JP5001523B2 - Method for producing optically active cyanohydrin and method for producing optically active α-hydroxycarboxylic acid - Google Patents

Description

  The present invention relates to a method for efficiently producing optically active cyanohydrins and optically active α-hydroxycarboxylic acids useful as pharmaceutical intermediates and the like.

The optically active cyanohydrin is useful as an optically active organic synthesis intermediate for pyrethroid pesticide production and pharmaceutical synthesis. As one means for directly synthesizing optically active cyanohydrin from HCN and a carbonyl compound, various synthesis methods using an enzyme called hydroxynitrile lyase have been proposed.
Usually, the synthesis of optically active cyanohydrin using the enzyme is carried out in an aqueous system, an aqueous-organic solvent two-phase system, an organic solvent-microwater system, or an organic solvent system containing the enzyme and the substrate HCN and carbonyl compounds as essential elements. . As the organic solvent used for the reaction, there are many examples in which an organic solvent that is hardly soluble or insoluble in water is used. In particular, many examples using ether solvents are known. For example, the reaction is carried out in a water-organic solvent two-phase system with a volume ratio of water to organic solvent of 5: 1 to 1: 5 (Patent Document 1), and an emulsion is formed in the water-organic solvent two-phase system It is known that the reaction is carried out with stirring (Patent Document 2).
It is also known that the reaction is carried out while dropping HCN in the presence of a carbonyl compound (Patent Document 3) or the reaction is carried out by dropping a carbonyl compound while maintaining the temperature in the presence of HCN (Patent Document 4). It has been. However, in the methods described in Patent Documents 1 to 4, the accumulated concentration of the produced cyanohydrin in the reaction system was only less than 30%. Moreover, the enzyme amount per 1 mmol of carbonyl compounds is also required in a large amount of 30 to 300 units, and it cannot be said that it is an efficient method suitable for industrial production.
Furthermore, the high chemical purity and the high optical purity optically active cyanohydrin may solidify near room temperature, and when solidified, there is a problem that it becomes difficult to handle the optically active cyanohydrin. Therefore, a production method capable of accumulating a high concentration of high chemical purity and high optical purity optically active cyanohydrin has been desired.
On the other hand, optically active α-hydroxycarboxylic acid is produced by hydrolyzing the above optically active cyanohydrin (Non-patent Documents 1 and 2, Patent Documents 5, and Patent Documents 7 to 8). In the method described in the above document, after the production of optically active cyanohydrin, the optically active cyanohydrin and the enzyme are separated by solid-liquid separation, solvent extraction or phase separation and then hydrolyzed. The method for producing an optically active α-hydroxycarboxylic acid including the above method requires a step of separating the enzyme from the optically active cyanohydrin solution in the presence of the remaining HCN, so that there is a problem of high risk and low yield. there were. Therefore, a safe and high yield method for producing optically active α-hydroxycarboxylic acid has been desired.
JP-A-5-317065 JP-A-11-243983 JP 2002-330791 A JP 2004-57005 A JP-A-63-219388 International Publication No. 98/30711 Pamphlet JP 2001-348356 A JP 2002-142792 A Thomas Ziegler et al., Synthesis, 1990, 575-578 (1990) Franz Effenberger et al., Tetrahedron Letters, 32, 2605-2608 (1991)

  An object of the present invention is to provide an efficient method for producing optically active cyanohydrin accumulated at a high concentration and a method for producing optically active α-hydroxycarboxylic acid that is safe and has a high yield.

The present invention is as follows.
(1) In a method for producing optically active cyanohydrin by an enzymatic reaction in the presence of an organic solvent that is substantially immiscible with water using carbonyl compound and HCN as a substrate, the molar concentration of carbonyl compound in the reaction solution is 0.4 mol / A method for producing an optically active cyanohydrin, characterized by maintaining a state of not more than kg and not more than the molar concentration of HCN. (2) The method according to (1), wherein 1 to 20 units of hydroxynitrile lyase are used per millimole of the final carbonyl compound used. (3) A method for producing an optically active α-hydroxycarboxylic acid comprising hydrolyzing the optically active cyanohydrin obtained by the method of (1) or (2). (4) Next, after bringing the solution containing optically active α-hydroxycarboxylic acid into contact with activated carbon, the method includes concentration and / or cooling crystallization.

  According to the present invention, optically active cyanohydrin accumulated at a high concentration can be obtained efficiently. Also, the optically active α-hydroxycarboxylic acid can be obtained safely and with high yield.

Hereinafter, the present invention will be specifically described.
Hereinafter, the method for producing an optically active cyanohydrin of the present invention is simply referred to as “the present cyanohydrin production method”.
The optically active cyanohydrin refers to cyanohydrin in which one enantiomer (for example, R isomer) is contained in a larger amount than the other enantiomer (for example, S isomer), or cyanohydrin consisting of only one of the enantiomers. When cyanohydrin consists of only one of the enantiomers, the optical purity is 100%.

  The carbonyl compound which is a substrate of the present cyanohydrin production method refers to an aldehyde or a ketone, and specifically, is a compound represented by the following formula (I).

(In the formula, R ¹ and R ² may be the same or different from each other, and each represents a hydrogen atom or a monovalent hydrocarbon group having 22 or less carbon atoms.) In the hydrocarbon group, —CH ₂ — and — CH ₂ of CH ₃ may be substituted with a carbonyl group, a sulfonyl group, —O— or —S—, and ═CH ₂ may be substituted with ═O or ═S. In addition, —CH ₂ —CH, —CH ₃ CH,> CH—CH, ═CH—CH, and ═CH ₂ CH are N or C-halogen. It may be replaced. Furthermore, R ¹ and R ² may jointly represent a divalent group.

  In the above formula (I), the monovalent hydrocarbon group having 22 or less carbon atoms is a linear or branched chain hydrocarbon group, a monocyclic hydrocarbon group having no side chain or having a side chain, A polycyclic hydrocarbon group having no side chain or having a side chain, a spiro hydrocarbon group having no side chain or having a side chain, a hydrocarbon group having a ring assembly structure having no side chain or having a side chain, or Any of the chain hydrocarbon groups substituted by the cyclic hydrocarbon group is included. Further, it includes both a saturated hydrocarbon group and an unsaturated hydrocarbon group, but the unsaturated hydrocarbon group excludes a group containing an allene structure of C═C═C.

  In the following, an aromatic group having no side chain, an aromatic group having a side chain, and a phenylphenyl group or a phenylphenyl group having a side chain are collectively referred to as an aryl group. The linear or branched alkyl group thus formed is called an aralkyl group. As for other cyclic hydrocarbon groups, unless otherwise specified, when referring to those having no side chain on the ring, names such as cycloalkyl groups are simply used. As for the chain hydrocarbon group, when referring to a straight chain and a branched chain together, a name such as an alkyl group is simply used.

In the hydrocarbon group, when —CH ₂ — is substituted with a carbonyl group, a sulfonyl group, —O— or —S—, a structure of ketone, sulfone, ether or thioether is introduced, and —CH ₃ —CH _{3 When 2-} is substituted with a carbonyl group, -O- or -S-, it is changed to a formyl group (aldehyde), a hydroxyl group or a mercapto group, respectively, or when the terminal = CH ₂ is substituted with = O or = S, This means that the structure of a ketone or thioketone is introduced. When CH of —CH ₂ — is changed to N, it is —NH—, and when CH of —CH— is changed to N,> N When —CH—C—H changes to N, it becomes = N—, and when —CH ₃ C—H at the terminal changes to N, —NH ₂ is introduced, and —CH ₂ C—H Changes to N, = NH. In addition, when C—H of —CH ₃ , —CH ₂ —, ═CH—, ≡CH or> CH— is substituted with C-halogen, a halogen atom is substituted on the carbon. In addition, when the substitution to —O—, —S—, or N in the carbon chain corresponds to oxa substitution, thia substitution, or aza substitution for the hydrocarbon group, respectively, for example, occurs at the skeleton carbon of the ring of the hydrocarbon ring. The hydrocarbon ring is converted into an oxygen-containing heterocycle, a sulfur-containing heterocycle and a nitrogen-containing heterocycle, respectively. In the hydrocarbon group, the substitution in CH _{2 and} C—H may be carried out independently, and in addition, when CH ₂ or C—H still remains on the carbon after the substitution described above. Further substitutions may be made. Furthermore, by the above substitution, conversion of —CH ₂ —CH ₃ to —CO—O—H; carboxylic acid structure, and the like is also performed.
Examples of the halogen atom include a fluorine atom, a chlorine atom, a bromine atom and an iodine atom, and a fluorine atom, a chlorine atom and a bromine atom are preferable.

  Therefore, as the hydrocarbon group, both a chain hydrocarbon group and a hydrocarbon group having a cyclic structure such as a cyclic hydrocarbon group can be selected. For example, a straight chain or branched chain that is a saturated chain hydrocarbon group Saturated cyclic carbonization such as linear alkyl group, unsaturated chain hydrocarbon group linear or branched alkenyl group, linear or branched alkynyl group, linear or branched alkadienyl group, etc. Cycloalkenyl groups that are hydrogen groups, cycloalkenyl groups that are unsaturated cyclic hydrocarbon groups, cycloalkynyl groups, cycloalkadienyl groups, etc., aryl groups that are aromatic hydrocarbon groups, aralkyl groups, arylalkenyl groups, etc. Is mentioned.

  More specifically, examples of the linear or branched alkyl group include a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a 1-methylpropyl group, a pentyl group, a 1-methylbutyl group, a hexyl group, 1-methylpentyl group, heptyl group, 1-methylhexyl group, 1-ethylpentyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, tridecyl group, tetradecyl group, 2-methylpropyl group, 2- Methylbutyl group, 3-methylbutyl group, 2-methylpentyl group, 3-methylpentyl group, 4-methylpentyl group, methylhexyl group, methylheptyl group, methyloctyl group, methylnonyl group, 1,1-dimethylethyl group, 1 , 1-dimethylpropyl group, 2,2-dimethylpropyl group, 2,6-dimethylheptyl group, 3,7 Dimethyl octyl group, a 2-ethylhexyl group. Examples of the cycloalkylalkyl group include a cyclopentylmethyl group and a cyclohexylmethyl group, and examples of the cycloalkyl group include a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a methylcyclopentyl group, a cyclohexyl group, a methylcyclohexyl group, a cycloheptyl group, and a cyclooctyl group. Etc. Examples of the bicycloalkyl group include a norbornyl group, a bicyclo [2.2.2] octyl group, an adamantyl group, and the like. Examples of the linear or branched alkenyl group include a vinyl group, an allyl group, a crotyl group (2-butenyl group), and an isopropenyl group (1-methylvinyl group). Examples of the cycloalkenyl group or cycloalkadienyl group include a cyclopentenyl group, a cyclopentadienyl group, a cyclohexenyl group, and a cyclohexanedienyl group. Examples of the linear or branched alkynyl group include an ethynyl group, a propynyl group, and a butynyl group. Examples of the aryl group include a phenyl group, 1-naphthyl group, 2-naphthyl group, 2-phenylphenyl group, 3-phenylphenyl group, 4-phenylphenyl group, 9-anthryl group, methylphenyl group, dimethylphenyl group, Examples thereof include a trimethylphenyl group, an ethylphenyl group, a methylethylphenyl group, a diethylphenyl group, a propylphenyl group, and a butylphenyl group. Examples of aralkyl groups include benzyl, 1-naphthylmethyl, 2-naphthylmethyl, phenethyl (2-phenylethyl), 1-phenylethyl, phenylpropyl, phenylbutyl, phenylpentyl, phenyl Examples include hexyl group, methylbenzyl group, methylphenethyl group, dimethylbenzyl group, dimethylphenethyl group, trimethylbenzyl group, ethylbenzyl group, and diethylbenzyl group. Examples of the arylalkenyl group include a styryl group, a methylstyryl group, an ethylstyryl group, a dimethylstyryl group, and a 3-phenyl-2-propenyl group.

Examples of the group in which CH ₂ in the hydrocarbon group is substituted with carbonyl group, sulfonyl group, O or S, or C—H with N or C-halogen include ketone, aldehyde, carboxylic acid, ester, sulfone, ether , A thioether, an amine, an alcohol, a thiol, a halogen, a group containing at least one structure such as a heterocyclic ring (for example, an oxygen-containing heterocyclic ring, a sulfur-containing heterocyclic ring, or a nitrogen-containing heterocyclic ring). The oxygen-containing heterocycle, sulfur-containing heterocycle, and nitrogen-containing heterocycle mean those in which the carbon of the ring skeleton of the cyclic hydrocarbon group is substituted with oxygen, sulfur, or nitrogen, respectively. There may be more than one kind of heterocycle. Examples of the hydrocarbon group having the above-described substitution include an acetylmethyl group and an acetylphenyl group having a ketone structure; an acetoxy group and a propoxy group having an ester structure; a methanesulfonylmethyl group having a sulfone structure; a methoxymethyl group having an ether structure, and a methoxyethyl group. Group, ethoxyethyl group, methoxypropyl group, butoxyethyl group, ethoxyethoxyethyl group, methoxyphenyl group, dimethoxyphenyl group, phenoxymethyl group; thioether structure methylthiomethyl group, methylthiophenyl group; amine structure aminomethyl group, 2 -Aminoethyl group, 2-aminopropyl group, 3-aminopropyl group, 2,3-diaminopropyl group, 2-aminobutyl group, 3-aminobutyl group, 4-aminobutyl group, 2,3-diaminobutyl group 2,4-diaminobutyl group, 3 , 4-Diaminobutyl group, 2,3,4-triaminobutyl group, methylaminomethyl group, dimethylaminomethyl group, methylaminoethyl group, propylaminomethyl group, cyclopentylaminomethyl group, aminophenyl group, diaminophenyl group , Aminomethylphenyl group; oxygen-containing heterocyclic tetrahydrofuranyl group, tetrahydropyranyl group, morpholylethyl group; oxygen-containing heteroaromatic furyl group, furfuryl group, benzofuryl group, benzofurfuryl group; sulfur-containing heteroaromatic ring thienyl Group: pyrrolyl group, imidazolyl group, oxazolyl group, thiadiazolyl group, pyridyl group, pyrimidinyl group, pyridazinyl group, pyrazinyl group, tetrazinyl group, quinolyl group, isoquinolyl group, pyridylmethyl group of nitrogen-containing heteroaromatic ring; Hydroxyethyl 2-hydroxypropyl group, 3-hydroxypropyl group, 2,3-dihydroxypropyl group, 2-hydroxybutyl group, 3-hydroxybutyl group, 4-hydroxybutyl group, 2,3-dihydroxybutyl group, 2,4 -Dihydroxybutyl group, 3,4-dihydroxybutyl group, 2,3,4-trihydroxybutyl group, hydroxyphenyl group, dihydroxyphenyl group, hydroxymethylphenyl group, hydroxyethylphenyl group; 2-mercaptoethyl group of thiol structure 2-mercaptopropyl group, 3-mercaptopropyl group, 2,3-dimercaptopropyl group, 2-mercaptobutyl group, 3-mercaptobutyl group, 4-mercaptobutyl group, mercaptophenyl group; halogenated hydrocarbon group Certain 2-chloroethyl groups, 2-chloropropiyl Group, 3-chloropropyl group, 2-chlorobutyl group, 3-chlorobutyl group, 4-chlorobutyl group, fluorophenyl group, chlorophenyl group, bromophenyl group, difluorophenyl group, dichlorophenyl group, dibromophenyl group, chlorofluorophenyl group, Trifluorophenyl group, trichlorophenyl group, fluoromethylphenyl group, trifluoromethylphenyl group; 2-amino-3-hydroxypropyl group, 3-amino-2-hydroxypropyl group, 2-amino having an amine structure and an alcohol structure -3-hydroxybutyl group, 3-amino-2-hydroxybutyl group, 2-amino-4-hydroxybutyl group, 4-amino-2-hydroxybutyl group, 3-amino-4-hydroxybutyl group, 4-amino -3-hydroxybutyl group, 2,4- Diamino-3-hydroxybutyl group, 3-amino-2,4-dihydroxybutyl group, 2,3-diamino-4-hydroxybutyl group, 4-amino-2,3-dihydroxybutyl group, 3,4-diamino- 2-hydroxybutyl group, 2-amino-3,4-dihydroxybutyl group, aminohydroxyphenyl group; fluorohydroxyphenyl group, chlorohydroxyphenyl group, which is a hydrocarbon group substituted with a halogen and a hydroxyl group; carboxyphenyl having a carboxylic structure Groups and the like. The asymmetric divalent group represented by R ¹ and R ² is not particularly limited, and examples thereof include norbornane-2-ylidene and 2-norbornene-5-ylidene.

  Examples of the carbonyl compound represented by the above formula (I) include benzaldehyde, m-phenoxybenzaldehyde, p-methylbenzaldehyde, o-chlorobenzaldehyde, m-chlorobenzaldehyde, p-chlorobenzaldehyde, m-nitrobenzaldehyde, 3,4 -Aromatic aldehydes such as methylenedioxybenzaldehyde, 2,3-methylenedioxybenzaldehyde, phenylacetaldehyde, furfural, 2-pyridinecarboxaldehyde, 3-pyridinecarboxaldehyde, 4-pyridinecarboxaldehyde; acetaldehyde, butyraldehyde, isobutyraldehyde , Aldehydes such as valeraldehyde, cyclohexanealdehyde, 4-hydroxy-3,3-dimethylbutyraldehyde; ethyl methyl Saturated aliphatic ketones such as ketone, butyl methyl ketone, methyl propyl ketone, isopropyl methyl ketone, methyl pentyl ketone, methyl (2-methylpropyl) ketone, methyl (3-methylbutyl) ketone; methyl (2-propenyl) ketone, ( Unsaturated aliphatic ketones such as 3-butenyl) methyl ketone; alkyl (haloalkyl) ketones such as (3-chloropropyl) methyl ketone; 2- (protected amino) aldehydes such as 2- (alkoxycarbonylamino) -3-cyclohexylpropionaldehyde Alkylthioaliphatic aldehydes such as 3-methylthiopropionaldehyde. Benzaldehyde, o-chlorobenzaldehyde, m-chlorobenzaldehyde, p-chlorobenzaldehyde, 2-pyridinecarboxaldehyde, 3-pyridinecarboxaldehyde, 4-pyridinecarboxaldehyde, 4-hydroxy-3,3-dimethylbutyraldehyde are preferably used. However, benzaldehyde is particularly preferably used.

  The enzyme used in the present method for producing cyanohydrin means an enzyme having an activity of synthesizing optically active cyanohydrin from a carbonyl compound in the presence of HCN. Such enzymes include hydroxynitrile lyase. Hydroxynitrile lyase ((R) -hydroxynitrile lyase) for synthesizing R-type cyanohydrin includes (R) -hydroxynitrile lyase derived from rose family plants such as almond (Prunus amygdalus), (R) derived from flaxaceae plants. -Hydroxynitrile lyase can be exemplified. Examples of hydroxynitrile lyase ((S) -hydroxynitrile lyase) for synthesizing S cyanohydrin include (S) -hydroxynitrile lyase derived from gramineous plants such as Sorghum bicolor, cassava (Manihot esculenta), para rubber tree ( Examples thereof include (S) -hydroxynitrile lyase derived from Euphorbiaceae plants such as Hevea brasiliensis and (S) -hydroxynitrile lyase derived from boroboroaceae plants such as Ximeria americana. The base sequence of the hydroxynitrile lyase gene derived from cassava (Manihot esculenta) is known and published in the literature (Jane Hughes et al, Arch. Biochem. Biophys. 331 (1994) 496-502 and GenBank accession number Z29091). . The base sequence of this gene is represented by SEQ ID NO: 2. The amino acid sequence encoded by the gene is represented by SEQ ID NO: 1.

The hydroxynitrile lyase can be prepared by extraction from biological tissue. It can also be produced and adjusted by a recombinant organism produced by cloning a hydroxynitrile lyase gene and incorporating the gene. Furthermore, the hydroxynitrile lyase modified by modifying the hydroxynitrile lyase gene and the enzyme function can be adjusted as long as it has an activity of synthesizing optically active cyanohydrin.
Hydroxynitrile lyase can be extracted by a conventional method. The extracted preparation can be used as an enzyme in this production method as long as it does not adversely affect the reaction. For example, hydroxynitrile lyase prepared using a genetically modified Escherichia coli prepared by incorporating a hydroxynitrile lyase gene is preferable because preparation is easy.
As the form of the hydroxynitrile lyase, any of powdered enzyme, an enzyme aqueous solution dissolved in a buffer solution, an immobilized enzyme immobilized on an appropriate carrier, and the like can be used. Since the preparation is easy, it is preferable to use an aqueous enzyme solution dissolved in a buffer solution or the like. The enzyme aqueous solution may be a suspension containing impurities, for example, a suspension obtained by crushing genetically modified E. coli.

  In the present method for producing cyanohydrin, the enzymatic reaction is carried out in the presence of an organic solvent substantially immiscible with water in order to increase productivity. Here, “an organic solvent substantially immiscible with water” means an organic solvent that separates into two layers when the organic solvent is mixed with water at 25 ° C. in a weight ratio of 1: 1. The organic solvent is not particularly limited as long as it is substantially immiscible with water, sufficiently dissolves the substrate and the product, and does not adversely affect the enzyme reaction. Such an organic solvent is appropriately selected according to the physical properties of the substrate aldehyde or ketone and the physical properties of the product optically active cyanohydrin.

Specific examples of organic solvents that are substantially immiscible with water include hydrocarbon solvents that may be halogenated (for example, linear, branched or cyclic saturated or unsaturated aliphatic hydrocarbons, aromatics). Group hydrocarbons), for example, pentane, hexane, cyclohexane, benzene, toluene, xylene, methylene chloride, chloroform, etc .; alcohol solvents that may be halogenated (for example, linear, branched or cyclic saturated or unsaturated). Saturated aliphatic alcohols, aralkyl alcohols) such as n-butanol, isobutanol, t-butanol, hexanol, cyclohexanol, n-amyl alcohol, etc .; ether solvents that may be halogenated (for example, linear, Branched or cyclic saturated or unsaturated aliphatic ethers, aromatic ethers) such as diethyl ether , Dipropyl ether, diisopropyl ether, dibutyl ether, t-butyl methyl ether, dimethoxyethane and the like; ester solvents which may be halogenated (for example, linear, branched or cyclic saturated or unsaturated aliphatic) Ester, aromatic ester), for example, methyl formate, methyl acetate, ethyl acetate, butyl acetate, methyl propionate and the like. These may be used alone or in admixture of two or more. In particular, it is preferable to use diisopropyl ether, dibutyl ether, or t-butyl methyl ether.
The organic solvent is preferably saturated with water or an aqueous buffer. The pH of the aqueous buffer is preferably the optimum pH for enzyme activity. The pH is constituted by a buffer solution that exhibits buffering ability at pH 4.0 to 7.0, for example, salts of phosphoric acid, citric acid, glutaric acid, malic acid, malonic acid, o-phthalic acid, succinic acid, acetic acid, etc. It is preferable to use a buffer solution or the like.
The organic solvent may contain HCN in advance, and the HCN concentration is not particularly limited. HCN is preferably 20% by mass or less, particularly preferably 10% by mass or less. The concentration of HCN in the organic solvent is preferably adjusted to a desired concentration by diluting with an organic solvent or adding HCN to the organic solvent.

  The enzyme reaction solution is not particularly limited as long as an organic solvent coexists. Any solution in which an enzymatic reaction proceeds, for example, an organic solvent, an organic solvent and fine water, or a two-phase solution of water and an organic solvent may be used. A two-phase solution of water and an organic solvent is preferred.

  The amount of the hydroxynitrile lyase used is 1 to 1000 units per 1 mmol of the final reaction amount of the carbonyl compound, for example, the final amount of the carbonyl compound used. In addition, since there is little coloration when the mixture containing the optically active cyanohydrin after distilling off the organic solvent and / or water is subjected to a hydrolysis step with a mineral acid, per 1 mmol of the final amount of carbonyl compound used. It is preferable to use 1 to 20 units, and it is particularly preferable to use 1 to 10 units. Here, “final amount of carbonyl compound used” means the total amount of carbonyl compound used from the start of the reaction to the end of the reaction. One unit (U; unit) is defined as the activity of producing 1 μmol of benzaldehyde per minute using DL-mandelonitrile as a substrate. The activity can be measured by the method described in JP-T-11-508775.

  The reaction temperature is preferably −10 to 40 ° C. Within this range, the energy consumption for cooling the reaction system is reduced. Further, it is possible to prevent a decrease in optical purity due to HCN addition in a non-enzymatic reaction to a carbonyl compound. The temperature is more preferably 0 to 30 ° C, and particularly preferably 4 to 20 ° C.

  The enzyme reaction solution is prepared by adding HCN and / or a carbonyl compound to a solution containing an organic solvent immiscible with water and a hydroxynitrile lyase. The concentration of the carbonyl compound in the enzyme reaction solution is maintained at 0.4 mol / kg or less. If it exceeds 0.4 mol / kg, the carbonyl compound is present in a high concentration in the enzyme reaction solution, and the activity of the hydroxynitrile lyase is remarkably reduced. Therefore, it becomes difficult to accumulate 30% by weight or more of optically active cyanohydrin. In addition, in order to prevent the activity of the hydroxynitrile lyase from being reduced due to the influence of the carbonyl compound staying in the enzyme reaction solution, the state in which the molar concentration of the carbonyl compound in the enzyme reaction solution is lower than the molar concentration of HCN is maintained. Is preferable, and is particularly preferably 0.2 mol / kg or less. The lower limit is preferably maintained at 1 μmol / kg or more, particularly preferably 1 mmol / kg or more.

The HCN concentration in the enzyme reaction solution is not particularly limited, but is preferably 20% by weight or less. The HCN concentration in the enzyme reaction solution is more preferably maintained at 10% by weight or less, and particularly preferably 4.5% by weight or less. The lower limit should just be more than the molar concentration of the carbonyl compound in an enzyme reaction solution. The HCN concentration in the enzyme reaction solution is preferably maintained at 0.01% by weight or more.
For example, HCN is preferably added to a solution containing an organic solvent immiscible with water and a hydroxynitrile lyase so that the HCN concentration does not exceed 10% by mass. Thereafter, the carbonyl compound is added while maintaining the concentration to 0.4 mol / kg or less and lower than the concentration of HCN. When HCN and a carbonyl compound are added to the enzyme reaction solution, HCN and the carbonyl compound are converted into optically active cyanohydrin by the enzyme reaction and consumed. In order to supplement the consumed HCN and carbonyl compounds, HCN and / or carbonyl compounds are added sequentially. Examples of the addition method include a method of adding in a plurality of times or a method of dropping continuously. The state in which the carbonyl compound is 0.4 mol / kg or less and lower than the molar concentration of HCN is maintained.
By the method described above, the optically active cyanohydrin has a high optical purity, for example 90% e. e. Thus, 30% by mass or more can be accumulated in the reaction system. When the concentration is higher than this accumulated concentration, the amount of hydroxynitrile lyase and organic solvent used relative to the optically active cyanohydrin is relatively suppressed, which is economically advantageous.

  In order to maintain the molar concentration of the carbonyl compound in the reaction system at 0.4 mol / kg or less, the carbonyl compound may be added by measuring the molar concentration of the carbonyl compound in the reaction system by HPLC analysis, or the reaction The consumption rate of the carbonyl compound under conditions may be measured in advance, and the carbonyl compound may be continuously added at a rate lower than the consumption rate. Alternatively, HCN may be added in advance in the reaction system so that preferably HCN does not exceed 10% by mass, and then the carbonyl compound and HCN may be added simultaneously so that the molar ratio thereof is 1: 1 or HCN is slightly excessive. Alternatively, the HCN concentration in the reaction system may be titrated and HCN added so that the HCN concentration does not exceed 10% by mass.

  In addition, the amount of HCN used is 1 to 4 times the mole of the final amount of carbonyl compound used, but since a large amount of HCN does not remain in the enzyme reaction solution after the reaction, it is safe. The amount of HCN used is preferably 1 to 1.5 moles.

  The reaction time may be longer than the time until the concentration of the optically active cyanohydrin in the enzyme reaction solution reaches 30% by weight or more. The time from the start of the addition of the solution containing HCN and / or carbonyl compound to the end of the enzyme reaction solution until the end of the addition is preferably 2 hours or more in order to prevent a rapid temperature increase due to the heat of reaction.

  In the present cyanohydrin production, the enzyme is dispersed in the reaction system by stirring or the like during and / or after the addition of HCN and / or carbonyl compound. Stop mixing the enzyme reaction solution to finish the enzyme reaction. The organic phase containing optically active cyanohydrin and the hydroxynitrile lyase are separated by a conventional method, or the organic solvent and / or water is distilled off without separating the hydroxynitrile lyase to recover the optically active cyanohydrin. It is preferable to recover the optically active cyanohydrin by distilling off the organic solvent and / or water without separating the hydroxynitrile lyase. When recovered by this method, the step of separating the organic phase and the enzyme can be omitted, and optically active cyanohydrin can be efficiently recovered. Moreover, caking of the optically active cyanohydrin can be prevented.

Here, the step of distilling off the organic solvent and / or water from the reaction solution is performed at a relatively low temperature under reduced pressure rather than under normal pressure and high temperature because optically active cyanohydrin is unstable at high temperature. It is preferable to do. Further, a known stabilizer for cyanohydrin may be added in the distillation step. Any stabilizer can be used as long as it can maintain the concentrated residue acidic. The concentrated residue is mainly composed of optically active cyanohydrin and enzyme debris obtained by distilling off the organic solvent and / or water from a reaction solution composed of an organic solvent, water, an enzyme and optically active cyanohydrin.
Examples of the stabilizer include organic acids such as p-toluenesulfonic acid and acetic acid, and inorganic acids such as sulfuric acid. It is preferable to add 1/200 to 1/10 mol of a stabilizer with respect to the optically active cyanohydrin.
It is preferable that the content of the optically active cyanohydrin in the solution containing the optically active cyanohydrin is 50% by mass or more by the above-described distillation step. The content is more preferably 80% by weight or more, and particularly preferably 90% by weight or more.
The degree of vacuum and temperature in the distillation step are appropriately selected according to the type of organic solvent. Usually, when a solvent having a boiling point of about 30 to 100 ° C., such as t-butyl methyl ether or diisopropyl ether, the distillation temperature is preferably 0 to 100 ° C. The distillation temperature is more preferably 20 to 70 ° C, and particularly preferably 20 to 60 ° C. The degree of vacuum is preferably 1 to 600 Torr, and particularly preferably 5 to 400 Torr. The distilled solvent is collected using a cooling tube cooled to a temperature sufficient to collect the solvent, for example, 10 ° C. or lower. This is efficient.

  Next, the second invention will be described. This carboxylic acid production method is carried out by hydrolyzing an optically active cyanohydrin obtained by distilling off an organic solvent and / or water. Examples of the hydrolysis method include hydrolysis using a mineral acid. Examples of the mineral acid used here include hydrochloric acid, sulfuric acid, nitric acid, boric acid, phosphoric acid, and perchloric acid. It is preferred to use hydrochloric acid. The amount of mineral acid used is preferably 0.5 to 20 equivalents relative to the optically active cyanohydrin. The amount used is more preferably 0.9 to 10 equivalents, and particularly preferably 1 to 5 equivalents.

  For the hydrolysis, a reaction solvent may be used as necessary. Water is preferred when a reaction solvent is used. Polar solvents such as dimethyl sulfoxide, dimethylformamide and dimethylacetamide, hydrocarbon solvents such as toluene, hexane and heptane, or ether solvents such as diethyl ether, diisopropyl ether, t-butyl methyl ether and tetrahydrofuran may coexist. . These solvents may be used as a mixture.

  The concentration of the optically active cyanohydrin is preferably 1 to 70% by mass. Within this range, the reaction rate is fast. The concentration is more preferably 5 to 60% by mass, and particularly preferably 10 to 50% by mass.

  The method for adding the optically active cyanohydrin solution, mineral acid or solvent is not particularly limited. A method in which an optically active cyanohydrin solution is added to mineral acid and then a solvent is added to the reaction solution is preferable in terms of high reaction efficiency. The reaction temperature for the hydrolysis is preferably -5 ° C to the boiling point of the solvent, more preferably 10 to 90 ° C. Within this range, the reaction rate is fast and impurities can be reduced. Further, the temperature at which the optically active cyanohydrin solution is added to the mineral acid may be different from the temperature at which the solvent is added to the reaction solution. For example, it is preferable that the temperature at the time of adding an optically active cyanohydrin solution containing a concentrated residue obtained by producing cyanohydrins by an enzymatic reaction and distilling off the solvent into the mineral acid is −5 ° C. to the boiling point of the solvent, It is especially preferable to set it as 10-40 degreeC. Next, the reaction temperature when the solvent is added to the reaction solution is preferably 10 ° C. to the boiling point of the solvent, particularly preferably 30 to 90 ° C.

By hydrolysis, the optically active cyanohydrin to be hydrolyzed and the intermediate α-hydroxyamide are in a state of 10% or less with respect to the optically active α-hydroxycarboxylic acid in terms of the analytical peak in the measurement by high performance liquid chromatography. After that, the optically active α-hydroxycarboxylic acid is isolated from the reaction solution. In this case, the reaction solution may be crystallized to form a non-uniform state, that is, a so-called slurry.
Next, the optically active α-hydroxycarboxylic acid is extracted with an organic solvent, and washed with water as necessary. Thereafter, the solvent is evaporated and dried, or the reaction solution is concentrated and / or cooled as required to precipitate crystals of optically active α-hydroxycarboxylic acid. The precipitated crystals are collected by filtration. After the hydrolysis is completed, since HCN substantially does not remain in the reaction solution, the recovery of the optically active α-hydroxycarboxylic acid crystal can be performed safely.

In the present carboxylic acid production method, when the optically active α-hydroxycarboxylic acid crystal is colored, the optically active α-hydroxycarboxylic acid crystal is redissolved with a solvent and then contacted with activated carbon to remove the color. Further, after the hydrolysis solution is contact-treated with activated carbon, the optically active α-hydroxycarboxylic acid crystal can be prevented from being colored by isolating the optically active α-hydroxycarboxylic acid crystal. The method for the contact treatment is not particularly limited. For example, when carrying out batchwise, the contact treatment is performed by adding activated carbon to the optically active α-hydroxycarboxylic acid solution and stirring. In the case of continuous operation, the optically active α-hydroxycarboxylic acid solution is contacted through a column filled with activated carbon.
The degree of coloring is digitized (Hazen color number) by comparing with the APHA standard color using a colorimeter tube. The amount of activated carbon used for the contact treatment, the treatment temperature, and the treatment time are appropriately selected depending on the degree of coloring.

  When the contact treatment is carried out batchwise, the activated carbon is filtered off after the contact treatment. After separation by filtration, the filtrate is evaporated, dried or concentrated, and cooled to crystallize to recover optically active α-hydroxycarboxylic acid crystals. When it is carried out continuously, the activated carbon does not need to be filtered off, so the optically active α-hydroxycarboxylic acid solution after the contact treatment is recovered as described above.

  According to the present carboxylic acid production method, optically active α-hydroxycarboxylic acid crystals can be recovered from the obtained optically active cyanohydrin without going through a complicated and dangerous enzyme separation step.

Hereinafter, the present invention will be described in more detail with reference to Examples and Comparative Examples.
In addition, the chemical purity and optical purity of mandelonitrile, mandelamide, and mandelic acid were determined under the following analysis conditions using high performance liquid chromatography (HPLC).
<Chemical purity>
Sample preparation method: Dissolve 20 mg of sample in 25 mL of carrier Device: Column oven 865-CO manufactured by JASCO Corporation
UV 870-UV manufactured by JASCO
Pump 880-PU manufactured by JASCO Corporation
Integrator Shimadzu Corporation C-R3A
Column: ODS-2 manufactured by GL Sciences Inc. Carrier: acetonitrile: water = 3/7 (adjusted to pH 3.0 with phosphoric acid)
Column temperature: 40 ° C
Flow rate: 1.0 mL / min
Wavelength: 220nm
<Optical purity>
Sample preparation method: Dissolve 20 mg of sample in 25 mL of carrier Device: Column oven 865-CO manufactured by JASCO Corporation
UV 870-UV manufactured by JASCO
Pump 880-PU manufactured by JASCO Corporation
Integrator Shimadzu Corporation C-R3A
Column: CHIRALCEL OJ-H manufactured by Daicel Chemical Industries, Ltd. Carrier: n-hexane: 2-propanol: trifluoroacetic acid = 90: 10: 0.1
Column temperature: 35 ° C
Flow rate: 1.0 mL / min
Wavelength: 220nm
Detection limit value: 99.9% ee

[Adjustment Example 1]
[Preparation of transformed (introduced) hydroxynitrile lyase expression]
(1) Preparation of hydroxynitrile lyase gene by PCR Jane Hughes et al, Arch. Biochem. Biophys. Based on the nucleotide sequences described in 331 (1994) 496-502 and GenBank accession number Z29091, a hydroxynitrile lyase gene derived from cassava (Manihot esculenta) represented by SEQ ID NO: 2 was synthesized by PCR. Specifically, 20 types of oligonucleotides F01 to F10 and R01 to R10 (SEQ ID NOs: 3 to 22) were designed and synthesized. Twenty kinds of oligonucleotides set to be complementary to the oligonucleotides were designed to overlap each other by about 20 bases. FIG. 1 schematically shows the positional relationship of 20 kinds of oligonucleotides F01 to F10 and R01 to R10 (SEQ ID NOs: 3 to 22). The lyophilized oligonucleotide was resuspended in distilled water to 100 pmol / μl. 1 μl of each of the 20 oligonucleotide solutions was collected to prepare a mixed oligo. This mixture was added to PCR-mix (Pwo 10 × buffer, dNTP mix, Pwo DNA polymerase) (manufactured by Boehringer Mannheim). Table 1 shows the composition of the PCR reaction solution.

PCR was carried out by setting 55 cycles of 94 ° C. for 30 seconds, 52 ° C. for 30 seconds, and 72 ° C. for 30 seconds, extending the oligonucleotide, and PCR synthesis of the gene. This operation was designated as 1st PCR.
Next, PCR amplification of the synthetic gene produced by the above method was performed. This operation was designated as 2nd PCR. To 1.3 μl of the above A, B, C reaction products, add 5 μl Pwo 10 × buffer, 5 μl dNTP mix, 0.5 μl Pwo DNA polymerase, 36.2 μl distilled water and 1 μl outer primer. Was added. F01 (SEQ ID NO: 3) and R01 (SEQ ID NO: 13) primers were used as outer primers. In 2nd PCR, a gene was amplified by performing 23 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds, and 72 ° C. for 60 seconds. The amplified product was subjected to 1.5% agarose gel electrophoresis, and an amplified product of about 1 kb was confirmed.

(2) Ligation of hydroxynitrile lyase gene to vector The band (about 1 kb) of the amplification product of 2nd PCR obtained in step (1) was purified with QIAquick Gel Extraction Kit (manufactured by QIAGEN). Purified DNA (5 μl) was digested with restriction enzymes BamHI (1 μl) (contains a digestion recognition site in oligonucleotide F01) and KpnI (1 μl) (contains a digestion recognition site in oligonucleotide R01) at 37 ° C. for 1 hour. Digestion, phenol extraction, chloroform extraction, ethanol precipitation [Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Press (1989))]. Vector-pUC19 (manufactured by Takara Bio Inc.) (1 μl), distilled water (4 μl) and solution I (DNA Ligation Kit ver. 2 (manufactured by Takara Bio Inc.) previously digested with purified DNA (5 μl), BamHI and KpnI )) (10 μl) was mixed to make a ligation mixture. The mixture was incubated for 12 hours at 16 ° C. to bind the amplified product to the vector.

(3) Preparation of competent cells of E. coli JM109 strain Inoculated 1 ml of E. coli JM109 strain in LB medium (1% bactotryptone, 0.5% bactoeast extract, 0.5% NaCl) at 37 ° C. for 5 hours aerobic Was pre-cultured. 0.4 ml of the preculture solution is added to 40 ml of SOB medium (2% bactotryptone, 0.5% bactoeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) for 20 hours at 18 ° C. Cultured. The culture was collected by centrifugation (3,700 × g, 10 minutes, 4 ° C.), and then cooled TF solution (20 mM PIPES-KOH (pH 6.0), 200 mM KCl, 10 mM CaCl ₂ , 40 mM MnCl _2). ) Was added and left at 0 ° C. for 10 minutes. Thereafter, the mixture was centrifuged again (3,700 × g, 10 minutes, 4 ° C.), and the supernatant was removed. The precipitated Escherichia coli was suspended in 3.2 ml of a cold TF solution, 0.22 ml of dimethyl sulfoxide was added, and the mixture was allowed to stand at 0 ° C. for 10 minutes.

(4) Cloning of hydroxynitrile lyase gene 200 μl of the prepared competent cell was added to 10 μl of the ligation product prepared in the step (2) and left at 0 ° C. for 30 minutes. The competent cell was subjected to a heat shock at 42 ° C. for 30 seconds and cooled at 0 ° C. for 2 minutes. Thereafter, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bactoeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) was added to the competent cells, Cultured with shaking at 37 ° C. for 1 hour. Each 200 μl of the culture solution was spread on an LBAmp agar medium (LB medium containing ampicillin 100 mg / L, 1.5% agar) and cultured at 37 ° C. A plurality of transformant colonies grown on an agar medium were cultured overnight at 37 ° C. in 1.5 ml of LBAmp medium (LB medium containing 100 mg / L of ampicillin). After collecting each of the culture solutions, the recombinant vector was recovered using Flexi Prep (manufactured by Amersham Bioscience). The base sequence of the obtained recombinant vector was analyzed using CEQ DTCS Quick Start Kit and fluorescent sequencer CEQ 2000XL DNA Analysis system (both BECKMAN COULTER, USA). Oligonucleotides F01 to F10 and R01 to R10 were used as primers.
One of the recombinant vectors having the same sequence as the base sequence of the hydroxynitrile lyase gene derived from cassava (Manihot esculenta) represented by SEQ ID NO: 2 was named pUME.

(5) Preparation of hydroxynitrile lyase gene for expression vector incorporation A cassava (Manihot esculenta) -derived hydroxynitrile lyase expression plasmid was prepared by the following method. First, a DNA fragment encoding hydroxynitrile lyase was prepared by PCR so that it had a restriction enzyme recognition site at both ends that could be easily introduced into an expression vector. The reaction mixture for PCR consisted of 5 μl Pwo 10 × buffer, 5 μl dNTP mix, 0.5 μl Pwo DNA polymerase, 36.2 μl distilled water, 1 μl sense primer (SEQ ID NO: 23, 29 nucleotides). , Having an NcoI recognition site and an ATG start codon after the hydroxynitrile lyase gene in the sequence, and an antisense primer (SEQ ID NO: 24, 33 nucleotides). The Sse8387I recognition site and the hydroxynitrile rearion in the sequence And 1 μl of plasmid pUME was used as a template. PCR was performed by denaturing at 95 ° C. for 2 minutes, followed by 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds, and 72 ° C. for 2 minutes.

Sense primer:
CCA CCATGG TAACTGCACATTTTGTTCTG (SEQ ID NO: 23; underlined indicates restriction enzyme NcoI recognition site)
Antisense primer:
GG CCTGCAGG TTAACTTAATAGGAGCTAAAAGC (SEQ ID NO: 24; underlined portion indicates restriction enzyme Sse8387I recognition site)

  The amplified PCR product obtained by PCR was digested with Sse8387I and then partially digested with NcoI. After separation by agarose gel electrophoresis, a gel (about 0.8 kb) containing the full length of hydroxynitrile lyase was cut out. The amplification product in the gel was purified with the QIAquick Gel Extraction Kit.

(6) Preparation of Expression Vector Next, a hydroxynitrile lyase expression vector was prepared as follows. As a vector for expression, pKK233-2 (Centralbureau room Schmelculures (CBS), Netherlands; http://www.cbs.knaw.nl/) was used. pKK233-2 (5 μl) was digested with HindIII (1 μl) and then purified by phenol extraction, chloroform extraction and ethanol precipitation. The ends were subjected to a blunting treatment using DNA Blunting Kit (Takara Bio Inc.). The treatment solution was purified again by phenol extraction, chloroform extraction and ethanol precipitation. The purified expression vector (5 μl) was dephosphorylated using Shrimp Alkaline Phosphatase (Takara Bio Inc.). The treatment solution was purified again by ethanol precipitation. Purified vector-DNA (5 μl), annealed Sse8387I phosphorylated linker-pSse8387I (Takara Bio) (5 μl) and solution I (DNA Ligation Kit ver. 2 (Takara Bio)) (10 μl) are mixed. To make a ligation mixture. The mixture was incubated at 16 ° C. for 12 hours to combine the linker and vector. E. coli JM109 strain was transformed by the same operation as in step (4). The recombinant vector was recovered from the grown colonies. The recovered recombinant vector was subjected to Sse8387I digestion reaction, and pKK233-2 (+ Sse) was confirmed to be digested linearly. pKK233-2 (+ Sse) was digested with restriction enzymes NcoI and Sse8387I, and then purified by phenol extraction, chloroform extraction and ethanol precipitation.

(7) Preparation of hydroxynitrile lyase expression plasmid and hydroxynitrile lyase expression transformed (introduced) body containing the plasmid Hydroxynitrile lyase gene DNA fragment (5 μl) obtained by the method of step (5) ) And the expression vector-pKK233-2 (+ Sse) (5 μl) prepared by the method of step (6). Solution I (DNA Ligation Kit ver. 2 (Takara Bio Inc.)) (10 μl) was added to the mixture to prepare a ligation mixture. This mixture was incubated at 16 ° C. for 12 hours to combine the linker and the vector. E. coli strain JM109 was transformed by the same operation as in step (4), and the recombinant vector was recovered from the growth colony. A recombinant vector in which the hydroxynitrile lyase gene DNA fragment was correctly ligated to the expression vector was confirmed, and designated as the hydroxynitrile lyase expression recombinant vector pOXN103. At the same time, a hydroxynitrile lyase expression transformed (introduced) body, JM109 / pOXN103 was obtained.

[Adjustment Example 2]
[Preparation of aqueous solution of (S) -hydroxynitrile lyase]
An Erlenmeyer flask containing 100 ml of a medium (2% Polypeptone N manufactured by Nippon Pharmaceutical Co., Ltd., 0.5% yeast extract manufactured by Oriental Yeast Co., Ltd., 0.15% dipotassium hydrogen phosphate, 0.1 g / L ampicillin sodium, 1 mM IPTG) 20 were prepared. The transformed (introduced) body JM109 / pOXN103 obtained in Preparation Example 1 was inoculated and cultured at 37 ° C. overnight. The enzyme activity of the culture solution was measured by the method described in JP-T-11-508775 and found to be 4.77 units / mL. Centrifugation (3,700 × g, 10 minutes, 4 ° C.) of 2 L of this culture broth collects the bacterial cells, and 80 mL of a pH 6.0 buffer solution containing 20 mM citric acid and 70 mM disodium hydrogen phosphate is added. A cell suspension of was obtained. This cell suspension was treated twice with a French press (French Press 5502 5615L, 1000 kg / cm ² , manufactured by Otake Seisakusho Co., Ltd.) to crush the cells. Thereafter, the supernatant was collected by centrifugation (10,000 × g, 10 minutes, 4 ° C.) to obtain 60 mL of an (S) -hydroxynitrile lyase aqueous solution having an enzyme activity of 130 units / mL.

[Example 1]
(1) Synthesis of (S) -Mandelonitrile Mixing 25.4 mL (3302 units) of the (S) -hydroxynitrile lyase aqueous solution obtained in Preparation Example 2 and 120.8 mL of t-butyl methyl ether, 3.5 g of HCN (0.1295 mol) was added. Next, 4 g (0.0377 mol) of benzaldehyde was added while sufficiently stirring the mixture at 16 to 18 ° C. Ten minutes after the addition, the concentration of benzaldehyde in the reaction system was measured by HPLC. As a result, it was 0.063 mol / kg (consuming 3.18 g of benzaldehyde per 10 minutes). Furthermore, while maintaining the inside of the reaction system at 16 to 18 ° C., HCN and benzaldehyde were added for 3 hours and 20 minutes at a ratio of 0.8 g of HCN (0.0296 mol) and 3 g of benzaldehyde (0.0283 mol) per 10 minutes. And continuously dripped. After completion of the dropwise addition, the reaction system was maintained at 16-18 ° C. for 1 hour and sufficiently stirred. Table 2 shows the results of monitoring the benzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of mandelonitrile was 39.5% by weight, and its optical purity was an excess of S form of 98.5% ee.

[Example 2]
(1) Synthesis of (S) -Mandelonitrile 44.6 mL (5798 units) of the (S) -hydroxynitrile lyase aqueous solution obtained in Preparation Example 2 and 120.8 mL of t-butyl methyl ether were mixed to obtain 5.0 g of HCN. (0.185 mol) was added. Then, 1.45 g (0.0537 mol) of HCN and 5.55 g (0.0523 mol) of benzaldehyde were added while sufficiently stirring the mixture at 6-8 ° C. Ten minutes after the addition, the benzaldehyde concentration in the reaction system was measured by HPLC. As a result, it was 0.060 mol / kg (4.65 g of benzaldehyde consumed per 10 minutes). Further, while maintaining the inside of the reaction system at 6-8 ° C. and sufficiently stirring, HCN and benzaldehyde were added at a ratio of 1.5 g (0.0556 mol) of HCN and 4.5 g (0.0424 mol) of benzaldehyde per 10 minutes for 20 hours. It was dripped continuously over a period of minutes. After completion of the dropwise addition, the reaction system was maintained at 6-8 ° C. for 1 hour and sufficiently stirred. Table 3 shows the results of monitoring the benzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of mandelonitrile was 45.0% by weight, and its optical purity was an excess of S form of 98.0% ee.

(2) Concentration of (S) -mandelonitrile 0.4 g of 98% sulfuric acid was added to 261 g of the reaction solution obtained in (1) of Example 2, and then concentrated with an evaporator. 130.5 g of a solution containing 90% by weight of mandelonitrile (yield 98% from benzaldehyde) was obtained. The concentrated mandelonitrile solution contained a precipitate insoluble in water and organic solvents.

[Example 3]
(1) Synthesis of (S) -mandelonitrile 25.4 mL (3302 units) of the (S) -hydroxynitrile lyase aqueous solution obtained in Preparation Example 2 and 120.8 mL of t-butyl methyl ether were mixed to obtain 24.3 g of HCN. (0.9 mol) was added. Next, 64 g (0.603 mol) of benzaldehyde was added dropwise over 3 hours and 30 minutes while sufficiently stirring the mixture at 16 to 18 ° C. After completion of the dropwise addition, the reaction system was maintained at 16-18 ° C. for 1 hour and sufficiently stirred. The results of monitoring the benzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system are shown in Table 4.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of mandelonitrile was 37.5% by weight, and its optical purity was an excess of S form of 97.7% ee.

[Example 4]
(1) Synthesis of (R) -2-chloromandelonitrile 24.3 mg (13200 units) of (R) -hydroxynitrile lyase (Sigma, MO646 (registered trademark)) derived from Almond (Prunus amygdalus) was added to 50 mM citric acid. It was dissolved in 25 mL of buffer solution (pH 5.0). Next, 140 mL of t-butyl methyl ether was mixed with this, and 3 g (0.111 mol) of HCN was added. While this mixture was sufficiently stirred at 26 to 28 ° C., 1.3 g (0.048 mol) of HCN and 5.3 g (0.0377 mol) of 2-chlorobenzaldehyde were added. Ten minutes after the addition, the concentration of 2-chlorobenzaldehyde in the reaction system was measured by HPLC, which was 0.057 mol / kg (4.2 g of 2-chlorobenzaldehyde was consumed per 10 minutes). Further, while maintaining the inside of the reaction system at 26 to 28 ° C., 3% of HCN and 2-chlorobenzaldehyde were mixed at a ratio of 1 g (0.037 mol) of HCN and 4 g (0.0284 mol) of 2-chlorobenzaldehyde per 10 minutes. It was dripped continuously over 20 minutes. After completion of the dropwise addition, the reaction system was maintained at 26 to 28 ° C. for 1 hour and sufficiently stirred. The results of monitoring 2-chlorobenzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system are shown in Table 5.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of 2-chloromandelonitrile was 41.4% by weight, and the optical purity was an excess of R form of 91.5% ee.

(2) Hydrolysis of (R) -2-chloromandelonitrile 0.4 g of 98% sulfuric acid was added to 238 g of the reaction solution obtained in (1) of Example 4, followed by concentration with an evaporator. 109.5 g of a solution containing 90% by weight of 2-chloromandelonitrile (87% yield from 2-chlorobenzaldehyde) was obtained. The concentrated 2-chloromandelonitrile solution contained a precipitate insoluble in water and organic solvents. Then, 109.5 g of the concentrated 2-chloromandelonitrile solution was added dropwise to 97 g of 35% hydrochloric acid while stirring at 30 to 35 ° C. for 17 hours. This reaction solution was a slurry. When the reaction solution after stirring for 17 hours was analyzed by HPLC, 2-chloromandelonitrile was not detected and 2-chloromandelamide and 2-chloromandelic acid were mixed. 213 g of water was added to the total amount of the reaction solution after stirring for 17 hours, and hydrolysis was carried out by stirring at 75 ° C. for 2 hours. This reaction solution was homogeneous. When the reaction solution after stirring at 75 ° C. for 2 hours was analyzed by HPLC, 2-chloromandelonitrile and 2-chloromandelamide were not detected. The concentration of 2-chloromandelic acid was 26.8% (93% yield from 2-chloromandelonitrile), and the optical purity was 91.5% ee excess of R form. This reaction solution was slightly brown and Hazen color number was 250-300.

(3) Decolorization of the hydrolysis reaction solution with activated carbon To the 419.5 g hydrolysis reaction solution obtained in (2) of Example 4, 8 g of activated carbon (Kuraray P-60W5; moisture content 50%) was added. Stir for 2 hours at ° C. Thereafter, the activated carbon was filtered off, and the degree of coloration was measured with a colorimetric tube. The Hazen color number was 150-200.

[Example 5]
Hydrolysis of (S) -mandelonitrile While stirring at 30 to 35 ° C. for 17 hours, 130.5 g of the mandelonitrile solution obtained in (1) of Example 2 was added dropwise to 146 g of 35% hydrochloric acid. This reaction solution was a slurry. When the reaction solution after stirring for 17 hours was analyzed by HPLC, mandelonitrile was not detected and mandelamide and mandelic acid were mixed. 319 g of water was added to the total amount of the reaction solution after stirring for 17 hours, followed by hydrolysis at 75 ° C. for 2 hours. This reaction solution was homogeneous. When the reaction solution after stirring at 75 ° C. for 2 hours was analyzed by HPLC, mandelonitrile and mandelamide were not detected, and the concentration of mandelic acid was 21.3% (yield from mandelonitrile 94.5%). %), And the optical purity was an excess of the S form of 98.0% ee. The reaction solution was slightly brown, and the degree of coloration was measured with a colorimetric tube. The Hazen color number was 200-250.

[Example 6] Decolorization of the hydrolysis reaction solution with activated carbon (3) of Example 4 except that the hydrolysis reaction solution was changed to 595 g of the hydrolysis reaction solution containing mandelic acid obtained in Example 5 and 12 g of activated carbon. As well as. The Hazen color number was 80-100.

[Example 7] Recovery of (S) -mandelic acid crystals from hydrolysis reaction solution Of the hydrolysis reaction solution after decolorization obtained in Example 6, 590 g was obtained at a cooling rate of 60 ° C to 5 ° C / hour. The solution was cooled to 0 ° C. to precipitate crystals. The crystals were separated by filtration, washed with 10 ° C. water, and dried. As a result, 114.5 g of white mandelic acid crystals were obtained. The chemical purity was 97.0% (including R-form), and the optical purity was 99.5% ee.

[Comparative Example 1]
Synthesis of (S) -mandelonitrile A mixture of 25.4 mL (3302 units) of the (S) -hydroxynitrile lyase aqueous solution obtained in Preparation Example 2 and 120.8 mL of t-butyl methyl ether was mixed with 64 g of benzaldehyde (0 .603 mol) was added. Next, 24.3 g (0.9 mol) of HCN was added dropwise over 3 hours and 30 minutes while sufficiently stirring the mixture at 16 to 18 ° C. After completion of the dropwise addition, the reaction system was maintained at 16-18 ° C. for 1 hour and sufficiently stirred. The results of monitoring the benzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system are shown in Table 6.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of mandelonitrile was 27.7% by weight, and its optical purity was an excess of S form of 77.5% ee.

[Comparative Example 2]
Synthesis of (S) -mandelonitrile Example 1 except that HCN and benzaldehyde were continuously added dropwise over a period of 1 hour and 45 minutes at a ratio of 2 g HCN (0.074 mol) and 6 g (0.0565 mol) benzaldehyde per 10 minutes. The same was done. After completion of the dropwise addition of HCN and benzaldehyde, the mixture was sufficiently stirred for 2 hours and 45 minutes. Table 7 shows the results of monitoring the benzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of mandelonitrile was 29.6% by weight, and its optical purity was an excess of S form of 83.1% ee.

[Comparative Example 3]
Synthesis of (R) -2-chloromandelonitrile HCN and benzaldehyde were continuously added dropwise over a period of 1 hour and 45 minutes at a ratio of 2 g (0.074 mol) of HCN and 8 g (0.0569 mol) of 2-chlorobenzaldehyde per 10 minutes. Otherwise, the same procedure as in Example 4 (1) was performed. After completion of the dropwise addition of HCN and 2-chlorobenzaldehyde, the mixture was sufficiently stirred for 2 hours and 45 minutes. Table 8 shows the results of monitoring the 2-chlorobenzaldehyde concentration (measured by HPLC) and HCN concentration (measured by titration) in the reaction system.

  After completion of the reaction, the reaction solution was analyzed by HPLC. As a result, the concentration of 2-chloromandelonitrile was 27.9% by weight, and its optical purity was 81.4% ee excess of R form.

It is the figure which represented typically the positional relationship of 20 types of oligonucleotide F01-F10 and R01-R10 (sequence number 3-22) used for preparation of the wild-type hydroxy nitrile lyase gene by PCR.

Sequence number 3-24: Synthetic DNA

Claims (4)

In a method for producing an optically active cyanohydrin by an enzymatic reaction using an aromatic aldehyde and HCN as substrates and in the presence of an organic solvent substantially immiscible with water,
Using a hydroxynitrile lyase prepared using genetically modified Escherichia coli as an enzyme, the reaction temperature is a state where the molar concentration of aromatic aldehyde in the reaction solution is 0.4 mol / kg or less and the molar concentration of HCN or less. By sequentially adding aromatic aldehyde and HCN at −10 to 40 ° C. and pH 4.0 to 7.0 for 2 hours or more, optical purity 90% e.e. e. A method for producing an optically active cyanohydrin, characterized by accumulating 37.5% by mass or more of the above optically active cyanohydrin in a reaction system.   The process according to claim 1, wherein the aromatic aldehyde is benzaldehyde, o-chlorobenzaldehyde, m-chlorobenzaldehyde or p-chlorobenzaldehyde.   A method for producing an optically active α-hydroxycarboxylic acid, comprising hydrolyzing the optically active cyanohydrin obtained by the method according to claim 1. The method according to claim 3, further comprising contacting the solution containing optically active α-hydroxycarboxylic acid with activated carbon, followed by concentration and / or cooling crystallization.

Images