JP5972667B2 - Hyaluronic acid synthesis promoter and topical skin preparation - Google Patents

Description

  The present invention contains a fermented lactic acid bacterium of pomegranate juice as an active ingredient, thereby enhancing the ability to synthesize hyaluronic acid in the living body, skin aging, atopic dermatitis, skin diseases such as psoriasis and ichthyosis, rheumatism The present invention relates to a hyaluronic acid synthesis promoter and an external preparation for skin which can be used for prevention and treatment of isoarthritis.

Conventionally, it is known that hyaluronic acid is present in the dermis and epidermis in the skin. Hyaluronic acid is a polymer in which glucuronic acid and N-acetylglucosamine are alternately bonded, and has a molecular weight of several millions, and it has been revealed that it can retain a large amount of water. However, it has been reported that this hyaluronic acid decreases with aging (Patent Document 1), which causes a decrease in the water retention capacity of the skin accompanying aging, and is considered to cause dry skin and the like. In patients with rheumatoid arthritis, hyaluronic acid in the joints decreases and hyaluronic acid content decreases in purulent arthritis and ventilated arthritis. Is described as being effective (Patent Documents 2 and 3).

  Pomegranate contains antioxidant components such as ellagic acid and can be expected to have an anti-aging effect, and it contains female hormone-like components that can be expected to have an effect on beauty and health. Used as a health food and cosmetic ingredient. The main patent documents include cosmetics having an antioxidant action (Patent Document 4), cosmetics having a whitening action (Patent Document 5), skin external preparations having an anti-allergic action (hyaluronidase inhibitory action) (Patent Document 6), Examples include cosmetics having a female hormone-like action (Patent Document 7), elastase inhibitors (Patent Document 8), and inhibitors for the synthesis of inflammatory cytokines (Patent Document 9). However, there is no description on the effect of increasing the synthesis ability of hyaluronic acid in vivo.

In addition, the utilization of the fermented product of the pomegranate juice by lactic acid bacteria is not so much used because the pomegranate juice has high acidity and poor fermentability. The patent document (Patent Document 10) relating to a cosmetic agent containing a lactic acid bacteria fermented product of fruit juice as an active ingredient has a description of the cosmetic agent of the lactic acid bacteria fermented product of fruit juice, but there is no description regarding specific effectiveness related to pomegranate juice. In addition, Patent Document (Patent Document 11) describes an antioxidant that exhibits degradation characteristics of lactic acid bacteria Lactobacillus plantarum to hydroxyperoxide and linoleic acid hydroxyperoxide. However, there is no description about specific objects used for lactic acid bacteria fermentation and effects other than the antioxidant action.
Moreover, there is no prior literature on the hyaluronic acid synthesis promoting effect of pomegranate juice or its lactic acid bacteria fermentation product, and there is no literature information on a skin external preparation containing the lactic acid bacteria fermentation product of pomegranate juice.

JP-A-10-182402 JP-A-2002-363081 JP 2004-51579 A JP 05-320037 A JP 05-331041 A JP 09-110710 A JP2001-131053 JP-A-2005-53873 JP 2005-89304 A JP 2006-8666 A JP 2006-291146 A

In view of such a situation, an object of the present invention is to provide a hyaluronic acid synthesis accelerator having a higher effect by using a natural and safe material.

  The hyaluronic acid synthesis promoting effect was examined on fruit juices or their fermented products. As a result of intensive studies aimed at solving the above problems, the present inventors have found an effect of promoting hyaluronic acid synthesis in pomegranate juice. Among them, the lactic acid bacteria fermented product of fruit juice was also examined. However, for the pomegranate fruit juice used in the present invention, an efficient fermentation method using lactic acid bacteria was an issue to be studied. As a result of further intensive studies, it has been found that the effect of promoting hyaluronic acid synthesis is improved only by the lactic acid bacteria fermented product of pomegranate juice, and the present invention has been completed.

  The pomegranate juice used in the present invention is pomegranate (Punica granatum) juice. The fruit juice can be squeezed from commercially available pomegranate by pressing, but a concentrate of pomegranate fruit juice distributed for business use can be used. The fruit juice may be used as it is, or concentrated fruit juice may be used, or it may be diluted. Moreover, in order to make fermentation efficient, you may adjust and adjust pH to 3-8 with alkalis, such as sodium hydroxide. For the purpose of promoting the growth of lactobacilli, organic substances such as yeast extract and soybean peptide, and minerals such as magnesium sulfate may be added.

  Examples of lactic acid bacteria used in the present invention include lactic acid bacteria belonging to the genus Lactobacillus, the genus Lactococcus, the genus Leuconostoc, or the genus Pediococcus. Preferably, even if it is a lactic acid bacterium belonging to Lactobacillus plantarum in terms of improving the effectiveness by fermentation and is isolated from a plant or pickled food that is a fermented food thereof, It may be registered. Moreover, what can ferment pomegranate juice efficiently in the range of pH 3-5 is preferable.

  Culture conditions can be set as appropriate. For example, the culture temperature is not particularly limited, but is 15 to 45 ° C. as a guide, and 25 to 40 ° C. is preferable.

  The pomegranate juice or its lactic acid bacteria fermented product may be used as it is, and may be used after treatment such as extraction, concentration, dilution, filtration, and decolorization or deodorization with activated carbon or the like. The solvent to be extracted may be water, ethanol, 1,3-butylene glycol, or a mixture thereof, and the extraction temperature may be heated at room temperature.

  In the formulation of the hyaluronic acid synthesis promoter or skin external preparation of the present invention, the above extract may be used as it is, and within the range not impairing the effect of the extract, cosmetics, quasi drugs, pharmaceuticals, foods, etc. Fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, perfumes, moisturizers, powders, UV absorbers Ingredients such as thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film agents, sweeteners, acidulants can also be blended.

  Examples of the dosage form of the hyaluronic acid synthesis accelerator or skin external preparation of the present invention include, for example, lotion, cream, massage cream, emulsion, gel, aerosol, pack, cleaning agent, bath preparation, foundation, dusting, lipstick, Ointment, cataplasm, paste, plaster, essence, powder, pill, tablet, injection, suppository, emulsion, capsule, granule, liquid (tincture, fluid extract, spirits, suspension, Limonade agents, etc.), tablet confectionery, beverages and the like.

  In the hyaluronic acid synthesis promoter or skin external preparation of the present invention, the content of pomegranate juice and its fermented lactic acid bacteria is not particularly limited, but is preferably 30% or less as a solid content, and 0.001 to 10% by weight Most preferably, it is used at a concentration that can be used. If it is less than 0.0001% by weight, the effect of the present invention may not be sufficiently exerted.

  The pomegranate juice used in the present invention is a natural and highly safe material, and has an excellent hyaluronic acid synthesis promoting effect. In addition, the fermented product of lactic acid bacteria has an effect of further promoting hyaluronic acid synthesis before fermentation, so it is effective in preventing and treating skin aging, atopic dermatitis, skin diseases such as psoriasis and ichthyosis, and arthritis such as rheumatism. Therefore, it can be formulated and applied to pharmaceuticals, quasi-drugs, cosmetics, foods, and the like.

  The pomegranate juice used in the present invention and its fermented lactic acid bacteria have an excellent hyaluronic acid synthesis promoting effect and can be used in the fields of pharmaceuticals, quasi drugs, cosmetics, and foods. Furthermore, when the pomegranate juice is fermented under specific conditions, the above effect is improved.

Next, in order to describe the present invention in detail, examples of production, formulation examples and experimental examples of fermented lactic acid bacteria used in the present invention will be given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.
Below, the manufacture example of the lactic acid bacteria fermented product of a pomegranate fruit juice is shown.

Production Example 1 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix15, and adjusted to pH 5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 2 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix11, and adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 3 Fermented Pomegranate Juice Concentrated pomegranate juice (Brix65) was diluted with water to adjust to Brix8, and adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 4 Pomegranate juice fermented product Pomegranate juice was adjusted to pH 4.5 using an aqueous sodium hydroxide solution. An inoculum of lactic acid bacteria (derived from pickles) belonging to Lactobacillus plantarum was added to 500 g of the adjustment liquid. Fermented at 30 ° C. for 2 days and filtered to obtain 450 g of a pomegranate juice fermented product.

Production Example 5 Fermented Pomegranate Juice 90 g of 1,3-butylene glycol was added to 210 g of the pomegranate juice fermented in Production Example 2 and filtered to obtain 280 g of a pomegranate juice fermented product.

Production Example 6 Lyophilized Product of Fermented Pomegranate Juice 100 g of the fermented pomegranate juice of Production Example 1 was freeze-dried to obtain 15 g of a freeze-dried pomegranate juice fermented product.

Production Example 7 Lyophilized product of fermented pomegranate juice 100 g of the fermented pomegranate juice of Production Example 3 was freeze-dried to obtain 8 g of a freeze-dried pomegranate juice fermented product.

Production Example 8 Dry Product of Pomegranate Juice Fermented Product 120 g dextrin was added to 200 g of the pomegranate juice fermented product of Production Example 4 and dried with a spray dryer to obtain 145 g of a dried product of pomegranate juice.

  Below, the formulation example of the hyaluronic acid synthesis promoter using the pomegranate fruit juice or its lactic acid bacteria fermented product and a skin external preparation is shown.

Formulation Example 1 Lotion Ingredient Ingredients (parts)
1. Fermented pomegranate juice (Production Example 5) 5.0
2. 1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5. Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Comparative Example 1 Conventional Lotion A conventional lotion was obtained by replacing the fermented pomegranate juice (Production Example 5) with purified water in Formulation Example 1.

Formulation Example 2 Cream Ingredients Amount (parts)
1. Fermented pomegranate juice (Production Example 5) 0.5
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5. Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12 Ethyl paraoxybenzoate 0.05
13.1,3-Butylene glycol 8.5
14 [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 3 Gel Agent Ingredient Amount (parts)
1. Pomegranate juice (before fermentation) 5.0
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 4 Bath agent Ingredients Amount (parts)
1. Lyophilized product of fermented pomegranate juice (Production Example 6) 1.0
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume appropriate amount 5. [Manufacturing method] Ingredients 1 to 5 are mixed uniformly with sodium sulfate to make a product.

Formulation Example 5 Tablet Ingredient Amount (parts)
1. Lyophilized product of fermented pomegranate juice (Production Example 7) 5.0
2. Dried corn starch 25.0
3. Carboxymethylcellulose calcium 20.0
4). Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6). Talc 3.0
[Production method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and compressed. One tablet is 0.52 g.

Formulation Example 6 Tablet Confectionery Ingredients Amount (parts)
1. Dry product of fermented pomegranate juice (Production Example 8) 2.0
2. Dried corn starch 49.8
3. Erythritol 40.0
4). Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6). Fragrance 0.1
7). Purified water 0.1
[Production method] Components 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and tableted. One tablet is 1.0 g.
[Production Method] Components 1 and 2 are added and mixed.

  Next, in order to explain the effect of the present invention in detail, an experimental example is given.

Experimental Example 1 Hyaluronic Acid Synthesis Promotion Test The hyaluronic acid synthesis promoting effect in normal human skin fibroblasts was evaluated using the expression level of hyaluronic acid synthase-2 (HAS-2) mRNA as an index. HAS-2 is one of the enzymes that synthesize hyaluronic acid present in the cell membrane.

  Normal human skin fibroblasts are seeded in a 6 cm petri dish and become confluent, and further cultured in a medium (DMEM containing 1% FBS) supplemented with a 0.01 mg / ml concentration sample as a solid content. And total RNA was extracted. TRIzol Reagent (Invitrogen) was used for extraction of total RNA. Based on the total RNA extracted from the cells, the expression level of HAS-2 mRNA was measured by RT-PCR. For the RT-PCR method, Superscript 3 Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen) was used. The PCR reaction was carried out for 40 cycles, with initial denaturation at 95 ° C. for 2 minutes followed by 95 ° C. for 15 seconds and 60 ° C. for 31 seconds. Further, β-actin was used as an internal standard. For other operations, the expression level of HAS-2 mRNA was determined as a ratio relative to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The ratio of HAS-2 mRNA expression level at the time of sample addition relative to the control was calculated and used as the hyaluronic acid synthesis acceleration rate. The primers used for the measurement are as follows.

Primer set TGGATGACCCTACGAAGCGATTA for HAS-2 (SEQ ID NO: 1)
GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 2)

Primer set CACTCTCCCAGCCTCTCTCCC for β-actin (SEQ ID NO: 3)
GTGTTGCGCGTACAGGTCTTTG (SEQ ID NO: 4)

  The test results are shown in Table 1. Although the hyaluronic acid synthesis promoting effect was recognized both before fermentation and after fermentation (Production Example 1), the fermented product (Production Example 1) became stronger than before fermentation. Similarly, a strong hyaluronic acid synthesis promoting effect was observed for the fermented products of Production Examples 2 to 4. In addition, about the improvement of the hyaluronic acid synthesis promotion effect accompanying such fermentation by lactic acid bacteria, it was not recognized except pomegranate juice.

Experimental example 2 Use test Using the lotion of prescription example 1 and the conventional lotion of comparative example 1, a use test for one month was conducted for 15 women (23 to 50 years old) suffering from fine lines and skin firmness. went. After use, we conducted a questionnaire survey on fine lines and skin firmness.

  The results of the questionnaire survey are shown in Table 2. The external preparation for skin containing the fermented pomegranate juice of the present invention showed an excellent effect of improving fine wrinkles and skin firmness. During the test period, there was no skin problem and there was no problem with safety. There was also no problem with the deterioration of the prescription ingredients.

  The invention of the present application promotes hyaluronic acid synthesis that can be used for prevention and treatment of skin aging, atopic dermatitis, skin diseases such as psoriasis and ichthyosis, and arthritis such as rheumatoid arthritis by enhancing the ability to synthesize hyaluronic acid in vivo. Agent and external preparation for skin can be provided.

Claims (4)

A hyaluronic acid synthesis promoter (excluding external preparations for skin and bath preparations) characterized by containing a lactic acid bacteria fermentation product of pomegranate juice. Hyaluronic acid synthesis promoting agent according to claim 1, wherein the lactic acid bacterium is Lactobacillus plantarum. A prophylactic or ameliorating agent for arthritis, comprising a lactic acid bacteria fermentation product of pomegranate juice Lactobacillus plantarum. A preventive or ameliorating agent for purulent arthritis or ventilated arthritis characterized by containing a lactic acid bacteria fermentation product of Lactobacillus plantarum of pomegranate juice.