에는 도체중, 등지방두께, 배장근단면적, 근내지방도 및 도체율이 있고, 번식형질에는 수정율, 배란율, 사산율 등을 들 수 있으며, 이외에도 한우는 다양한 형질을 갖고 있다. 이와 같은 한우의 형질은 개체가 갖고 있는 유전자에 의해 표현되는 것이므로, 어떤 형질에 대한 유전자를 밝혀내어 능력이 좋은 유전자를 갖고 있는 한우를 선발하여 사용하면 한우의 능력을 개량하는데 큰 효과를 볼 수 있을 것이다. 그러나, 관여하는 유전자를 밝혀내는 것도 어렵지만, 형질에 여러 유전자가 동시에 관여하기 때문에 현재로써는 유전자를 이용한 한우 개량은 쉽게 이루어질 수 있는 방법이 아니다.Economic traits mean economically valuable traits among many traits of many domestic animals including Korean cattle, and in the case of Korean cattle, economic traits can be classified into three types: growth traits, carcass traits, and breeding traits. When subdivided in Korean cattle, growth traits include live weight, wean weight, 6 months old, 12 months old, 18 months old, factory weight and body shape. It can be divided into chest, chest, chest, rectangle, anterior tube, sciatic width, and horn width.The carcass shape includes carcass weight, backfat thickness, abdominal muscle cross-sectional area, intramuscular fat and carcass rate, and the fertilization shape contains fertilization rate, ovulation rate, The stillbirth rate, etc., and in addition, Hanwoo has a variety of traits. Since the traits of Hanwoo are expressed by the genes owned by the individual, identifying the genes for certain traits and selecting and using Hanwoo, which has a good ability, will have a great effect in improving the ability of the Korean beef. will be. However, although it is difficult to identify genes involved, the improvement of Hanwoo using genes is not an easy method at this time because several genes are involved at the same time.
한편, 마이크로새틀라이트(microsatellite)는 2 내지 6개 정도의 염기서열이 반복되는 DNA군(repetitive DNA group)으로, 게놈 내에 골고루 분포하고 매우 높은 다형성을 나타내는 비암호화 DNA 서열(non-coding DNA sequence)에 해당한다(Zajc I and Sampson J (1999) Utility of canine microsatellites in revealing the relationships of pure bred dogs. J Hered 90: 104-107). 특정 좌위에서 반복단위의 반복수에 따라 개체간의 다양성이 인정되는데(Koreth J, O'Leary JJ and McGee JO (1996) J Pathol 178: 239-248.), 반복수에 품종간 다형이 있는 경우에 인접영역에 설계한 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction; PCR)을 행하면, PCR 산물 길이에 다형이 관찰되고, DNA 다형을 검출하는 것이 가능해진다. 마이크로새틀라이트를 이용한 다형검출 마커는 마이크로새틀라이트 마커라고 불리우고 있다(O. Parnaud, et al., Mol. Gen. Genet. 252: 597- 607,1996). 마이크로새틀라이트는 다른 유전자들과 마찬가지로 멘델의 유전법칙에 따라 자식에게 전달되며 PCR을 이용하여 증폭할 수 있고, 전기영동을 할 경우 공우성(co-dominant)의 양상을 보인다. On the other hand, microsatellite is a repetitive DNA group that repeats 2 to 6 nucleotide sequences, and is non-coding DNA sequence evenly distributed in the genome and exhibiting very high polymorphism. (Jajc I and Sampson J (1999) Utility of canine microsatellites in revealing the relationships of pure bred dogs.J Hered 90: 104-107). Diversity is recognized between individuals according to the number of repeat units in a particular locus (Koreth J, O'Leary JJ and McGee JO (1996) J Pathol 178: 239-248.). When polymerase chain reaction (PCR) is carried out using a primer designed in an adjacent region, a polymorphism is observed in the length of the PCR product, and the DNA polymorphism can be detected. Polymorphism detection markers using microsatellites are called microsatellite markers (O. Parnaud, et al., Mol. Gen. Genet. 252: 597-607, 1996). Like other genes, microsatellites are delivered to children according to Mendel's genetic law and can be amplified using PCR, and co-dominant when electrophoresed.
특히, 마이크로새틀라이트는 크기가 작기 때문에 2개에서 최대 8개까지의 프라이머를 동시에 증폭할 수 있으므로(Chamberlain JS et al., (1988) Nucleic Acids Res 16: 11141-11156) 유전자의 다형성을 분석하는데 시간과 비용을 줄일 수 있으며 민감성과 정확성이 높은 결과를 얻을 수 있다. 그래서, 이와 같은 마이크로새틀라이트는 가축의 분자육종분야에 이용가치가 대단히 높으며 근친교배에 의한 퇴화를 방지하는 데 유용할 뿐만 아니라 특정형질을 선택하는 것에도 이용될 수 있다고 한다. 그러나, 한우와 같은 순수한 품종 집단에서는 아직까지 이러한 마이크로새틀라이트법을 이용한 유전적 다형분석이 거의 실시되지 않았으며, 유전적 대립유전자 빈도(allele frequencies)에 대한 보고도 전무한 실정이다. In particular, microsatellite can be amplified from 2 to up to 8 primers simultaneously due to its small size (Chamberlain JS et al., (1988) Nucleic Acids Res 16: 11141-11156). This saves time and money, and results in high sensitivity and accuracy. Thus, such microsatellites are highly valuable in the field of molecular breeding of livestock and can be used not only to prevent degeneration by inbreeding but also to select specific traits. However, pure polymorphisms such as Korean cattle have rarely been subjected to genetic polymorphism analysis using the microsatellite method, and there are no reports of genetic allele frequencies.
상기 종래기술의 문제점을 해결하기 위하여 안출된 것으로서, 본 발명은 한우의 경제형질과 연과성이 있는 마이크로새틀라이트 DNA를 제공하는 것을 목적으로 한다.In order to solve the problems of the prior art, an object of the present invention is to provide a microsatellite DNA having a linkage between the economic quality of Hanwoo.
또한 본 발명은 상기 마이크로새틀라이트 DNA 검출용 프라이머 세트를 제공하는 것을 목적으로 한다.It is also an object of the present invention to provide a primer set for detecting the microsatellite DNA.
또한 본 발명은 상기 마이크로새틀라이트 DNA를 분석하여 우수 경제형질을 갖는 한우를 선발할 수 있는 방법을 제공하는 것을 목적으로 한다. In addition, an object of the present invention is to provide a method capable of selecting a Hanwoo having an excellent economic trait by analyzing the microsatellite DNA.
또한 본 발명은 한우의 마이크로새틀라이트 DNA를 이용한 한우 품질 분석방법을 제공하는 것을 목적으로 한다. In addition, an object of the present invention is to provide a method for quality analysis of Korean beef using microsatellite DNA of Hanwoo.
상기 목적을 달성하기 위하여 본 발명은 시토신 및 아데닌으로 이루어진 서열이 12 내지 23회 반복되며, 5' 말단에 서열번호 7의 서열이 존재하며, 3' 말단에 서열번호 8의 서열이 존재하는 뉴클레오타이드 또는 이의 상보적인 뉴클레오타이드를 포함하는 한우의 경제형질 특이성을 갖는 마이크로새틀라이트 DNA를 제공한다.In order to achieve the above object, the present invention is a nucleotide sequence consisting of cytosine and adenine is repeated 12 to 23 times, the sequence of SEQ ID NO: 7 at the 5 'end, the sequence of SEQ ID NO: 8 at the 3' end, or Provided are microsatellite DNAs having economic trait specificity of Hanwoo including its complementary nucleotides.
또한 본 발명은 서열번호 1의 염기서열(TgTggTCATgCTCTTCTCCA)을 포함하는 프라이머 및 서열번호 2의 염기서열(AAAACTCTgCCgACTCgTgT)을 포함하는 프라이머로 이루어지는 한우의 고유 마이크로새틀라이트 DNA 검출용 프라이머 세트를 제공한다.In another aspect, the present invention provides a primer set for detecting native microsatellite DNA of Hanwoo consisting of a primer comprising a nucleotide sequence of SEQ ID NO: 1 (TgTggTCATgCTCTTCTCCA) and a primer comprising a nucleotide sequence of SEQ ID NO: 2 (AAAACTCTgCCgACTCgTgT).
또한 본 발명은 상기 프라이머 세트를 이용하여 한우 유전자의 경제형질 연관 특이적 마이크로새틀라이트 DNA의 반복염기서열을 포함하는 유전자 마커를 동정하는 것을 포함하는 우수 경제형질을 지닌 한우의 선발방법을 제공한다.In another aspect, the present invention provides a method for selection of a Korean beef having an excellent economic trait comprising identifying a genetic marker comprising a repeat base sequence of the specific microsatellite DNA associated with economic traits of the Hanwoo gene using the primer set.
또한 본 발명은 (a) 한우의 염색체에 대하여 상기의 프라이머 세트로 PCR을 실시하는 단계, (b) 상기 PCR로 증폭된 유전자 마커의 크기를 분석하는 단계, (c) 상기 (b) 단계에서 분석된 크기의 유전자 마커를 갖는 한우의 경제형질을 분석하는 단계 및 (d) 상기 (b) 및 (c)의 결과를 통하여 유전자 마커의 크기별 특이적인 경제형질을 분석하는 단계를 포함하는 한우의 마이크로새틀라이트 DNA를 이용한 한우 품질 분석방법을 제공한다.In another aspect, the present invention (a) performing PCR with the primer set on the chromosome of Hanwoo, (b) analyzing the size of the gene marker amplified by the PCR, (c) the analysis in step (b) Analyzing the economic traits of Hanwoo having a genetic marker of the size and (d) analyzing the specific economic traits of the size of the genetic markers through the results of (b) and (c) Provided is a quality analysis method of Korean beef using light DNA.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 한우의 경제형질 특징에 따라 다형성을 나타내는 마이크로새틀라이트 DNA 및 이를 이용한 한우의 경제형질 분석방법에 관한 것이다.The present invention relates to microsatellite DNA showing polymorphism according to the economic trait characteristics of Hanwoo and an economic trait analysis method of the Korean beef using the same.
본 발명의 한우의 경제형질 특징에 따라 다형성을 나타내는 마이크로새틀라이트 DNA는, 티민-구아닌이 반복된 서열 또는 시토신-아데닌이 반복된 서열을 포함한다. 즉, 마이크로새틀라이트 DNA는 (TG)n 또는 (CA)n을 포함하며, 상기 n은 12 내지 23의 자연수이다. 또한 상기 마이크로새틀라이트 DNA는 반복서열 즉 (TG)n의 5' 말단에 서열번호 5의 서열(tctgtctgtattggtgtggaaagtcc)을 더욱 포함할 수 있으며, 3' 말단에 서열번호 6의 서열(cgcgcgtgtatg)를 더욱 포함할 수도 있으며, 또한 반복서열 (CA)n은 5' 말단에 서열번호 7의 서열(catacacgcgcg) 또는 3' 말단에 서열번호 8의 서열(ggactttccactccaatacagacaga)다.Microsatellite DNA exhibiting polymorphism according to the economic characteristics of the Korean beef of the present invention includes a sequence in which thymine-guanine is repeated or a sequence in which cytosine-adenine is repeated. That is, the microsatellite DNA contains (TG) n or (CA) n, where n is a natural number of 12 to 23. In addition, the microsatellite DNA may further include a repetitive sequence, that is, a sequence of SEQ ID NO: 5 at the 5 ′ end of (TG) n (tctgtctgtattggtgtggaaagtcc), and further include a sequence of SEQ ID NO: 6 at the 3 ′ end (cgcgcgtgtatg). In addition, the repetitive sequence (CA) n is the sequence of SEQ ID NO: 7 at the 5 'end (catacacgcgcg) or the sequence of SEQ ID NO: 8 at the 3' end (ggactttccactccaatacagacaga).
본 발명의 마이크로세틀라이트 DNA는, 한우의 경제형질을 나타내는 유전자 마커로 이용될 수 있다. 이에 본 발명은 한우의 마이크로새틀라이트 DNA를 이용한 한우 품질 분석방법을 제공한다.The microsatellite DNA of the present invention can be used as a genetic marker representing the economic traits of Hanwoo. Accordingly, the present invention provides a method for quality analysis of Korean beef using microsatellite DNA of Hanwoo.
본 발명의 한우 품질 분석방법은, (a) 한우의 염색체에 대하여 상기 마이크로새틀라이트 DNA 분석용 프라이머 세트로 PCR을 실시하는 단계, (b) 상기 PCR로 증폭된 유전자 마커의 크기를 분석하는 단계, (c) 상기 (b) 단계에서 분석된 크기의 유전자 마커를 갖는 한우의 경제형질을 분석하는 단계 및 (d) 상기 (b) 및 (c)의 결과를 통하여 유전자 마커의 크기별 특이적인 경제형질을 분석하는 단계를 포함할 수 있다.Hanwoo quality analysis method of the present invention, (a) performing PCR with the primer set for microsatellite DNA analysis on the chromosome of Hanwoo, (b) analyzing the size of the gene marker amplified by the PCR, (c) analyzing the economic traits of Hanwoo with the genetic markers of the size analyzed in step (b) and (d) the specific economic traits by size of the genetic markers through the results of (b) and (c) Analyzing may include.
(a) 단계에서, 상기 프라이머 세트는, 마이크로새틀라이트 DNA의 3' 및 5' 부위에 인접한 5 내지 100 bp 부위에 위치한 10 내지 50 bp의 연속된 각 폴리뉴클레오타이드를 포함할 수 있다. 상기 프라이머 세트의 일례로는 서열번호 1의 염기서열을 포함하는 폴리뉴클레오타이드 및 서열번호 2의 염기서열을 포함하는 폴리뉴클레오타이드가 있으나, 이에 한정되는 것은 아니다. PCR 실시는, 통상의 PCR 방법에 준하여 실시가능하다.In step (a), the primer set may comprise 10 to 50 bp of each contiguous polynucleotide located at a 5 to 100 bp site adjacent to the 3 'and 5' sites of the microsatellite DNA. Examples of the primer set include, but are not limited to, a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1 and a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 2. PCR can be performed according to a conventional PCR method.
(b) 단계에서, PCR로 증폭된 PCR 산물을 유전자 마커라 하며, 상기 유전자 마커의 크기는 통상의 방법, 예컨대 아가로즈 젤 또는 아크릴아마이드 젤을 이용한 전기영동으로 실시한 후, 전개된 DNA 단편을 형광 염색 등을 통하여 확인가능하다. 상기 단계에서의 PCR 산물의 크기 분석 방법은 본 발명이 속하는 기술분야의 당업자라면 모두 실시가능하며, 상기 일예로 설명한 방법이외 통상의 모든 방법을 포함할 수 있다.In step (b), the PCR product amplified by PCR is called a gene marker, and the size of the gene marker is performed by a conventional method such as electrophoresis using an agarose gel or acrylamide gel, and then the developed DNA fragments are fluorescent. It can be confirmed through dyeing. The size analysis method of the PCR product in the above step can be carried out by those skilled in the art to which the present invention pertains, and can include all conventional methods other than the method described as an example.
본 발명의 일예로, 서열번호 1 및 서열번호 2의 프라이머 세트로 PCR을 실시하여, 104bp, 110bp, 112bp, 115bp, 118bp, 120bp, 122bp, 124bp 및 126bp의 크기를 갖는 유전자 마커를 확인하였다. 즉 상기 프라이머 세트로 증폭되는 부위는 다형성이 존재하는 부위이다.In one embodiment of the present invention, PCR was carried out using primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 to identify gene markers having sizes of 104 bp, 110 bp, 112 bp, 115 bp, 118 bp, 120 bp, 122 bp, 124 bp, and 126 bp. That is, the site amplified by the primer set is a site where polymorphism exists.
(c) 단계는 상기 (b) 단계에서 유전자 마커의 크기별로 분류된 한우의 경제형질을 분석하는 단계이다. 경제형질은 성장형질, 도체형질 및 번식형질로 이루어진 군으로부터 선택될 수 있으며, 이는 통상의 경제형질 분석 방법으로 용이하게 분석할 수 있다. 상기 성장형질은 생시체중, 이유시체중, 6개월령체중, 12개월령 체중, 18개월령체중, 출하시체중 및 체형으로 세분될 수 있으며, 상기 체형은 구체적으로 체장, 체고, 십자부고, 고장, 흉위, 흉폭, 흉심, 요각폭, 전관위, 좌골폭 및 곤폭으로 나눌 수 있다. 상기 도체형질은 도체중, 등지방두께, 배장근단면적, 근내지방도 및 도체율로 세분될 수 있으며, 번식형질은 수정율, 배란율 및 사산율 등으로 세분될 수 있다.Step (c) is a step of analyzing the economic traits of Hanwoo categorized by the size of the genetic marker in step (b). Economic traits can be selected from the group consisting of growth traits, carcass traits and breeding traits, which can be easily analyzed by conventional economic trait analysis methods. The growth traits may be subdivided into live weight, weaning weight, 6 months old weight, 12 months old weight, 18 months old weight, weight at shipment and body shape, and the body shape is specifically length, height, cruciate weight, breakdown, thorax, It can be divided into thoracic width, thoracic heart, yaw width, anterior tube position, sciatic width and width. The carcass morphology may be subdivided into carcass weight, backfat thickness, intestinal muscle cross-sectional area, intramuscular fat and carcass rate, and the breeding trait may be subdivided into fertilization rate, ovulation rate and stillbirth rate.
(d) 단계는, 상기 (c)의 결과를 토대로 특정 크기의 유전자 마커를 갖는 한우 개체군에서 공통적인 경제형질 특징이 있는지를 확인하는 단계로, 유전자 마커의 크기와 경제형질 특징간의 상관관계가 있는 경우, 한우의 유전자 마커의 크기만을 분석함으로써 쉽게 한우의 경제형질 특징을 파악할 수 있을 뿐만 아니라, 원하는 경제형질 특징을 갖도록 한우 개체를 개량할 수 있다. Step (d) is to determine whether there is a common economic trait characteristic in the Hanwoo population having a specific size genetic marker based on the result of (c), and there is a correlation between the size of the genetic marker and the economic trait characteristic. In this case, by analyzing only the size of the genetic markers of the cattle, it is easy to identify the economic characteristics of the cattle, as well as to improve the individual population of the cattle to have the desired economic characteristics.
본 발명에서는 서열번호 1 및 2의 프라이머 세트로 분석하였을때, 120 bp 또는 115 bp 크기의 유전자 마커를 갖는 한우의 경제형질을 분석하였으며, 그 결과 120 bp의 유전자 마커는 한우의 근내지방도가 높은 형질에서 관찰되었으며, 115 bp의 유전자 마커는 한우의 등지방 두께가 높은 형질에서 관찰되었다. 즉, 서열번호 1 및 2의 프라이머 세트를 이용하여 PCR 한 경우 120 bp의 유전자 마커가 관찰되는 경우 시료 한우는 근내지방도가 높은 형질을 가지며, 115 bp의 유전자 마커가 관찰되는 경우 시료 한우는 등지방 두께가 두꺼운 형질을 갖는 우수 품종임을 판단할 수 있었다.In the present invention, when analyzed by the primer set of SEQ ID NO: 1 and 2, the economic trait of Hanwoo having a genetic marker of 120 bp or 115 bp size was analyzed, and as a result, the genetic marker of 120 bp is characterized by high intramuscular fat of Hanwoo The gene marker of 115 bp was observed in the trait of high back fat thickness of Korean cattle. In other words, when PCR was performed using the primer sets of SEQ ID NOs: 1 and 2, when a 120 bp genetic marker was observed, the sample Hanwoo had a high intramuscular fat trait, and when the 115 bp genetic marker was observed, the sample Hanwoo was equal fat. It could be determined that it is an excellent variety having a thick trait.
이에, 본 발명은 서열번호 1의 염기서열을 포함하는 폴리뉴클레오타이드 및 서열번호 2의 염기서열을 포함하는 폴리뉴클레오타이드를 이용하여, 한우 유전자의 경제형질과 연관된 특이적 마이크로새틀라이트 DNA의 반복염기서열을 포함하는 유전자 마커를 동정하는 것을 포함하는 우수 경제형질을 지닌 한우의 선발방법을 제공한다. 상기 선발방법은 바람직하기로는 (a) 한우의 염색체에 대하여 상기 프라이머 세트로 PCR을 실시하는 단계 및 (b) 상기 PCR로 증폭된 유전자 마커가 120 bp 또는/및 115 bp의 크기를 갖는 한우를 선별하는 단계를 포함할 수 있다. 구체적인 PCR 조건 및 방법은 통상의 PCR 방법에 준하여 실시가능하다.Thus, the present invention uses a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2, to repeat the repeat base sequence of specific microsatellite DNA associated with the economic trait of the Hanwoo gene Provided is a method for selection of Korean cattle with excellent economic traits, including identifying genetic markers. Preferably, the selection method includes (a) performing PCR on the chromosome of Hanwoo with the primer set, and (b) screening Hanwoo having a size of 120 bp or 115 bp. It may include the step. Specific PCR conditions and methods can be carried out in accordance with conventional PCR methods.
본 발명의 한우 고유의 마이크로새틀라이트 DNA 및 이를 이용한 한우의 경제형질 분석방법은, 한우의 성장과정중 시기에 관계없이 정확하고 간편하게 한우의 유전적 능력을 평가할 수 있으며, 우수 개체의 판별, 우수 종축의 선발 및 고급육 집단의 사양관리 선정에 유용하게 이용될 수 있다.The unique microsatellite DNA of the present invention and the economic trait analysis method using the same can be used to accurately and easily evaluate the genetic ability of the cattle, regardless of the timing of the growth of the cattle, discrimination of excellent individuals, excellent breeders It can be useful for the selection and management of high quality meat group.
이하 본 발명의 실시예를 기재한다. 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다.Hereinafter, examples of the present invention will be described. The following examples are only for illustrating the present invention and the present invention is not limited to the following examples.
실시예 1: 한우 고유의 마이크로새틀라이트 DNA를 이용한 프라이머 제작Example 1 Preparation of Primer Using Hanwoo's Native Microsatellite DNA
1-1. 실험동물1-1. Laboratory animals
농협중앙회 한우개량부에서 705일간 사육된 26-28차 한우 후대검정집단 269두를 사용하였으며, 한우의 중요한 경제형질, 즉 근내지방도(Marbling score), 일당증체량(Daily gain), 등지방두께(Backfat thickness) 그리고 등심단면적(M.longissimus dorsi area)의 기록을 이용하였다.The National Agricultural Cooperative Federation's 269 26-28th Korean Native Cattle Protest Group, which were raised for 705 days, were used.The important economic characteristics of Korean cattle were Marbling score, Daily gain, and Backfat thickness. And records of the M. longissimus dorsi area were used.
1-2. 마이크로새클라이트 DNA 분석1-2. Microsatellite DNA Analysis
도축결과 육량과 육질이 뛰어난 것으로 판단된 한우의 혈액으로부터 핵산을 분리한 후 아가로스 플러그(agarose plug)를 제조하여 기존에 발표된 방법(An Improved Approach for Construction of Bacterial Artificial Chromosome Libraries. 1998. Genomics 52:1-8)을 이용하여 총 150,000개의 각각 다른 부위의 한우 염색체 조각을 포함하는 BAC 클론을 제작하였다. EcoRI 과 HindIII 제한효소로 부분적으로 절단된 한우 염색체 DNA를 pBACe3.6 벡터와 pIndigoBAC-5 벡터에 각각 삽입하고, 이를 박테리아 수용성 세포(bacteria competent cell)에 일렉트로포레이터(electrophorator)를 이용하여 형질변형(transformation)시켰다. 형질변형체들 중, LB 고체배지(sodium chloride 10g, tryptone yeast 5g, tryptone peptone 10g, bacto-agar 15g, deionized H2O 1L) 상에서 한우의 염색체 DNA를 포함하고 있는 BAC 클론들만 선택적으로 구분하여 글리세롤 스탁(glycerol stock) 형태로 만든 후 -80℃에 보관하였다.An Improved Approach for Construction of Bacterial Artificial Chromosome Libraries. 1998. Genomics 52 : 1-8) was used to construct a BAC clone containing a total of 150,000 different regions of Hanwoo chromosome. Hanwoo chromosomal DNA partially digested with EcoR I and Hind III restriction enzymes was inserted into pBACe3.6 vector and pIndigoBAC-5 vector, respectively, and transfected into bacterial competent cells using an electrophorator. It was transformed. Among the transformants, only the BAC clones containing the chromosomal DNA of Hanwoo on LB solid medium (sodium chloride 10g, tryptone yeast 5g, tryptone peptone 10g, bacto-agar 15g, deionized H 2 O 1L) were selectively separated into glycerol stocks. (glycerol stock) was made in the form and stored at -80 ℃.
두 개의 유니버설 시퀀싱 프라이머(universal sequencing primer, RP2 priemr(서열번호 3) : 5'-GAGCCAATATGCGAGAAC ACCCGAGAA-3' 및 T7 primer(서열번호 4) : 5'-AATACGACTCACTATA-3'를 마크로젠(주)에서 합성)를 이용하여 총 2,794 클론(5,588 sequencing reaction)에 대한 5' 및 3' 말단의 염기서열 분석하였다. 그 결과, 약 330만 염기쌍(3.3 Giga base)의 한우 염색체에 대한 염기서열이 확인되었으며, 이를 미국 일리노이주립대학 생명공학연구소의 Bioinformatics 연구실에 있는 컴퓨터프로그램을 활용하여 마이크로새틀라이트 DNA의 염기서열을 분석하였다. 이로써 한우의 마이크로새틀라이트 DNA 중 (CA)n의 반복염기서열을 갖는 부위를 확 보하였다.Two universal sequencing primers, RP2 priemr (SEQ ID NO: 3): 5'-GAGCCAATATGCGAGAAC ACCCGAGAA-3 'and T7 primer (SEQ ID NO: 4): 5'-AATACGACTCACTATA-3' synthesized by Macrogen Co., Ltd. 5 'and 3' terminal sequences were analyzed for a total of 2,794 clones (5,588 sequencing reaction). As a result, the base sequence of the Korean cattle chromosome of about 3.3 million base pairs (3.3 Giga base) was identified, and the base sequence of the microsatellite DNA was analyzed using a computer program in the Bioinformatics Laboratory of the Institute of Biotechnology, Illinois State University. It was. This secured a region having a repeat base sequence of (CA) n in the microsatellite DNA of Hanwoo.
1-3. 프라이머 제작1-3. Primer production
PCR을 통한 유전분석 및 각 마이크로새틀라이드 염기서열의 다형화에 따른 경제형질과의 상관관계 분석을 위해, (CA)n 주위에 존재하는 염기서열만을 인지하는 PCR 프라이머를 Primer3 program(http://www.broad.mit.edu/cgi-bin/primer/ primer3_www.cgi)을 사용하여 제작하였다. 상기 프라이머의 염기서열은 서열번호 1 및 서열번호 2로 표시하였다. 하기 표 1은 상기 프라이머를 이용하여 동정한 (CA)20 반복염기서열을 포함하는 DNA 염기서열을 나타내고 있다. 이때, 이탤릭체로 된 것은 제작된 프라이머이고, 밑줄친 염기서열은 (CA)20 반복염기서열을 의미한다. For genetic analysis through PCR and correlation analysis with economic traits according to polymorphism of each microsatellite sequence, PCR primers that recognize only nucleotide sequences around (CA) n are prepared by Primer3 program (http: // www). .broad.mit.edu / cgi-bin / primer / primer3_www.cgi). The base sequence of the primer is represented by SEQ ID NO: 1 and SEQ ID NO: 2. Table 1 below shows the DNA base sequence including the (CA) 20 repeat base sequence identified using the primer. At this time, italicized is the prepared primer, the underlined base sequence means (CA) 20 repeat base sequence.
(표 1)Table 1
실시예 2: 한우의 DNA 다형화와 우수 경제형질을 지닌 한우간의 상관관계 분석 Example 2 Analysis of Correlation between DNA Polymorphism of Korean Cattle and Korean Cattle with Excellent Economic Characteristics
실시예 1의 프라이머로 PCR하였을때, 한우의 DNA 다형화를 확인하였다. 도 1은 서열번호 1 및 2의 프라이머를 사용하여 269두의 한우로부터 수득한 DNA를 PCR한 결과로, 104bp, 110bp, 112bp, 115bp, 118bp, 120bp, 122bp, 124bp 및 126bp 크기의 PCR 산물이 확인되었다. 이는 한우마다 상기 프라이머로 증폭되는 부위에 다형성이 있음을 의미하는 것이다.When PCR was performed with the primer of Example 1, DNA polymorphism of Korean cattle was confirmed. FIG. 1 shows PCR results of DNAs obtained from 269 cows using primers of SEQ ID NOs: 1 and 2, and PCR products of 104bp, 110bp, 112bp, 115bp, 118bp, 120bp, 122bp, 124bp, and 126bp are identified. It became. This means that there is polymorphism at the site amplified by the primer for each Korean cattle.
이에, 상기 다형성과 한우 경제형질간의 상관관계를 분석하기 위하여, 양적형질 좌위 분석(quantitative trait loci, QTL)을 실시하였다(Kuhn et al. Animal Genetics 30:333-40.(1999); Stone et al. Plant & Animal Genome Ⅶ Conference 17-21.(1999); Stone et al. Journal of Animal Science 77(6):1379-1384.(1999)) ).In order to analyze the correlation between the polymorphism and Hanwoo economic traits, a quantitative trait loci (QTL) was performed (Kuhn et al. Animal Genetics 30: 333-40. (1999); Stone et al. Plant & Animal Genome Ⅶ Conference 17-21. (1999); Stone et al. Journal of Animal Science 77 (6): 1379-1384. (1999)).
표 2는 다형성 부위의 마이크로새틀라이트 DNA 크기 115 bp 또는 120 bp에 따른 한우의 경제형질 특성을 나타낸 것으로, 120bp의 대립유전자가 존재하는 개체 46두는 대립유전자가 나타나지 않은 개체(223두)보다 근내지방도에서 유의적으로 높은 성적으로 분석되었고, 115bp 대립유전자의 경우에는 등지방두께에서 높은 유의적인 차이가 있었다.Table 2 shows the economic trait characteristics of Hanwoo according to the size of the microsatellite DNA at the polymorphic region of 115 bp or 120 bp.In the case of 46 individuals with 120 bp alleles, the intramuscular fat profile was higher than those with no alleles (223 heads). Was significantly higher than that of. In the 115bp allele, there was a significant difference in backfat thickness.
(표 2)Table 2
표 3은 대립유전자 115 bp 또는 120 bp가 존재하는 한우에 대해, 근내지방도 분포를 나타낸 것으로, 120bp 대립유전자를 가지는 개체는 고급육등급비율이 50%에 해당하여, 한우집단의 평균 31%에 비해 개량된 형질을 가짐을 알 수 있었다. 즉, 실시예 1의 프라이머로 분석되는 마이크로새틀라이트 부위는 한우의 고급육등급을 판단할 수 있는 유전적 마커로 이용가능하다.Table 3 shows the distribution of intramuscular fat for Hanwoo with allele 115 bp or 120 bp. The population with 120bp allele was 50% of high-grade meat grade, which was improved compared to the average 31% of the Hanwoo population. It can be seen that it has a trait. That is, the microsatellite site analyzed by the primer of Example 1 can be used as a genetic marker to determine the high grade meat grade of Hanwoo.
(표 3) Table 3
115bp 크기를 갖는 한우는 포함하지 않는 한우에 비하여 등지방두께가 1.04㎜ 두꺼운 것은 정육량을 감소시키는 악영향이 있는 결과이나 항상 체중이 높으면 등지방이 두꺼워지고 근내지방을 높이기 위해서는 등지방이 두꺼워지는 생리적 특성 때문에 정육량(뼈와 부산물을 제외한 고기량)의 감소는 경제적 가치로 보면 등지방 이외의 가치가 매우 높다고 할 수 있다.Thick 1.04mm thick back fat compared to Korean beef, which does not contain 115bp size, has the negative effect of reducing meat mass, but due to the physiological characteristics of thickening the back fat at high weight at all times and thickening the back fat to increase intramuscular fat The decrease in meat (meat except bone and by-products) can be said to be very valuable in terms of economic value.
표 4는 115 bp 및 120 bp 크기를 모두 포함하는 한우의 양적형질 좌위 분석 결과를 나타낸 것이다. Lod 값은 3.0 이상일때 통계적으로 높은 유의성을 가지는 것으로, 양적형질 좌위 분석에서 근내지방도의 Lod 값이 9.99로 나타났으며, 등지방두께에서도 높은 Lod값이 측정되었다.Table 4 shows the results of quantitative locus analysis of Hanwoo including both 115 bp and 120 bp sizes. The Lod value was statistically significant when the value was 3.0 or more. In the quantitative trait locus analysis, the Lod value of the intramuscular fat was 9.99 and the Lod value was also measured at the back fat thickness.
Lod 값은 QTL(quantitative trait loci) 분석과 MAS(marker assisted selection)을 통하여 실시하였다. QTL 분석을 기초로 하여 근내지방도에 연관된 MAS는 Lod score가 3.0 이상인 loci를 이용하여 후대검정우를 대상으로 분석을 실시하였고 그 결과를 MS-Excel를 통해 분석하였다. Lod values were performed by QTL (quantitative trait loci) analysis and marker assisted selection (MAS). Based on the QTL analysis, MAS related to intramuscular fat score was analyzed using the loci with a Lod score of 3.0 or higher.
(표 4)Table 4
이상 살펴본 바와 같이, 본 발명의 한우 고유의 마이크로새틀라이트 DNA의 반복염기서열을 탐색하기 위한 프라이머 세트는, 120bp 및 115bp 대립유전자에서 나타나는 유전자 마커(DNA marker) 유무를 분석에 이용하여, 한우의 성장과정 어느 시기에도 정확하고 간편하게 유전적 능력을 평가할 수 있으므로, 우수 개체의 판별, 우수 종축의 선발 및 고급육 집단의 사양관리 선정에 유용하게 이용될 수 있다. As described above, the primer set for searching for the repeat base sequence of the native microsatellite DNA of the present invention, using the presence or absence of DNA markers appearing in the 120bp and 115bp alleles for analysis, growth of Hanwoo It is possible to evaluate the genetic ability accurately and easily at any time of the process, which can be useful for the identification of good individuals, the selection of good breeders, and the selection of stock management for high-quality meat groups.
서열목록 전자파일 첨부 Attach sequence list electronic file
Claims (7)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020040091892A KR100590728B1 (en) | 2004-11-11 | 2004-11-11 | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020040091892A KR100590728B1 (en) | 2004-11-11 | 2004-11-11 | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20060044093A KR20060044093A (en) | 2006-05-16 |
KR100590728B1 true KR100590728B1 (en) | 2006-06-19 |
Family
ID=37148946
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020040091892A KR100590728B1 (en) | 2004-11-11 | 2004-11-11 | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100590728B1 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100683068B1 (en) | 2006-01-10 | 2007-02-15 | 영남대학교 산학협력단 | A new primer set and a selective method of hanwoo using said primer set |
KR100832348B1 (en) * | 2006-11-23 | 2008-05-26 | 경희대학교 산학협력단 | Protein marker related with the ema for improving meat quality of hanwoo |
KR100816476B1 (en) * | 2006-12-14 | 2008-03-26 | 영남대학교 산학협력단 | Microsatellite dna primer related to economic traits in hanwoo |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5674687A (en) | 1994-05-31 | 1997-10-07 | Cornell Research Foundation, Inc. | Method for identifying the species origin of a DNA sample |
KR19990070819A (en) * | 1998-02-25 | 1999-09-15 | 김강권 | Beef quality related DNA markers and selection method of bovine sarcoma |
KR20020035678A (en) * | 2000-11-07 | 2002-05-15 | 여정수 | Primer related marbling score of Hanwoo and test process of marbling score using thereof |
-
2004
- 2004-11-11 KR KR1020040091892A patent/KR100590728B1/en not_active IP Right Cessation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5674687A (en) | 1994-05-31 | 1997-10-07 | Cornell Research Foundation, Inc. | Method for identifying the species origin of a DNA sample |
KR19990070819A (en) * | 1998-02-25 | 1999-09-15 | 김강권 | Beef quality related DNA markers and selection method of bovine sarcoma |
KR20020035678A (en) * | 2000-11-07 | 2002-05-15 | 여정수 | Primer related marbling score of Hanwoo and test process of marbling score using thereof |
Non-Patent Citations (1)
Title |
---|
논문 |
Also Published As
Publication number | Publication date |
---|---|
KR20060044093A (en) | 2006-05-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Poompuang et al. | Toward detection of quantitative trait loci and marker‐assisted selection in fish | |
KR100780449B1 (en) | A new primer set and method of selecting hanwoomeat by using the said primer set | |
CN108251539A (en) | A kind of and the relevant SNP marker of chicken Carcass Traits and its application, detection primer, detection kit | |
CN109811063A (en) | One kind SNP marker relevant to growth speed of pigs and its application | |
CN107164463A (en) | It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits | |
CN110438242B (en) | Portunus trituberculatus microsatellite marked primer and application thereof | |
CN114015788B (en) | Genetic marker for intramuscular fat content character of pig and application | |
CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
KR100590728B1 (en) | Microsatellite dna associated with economic traits in hanwoo and primer for detecting same | |
CN104694650B (en) | A kind of molecular detecting method and its application and kit for differentiating chicken feed utilization ratio | |
CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
KR100561101B1 (en) | A new primer set and a selective method of Hanwoo using said primer set | |
CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
KR100561100B1 (en) | A new primer set and a selective method of Hanwoo using said primer set | |
CN109439764B (en) | Molecular marker for identifying native-like eggs and native eggs and application | |
KR100532592B1 (en) | Detection method of DNA marker associated to average daily gain(ADG), backfat thickness(BFT) , and loin muscle area(LMA) in pig. | |
CN111961732A (en) | Molecular marker influencing full bore weight of chicken and application thereof | |
CN111826449A (en) | Method for obtaining molecular marker related to gynogenesis bighead malformation character and application thereof | |
CN111910009A (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
KR100683068B1 (en) | A new primer set and a selective method of hanwoo using said primer set | |
CN114561475B (en) | Method for breeding chicken by molecular marker, application and kit thereof | |
KR100816476B1 (en) | Microsatellite dna primer related to economic traits in hanwoo | |
CN110172516B (en) | Method for detecting single nucleotide polymorphism of 5' flanking region of cattle lncFAM200B gene and application thereof | |
CN107034297B (en) | Molecular marker related to growth traits of meat ducks and application thereof, nucleic acid combination and kit | |
KR100963314B1 (en) | A new primer set and a method of selecting hanwoo by using the said primer set |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20120611 Year of fee payment: 7 |
|
FPAY | Annual fee payment |
Payment date: 20130327 Year of fee payment: 8 |
|
LAPS | Lapse due to unpaid annual fee |