JP2001348356A - METHOD FOR PRODUCING OPTICALLY ACTIVE alpha- HYDROXYCARBOXYLIC ACID - Google Patents

Abstract

PROBLEM TO BE SOLVED: To industrially and economically produce an optically active α- hydroxycarboxylic acid. SOLUTION: This method for producing an optically active α- hydroxycarboxylic acid is to produce an optically active cyanohydrin by reacting a carbonyl compound with hydrogen cyanide by using at least one species of organic solvent selected from a group comprising alcohol-based solvents, ester- based solvents, ether-based solvents and carboxylic acid-based solvents subsequently remove the aforesaid organic solvent in the aforesaid reaction medium and carry out a hydrolysis without isolating the optically active cyanohydrin.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for efficiently producing an optically active α-hydroxycarboxylic acid useful as a pharmaceutical intermediate or the like.

[0002]

2. Description of the Related Art Conventionally, optically active α-hydroxycarboxylic acids are prepared by adding a corresponding carbonyl compound to an organic solvent such as an alcohol solvent, an ester solvent, an ether solvent, a carboxylic acid solvent, or a hydrocarbon solvent. Asymmetric addition of hydrogen cyanide in the presence of enzymes such as (S) -hydroxynitrile lyase, (R) -hydroxynitrile lyase, or enzymes produced by genetically modified microorganisms incorporating the genes of these enzymes To obtain an optically active cyanohydrin, and then hydrolyze it (for example, Synthesis, July 1990,
575-578; Tetrahedron Letters, 32 , 2605-2608 (199
1); JP-A-63-219388; JP-A-5-3170
No. 65; WO 98/30711).

In these methods, the optically active cyanohydrin is isolated and then hydrolyzed, or in consideration of efficiency,
Hydrolysis occurs without removing the reaction solvent used in the optically active cyanohydrin production process.

[0004]

SUMMARY OF THE INVENTION An object of the present invention is to provide a process for producing an optically active α-hydroxycarboxylic acid which is industrially advantageous.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies with the aim of improving the yield and optical purity of optically active α-hydroxycarboxylic acid. When using an alcohol solvent, an ester solvent, an ether solvent or a carboxylic acid solvent as a solvent, after removing the solvent,
By hydrolysis, it has been found that both the yield and the optical purity of the optically active α-hydroxycarboxylic acid are improved as compared with the case of hydrolysis without such removal, leading to the completion of the present invention. Was. The present invention includes the following inventions.

(1) A carbonyl compound is reacted with hydrogen cyanide using a solvent containing at least one organic solvent selected from the group consisting of alcohol solvents, ester solvents, ether solvents and carboxylic acid solvents. After producing the optically active cyanohydrin, after removing the organic solvent in the reaction solvent, without isolating the optically active cyanohydrin, a method for producing an optically active α-hydroxycarboxylic acid, comprising performing a hydrolysis reaction . (2) The method according to (1), wherein the content of the organic solvent in the reaction mixture subjected to the hydrolysis reaction is less than 10% by weight. (3) The method according to (1) or (2), wherein the hydrolysis reaction is performed using a mineral acid.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION The method of the present invention relates to an optically active α-hydroxycarboxylic acid derived from an alcohol-based solvent, an ester-based solvent, an ether-based solvent and / or a carboxylic acid-based solvent used in the process for producing optically active cyanohydrin. The production process of the optically active cyanohydrin is not particularly limited as long as these solvents are used as a reaction solvent.

The process for producing optically active cyanohydrin includes, for example, the following formula (I):

## STR1 ## R¹-CO-R² (I) (wherein, R¹And R²Are different from each other,
Represents a monovalent hydrocarbon group having 22 or less carbon atoms,
In the hydrocarbon group, -CH₂-And -CH₃CH₂Is
A carbonyl group, a sulfonyl group, -O- or -S-
May be replaced, = CH₂Is set to = O or = S
May be replaced with₂-CH of-, -C
H₃Of CH, CH of> CH-, CH of CH =
= CH ₂Is replaced by N or C-halogen
And R¹And R²Are jointly
It may represent an asymmetric divalent group. Carbo indicated by)
Nyl compounds are extracted from plants in the above organic solvents
(S) -hydroxynitrile lyase, (R) -hydro
Enzymes such as xinitrile lyase or the rest of these enzymes
Produced by genetically modified microorganisms incorporating the gene
Activity by asymmetric addition of hydrogen cyanide in the presence of an enzyme
A step of obtaining cyanohydrin (for example, Synt
hesis, July 1990, 575-578; Tetrahedron Letters,Three
Two, 2605-2608 (1991); JP-A-63-219388;
JP-A-5-317065; JP-A-9-227488
Gazette, WO 98/30711).

In the above formula (I), a monovalent hydrocarbon group having 22 or less carbon atoms means a linear or branched chain hydrocarbon group, a monocyclic hydrocarbon having no side chain or having a side chain. A hydrogen group, a polycyclic hydrocarbon group having no side chain or having a side chain, a spiro hydrocarbon group having no side chain or having a side chain, a hydrocarbon group having a ring assembly structure having no side chain or having a side chain, Alternatively, it includes any of the chain hydrocarbon groups substituted by the above-mentioned cyclic hydrocarbon groups. Further, it includes both a saturated hydrocarbon group and an unsaturated hydrocarbon group.
A group containing an allene structure of ＣC ＝ C is excluded. Examples of the linear or branched chain hydrocarbon group include, for example, a saturated chain hydrocarbon group, a linear alkyl group having 1 or more carbon atoms, a branched alkyl group having 3 or more carbon atoms, and an unsaturated Straight chain alkenyl group having 2 or more carbon atoms,
The above branched alkenyl group, a linear alkynyl group having 3 or more carbon atoms, a branched alkynyl group having 4 or more carbon atoms, a straight-chain alkadienyl group having 4 or more carbon atoms, a branched alkadienyl group having 5 or more carbon atoms, etc. Examples can be given. Examples of the monocyclic hydrocarbon group include, for example, a saturated monocyclic hydrocarbon group, a cycloalkyl group having 3 or more carbon atoms without a side chain, a cycloalkyl group having a total of 4 or more carbon atoms and a side chain. A saturated monocyclic hydrocarbon group, a cycloalkenyl group having no side chain having 4 or more carbon atoms, a cycloalkynyl group having a side chain having 5 or more carbon atoms, a cycloalkadi group having no side chain having 5 or more carbon atoms. Examples thereof include an enyl group and a cycloalkadienyl group having a side chain having a total carbon number of 6 or more. As the unsaturated monocyclic or polycyclic hydrocarbon group, an aromatic hydrocarbon group, for example, a phenyl group, a 1-naphthyl group, a 2-naphthyl group, a 9-anthryl group or the like having 6 to 22 carbon atoms in total. An aromatic group having no chain, an aromatic group having a total number of carbon atoms of 7 or more, and a phenylphenyl group having 12 carbon atoms, which is also a hydrocarbon group having a ring assembly structure, and a side chain having a total number of 13 or more carbon atoms A phenylphenyl group having a group can be exemplified. Examples of the polycyclic hydrocarbon group include a condensed cyclic hydrocarbon group having 6 or more carbon atoms without side chains, a condensed cyclic hydrocarbon group having 7 or more total carbon atoms with side chains, and a side chain having 7 or more carbon atoms. Cross-linked cyclic hydrocarbon group having no chain, cross-linked cyclic hydrocarbon group having side chains having a total of 8 or more carbon atoms, spiro hydrocarbon group having no side chain having a total of 9 or more carbon atoms, side chain having a total of 10 or more carbon atoms Spiro hydrocarbon group having the same can be exemplified. In the above-mentioned condensed cyclic hydrocarbon group having no side chain, when one of the condensed rings is a benzene ring, those having a total carbon number of 9 or more can be mentioned. In the condensed cyclic hydrocarbon group, when one of the condensed rings is a benzene ring,
Those having a total carbon number of 10 or more can be given. Examples of the hydrocarbon group having a ring assembly structure include a cycloalkylcycloalkyl group having 6 or more total carbon atoms without side chains, a cycloalkylcycloalkyl group having 7 or more total carbon atoms and side chains having 6 or more total carbon atoms. And a cycloalkylidenecycloalkyl group having no side chain and a side chain having 7 or more carbon atoms in total. In these cyclic hydrocarbons, having a side chain means that a cyclic hydrocarbon group is substituted on the ring. Examples of the above-mentioned chain hydrocarbon group substituted by the cyclic hydrocarbon group include a straight-chain alkyl group substituted by an aromatic group having no side chain having a total carbon number of 7 or more, and a side chain having a total carbon number of 8 or more. A linear alkyl group substituted with a certain aromatic group, having 9 carbon atoms
A branched alkyl group substituted with an aromatic group having no side chain, a branched alkyl group substituted with an aromatic group having a total of 10 or more carbon atoms, and no side chain having a total of 8 or more carbon atoms A straight-chain alkenyl group substituted with an aromatic group, a straight-chain alkenyl group substituted with an aromatic group having a total number of carbon atoms of 9 or more, and an aromatic group having no total side chains of 9 or more carbon atoms. A substituted branched alkenyl group, a branched alkenyl group substituted with an aromatic group having a total number of carbon atoms of 10 or more, a straight chain substituted with an aromatic group having a total number of 8 or more carbon atoms without a side chain. Alkynyl group, linear alkynyl group substituted with an aromatic group having a total number of carbon atoms of 9 or more, branched alkynyl group substituted with an aromatic group having a total number of not less than 10 carbon atoms, total carbon number Number 11
A branched alkynyl group substituted with an aromatic group having a side chain, a linear alkadienyl group substituted with an aromatic group having no side chain having 10 or more carbon atoms, and a side chain having a total carbon atom of 11 or more. A straight-chain alkadienyl group substituted with an aromatic group,
A branched alkadienyl group substituted with an aromatic group having no side chain having 11 or more carbon atoms, a branched alkadienyl group substituted with an aromatic group having a side chain having 12 or more carbon atoms, having 4 or more carbon atoms A linear alkyl group substituted with a cycloalkyl group having no side chain, a linear alkyl group substituted with a cycloalkyl group having a total of 5 or more carbon atoms, no side chain having a total of 6 or more carbon atoms A branched alkyl group substituted with a cycloalkyl group, a branched alkyl group substituted with a cycloalkyl group having a total number of carbon atoms of 7 or more, or a substituted or unsubstituted cycloalkyl group having a total number of carbon atoms of 5 or more. Linear alkenyl group, straight-chain alkenyl group substituted by a cycloalkyl group having 6 or more total carbon atoms, branched alkenyl substituted by a cycloalkyl group having 6 or more total carbon atoms and no side chain Group, total carbon number 7 or less A branched alkenyl group substituted with a cycloalkyl group having a side chain, a linear alkynyl group substituted with a cycloalkyl group having no total side chain having 5 or more carbon atoms, and a side chain having a total carbon number of 6 or more A straight-chain alkynyl group substituted by a cycloalkyl group, a branched alkynyl group substituted by a cycloalkyl group having no total side chain having 7 or more carbon atoms, or a cycloalkyl group having a total side chain having 8 or more carbon atoms Branched alkynyl group, branched alkadienyl group substituted by unsubstituted cycloalkyl group having 8 or more total carbon atoms, branched alkadienyl group substituted by cycloalkyl group having 9 or more total carbon atoms And the like.

In the following, an aromatic group having no side chain, an aromatic group having a side chain, and a phenylphenyl group or a phenylphenyl group having a side chain are collectively referred to as an aryl group. A linear or branched alkyl group substituted with a group is called an aralkyl group. Regarding other cyclic hydrocarbon groups, unless otherwise specified, in the case of referring to those having no side chain on the ring and those having a side chain, simply use the name such as cycloalkyl group. When a chain hydrocarbon group refers to both a straight-chain hydrocarbon group and a branched hydrocarbon group, a name such as an alkyl group is simply used.

When -CH ₂ -is replaced with a carbonyl group, a sulfonyl group, -O- or -S- in the above hydrocarbon group, a ketone, sulfone, ether or thioether structure is introduced, respectively, and -CH ₃ is -CH ₂ - carbonyl group and replaced by -O- or -S-, respectively formyl (aldehyde), changes to a hydroxyl group or a mercapto group, or, when replacing the terminal = CH ₂ is = O or = S, It means that a ketone or thioketone structure is introduced. When CH of —CH ₂ — changes to N, it becomes —NH—, and when CH of> CH— changes to N,> N -, And CH of CH = is changed to N,
= N-, and the the CH of -CH ₃ terminal is changed to N, -NH ₂ is introduced, = CH of CH ₂ is the change in N, a = NH. In _{addition, -CH 3, -CH 2 -,} =
When CH of CH-, ≡CH or> CH- is replaced by C-halogen, a halogen atom is substituted on the carbon. In addition, -O-, -S in a carbon chain
The substitution with-or N corresponds to oxa substitution, thia substitution, or aza substitution, respectively, with respect to the hydrocarbon group. For example, when occurring at a skeletal carbon of a hydrocarbon ring, an oxygen-containing heterocyclic ring, a hydrocarbon ring-containing or Conversion to sulfur heterocycle and nitrogen-containing heterocycle. CH _{2 and} C—H in the hydrocarbon group
May be performed independently of each other. In addition, after performing the above-mentioned substitution, C
When H ₂ or the C-H remains may be made further replaced. Furthermore, by the above replacement, -CH ₂
Conversion of —CH ₃ to —CO—O—H; carboxylic acid structure is also performed.

In the present specification, a halogen atom refers to a fluorine atom, a chlorine atom, a bromine atom and an iodine atom.
Fluorine, chlorine and bromine are preferred. Therefore,
As the hydrocarbon group, any of a chain hydrocarbon group and a hydrocarbon group having a ring structure such as a cyclic hydrocarbon group can be selected, for example, a linear or branched saturated chain hydrocarbon group. Alkyl groups, linear or branched alkenyl groups that are unsaturated chain hydrocarbon groups, linear or branched alkynyl groups, linear or branched alkadienyl groups,
Aryl and aralkyl groups that are aromatic hydrocarbon groups such as cycloalkyl groups that are saturated cyclic hydrocarbon groups, cycloalkenyl groups, cycloalkynyl groups, and cycloalkadienyl groups that are unsaturated cyclic hydrocarbon groups And an arylalkenyl group.

More specifically, examples of the linear or branched alkyl group include a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a 1-methylpropyl group, a pentyl group, a 1-methylbutyl group, Hexyl group, 1
-Methylpentyl, heptyl, 1-methylhexyl, 1-ethylpentyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, 2-methylpropyl, 2-methylbutyl Group, 3-methylbutyl group, 2-methylpentyl group, 3
-Methylpentyl group, 4-methylpentyl group, methylhexyl group, methylheptyl group, methyloctyl group, methylnonyl group, 1,1-dimethylethyl group, 1,1-dimethylpropyl group, 2,6-dimethylheptyl group, 3,7
-Dimethyloctyl group, 2-ethylhexyl group and the like, cycloalkylalkyl groups such as cyclopentylmethyl group and cyclohexylmethyl group, and cycloalkyl groups such as cyclopropyl group, cyclobutyl group, cyclopentyl group, methylcyclopentyl group and cyclohexyl group; Examples of the bicycloalkyl group such as a methylcyclohexyl group, a cycloheptyl group, and a cyclooctyl group include a norbornyl group, a bicyclo [2.2.2] octyl group, and an adamantyl group. Examples of the linear or branched alkenyl group include a cycloalkenyl group and a cycloalkadienyl group such as a vinyl group, an allyl group, a crotyl group (2-butenyl group), and an isopropenyl group (1-methylvinyl group). Examples thereof include a cyclopentenyl group, a cyclopentadienyl group, a cyclohexenyl group, a cyclohexanedienyl group and the like. Examples of the linear or branched alkynyl group include an ethynyl group, a propynyl group,
Butynyl group and the like. Examples of the aryl group include a phenyl group, a 1-naphthyl group, a 2-naphthyl group,
-Phenylphenyl group, 3-phenylphenyl group, 4-
Examples include a phenylphenyl group, a 9-anthryl group, a methylphenyl group, a dimethylphenyl group, a trimethylphenyl group, an ethylphenyl group, a methylethylphenyl group, a diethylphenyl group, a propylphenyl group, and a butylphenyl group. Examples of the aralkyl group include benzyl, 1-naphthylmethyl, 2-naphthylmethyl, phenethyl (2-phenylethyl), 1-phenylethyl, phenylpropyl, phenylbutyl, phenylpentyl, and phenyl. Examples include a hexyl group, a methylbenzyl group, a methylphenethyl group, a dimethylbenzyl group, a dimethylphenethyl group, a trimethylbenzyl group, an ethylbenzyl group, and a diethylbenzyl group. Examples of the arylalkenyl group include a styryl group, a methylstyryl group, an ethylstyryl group, a dimethylstyryl group,
And a phenyl-2-propenyl group.

CH ₂ in the hydrocarbon group is a carbonyl group, a sulfonyl group, O or S, or CH is N or C
-As the group replaced with halogen, ketone, aldehyde, carboxylic acid, sulfone, ether, thioether, amine, alcohol, thiol, halogen, heterocycle (for example, oxygen-containing heterocycle, sulfur-containing heterocycle, nitrogen-containing heterocycle) And a group containing one or more structures. In addition,
The term "oxygen-containing heterocycle, sulfur-containing heterocycle and nitrogen-containing heterocycle" means those in which the carbon of the ring skeleton of the cyclic hydrocarbon group is replaced with oxygen, sulfur or nitrogen, respectively. There may be more than one heterocycle. Examples of the substituted hydrocarbon group include an acetylmethyl group and an acetylphenyl group having a ketone structure; a methanesulfonylmethyl group having a sulfone structure; a methoxymethyl group, a methoxyethyl group, an ethoxyethyl group, and a methoxypropyl group having an ether structure. , Butoxyethyl group, ethoxyethoxyethyl group, methoxyphenyl group, dimethoxyphenyl group,
Phenoxymethyl group; thioether structure methylthiomethyl group, methylthiophenyl group; amine structure aminomethyl group, 2-aminoethyl group, 2-aminopropyl group,
3-aminopropyl group, 2,3-diaminopropyl group,
2-aminobutyl group, 3-aminobutyl group, 4-aminobutyl group, 2,3-diaminobutyl group, 2,4-diaminobutyl group, 3,4-diaminobutyl group, 2,3,4-
Triaminobutyl, methylaminomethyl, dimethylaminomethyl, methylaminoethyl, propylaminomethyl, cyclopentylaminomethyl, aminophenyl, diaminophenyl, aminomethylphenyl; oxygen-containing heterocyclic tetrahydrofuranyl Group, tetrahydropyranyl group, morpholylethyl group; furyl group, furfuryl group, benzofuryl group, benzofurfuryl group of oxygen-containing heteroaromatic ring; thienyl group of sulfur-containing heteroaromatic ring; pyrrolyl group of nitrogen-containing heteroaromatic ring, imidazolyl group , Oxazolyl group, thiadiazolyl group, pyridyl group, pyrimidinyl group, pyridazinyl group, pyrazinyl group, tetrazinyl group,
Quinolyl group, isoquinolyl group, pyridylmethyl group; 2-hydroxyethyl group, 2-hydroxypropyl group, 3-hydroxypropyl group, 2,3-dihydroxypropyl group, 2-hydroxybutyl group, 3-hydroxybutyl group having an alcohol structure , 4-hydroxybutyl group, 2,3-
Dihydroxybutyl, 2,4-dihydroxybutyl, 3,4-dihydroxybutyl, 2,3,4-trihydroxybutyl, hydroxyphenyl, dihydroxyphenyl, hydroxymethylphenyl, hydroxyethylphenyl; thiol 2-mercaptoethyl group, 2-mercaptopropyl group, 3-mercaptopropyl group, 2,3-dimercaptopropyl group, 2-mercaptobutyl group, 3-mercaptobutyl group, 4-mercaptobutyl group, mercaptophenyl group A halogenated hydrocarbon group, 2-chloroethyl group, 2-chloropropyl group, 3-chloropropyl group, 2-chlorobutyl group, 3
-Chlorobutyl group, 4-chlorobutyl group, fluorophenyl group, chlorophenyl group, bromophenyl group, difluorophenyl group, dichlorophenyl group, dibromophenyl group, chlorofluorophenyl group, trifluorophenyl group, trichlorophenyl group, fluoromethylphenyl group, Trifluoromethylphenyl group; 2-amino-3-hydroxypropyl group, 3-amino-2-hydroxypropyl group, 2-amino-3-hydroxybutyl group, 3-amino-2-hydroxyl having an amine structure and an alcohol structure Butyl group, 2-amino-4-hydroxybutyl group, 4-amino-2-hydroxybutyl group, 3-amino-4-hydroxybutyl group, 4-amino-3-hydroxybutyl group, 2,4-diamino-3 -Hydroxybutyl group, 3-amino-2 4-dihydroxy-butyl group, 2,
3-diamino-4-hydroxybutyl group, 4-amino-
2,3-dihydroxybutyl group, 3,4-diamino-2
-Hydroxybutyl group, 2-amino-3,4-dihydroxybutyl group, aminohydroxyphenyl group; fluorohydroxyphenyl group, chlorohydroxyphenyl group which is a hydrocarbon group substituted by halogen and hydroxyl group; carboxyphenyl group having a carboxylic structure And the like.

The asymmetric divalent group represented by R ¹ and R ² is not particularly limited. For example, norbornane-2
-Ylidene and 2-norbornene-5-ylidene.

Examples of the carbonyl compound represented by the formula (I) include benzaldehyde, m-phenoxybenzaldehyde, p-methylbenzaldehyde, o-
Aromatic aldehydes such as chlorobenzaldehyde, m-chlorobenzaldehyde, p-chlorobenzaldehyde, m-nitrobenzaldehyde, 3,4-methylenedioxybenzaldehyde, 2,3-methylenedioxybenzaldehyde, phenylacetaldehyde, and furfural; acetaldehyde, butyraldehyde Aliphatic aldehydes such as isobutyl aldehyde, valeraldehyde, cyclohexane aldehyde; ethyl methyl ketone, butyl methyl ketone, methyl propyl ketone, isopropyl methyl ketone, methyl pentyl ketone, methyl (2-
Methylpropyl) ketone, methyl (3-methylbutyl)
Saturated aliphatic ketones such as ketones; unsaturated aliphatic ketones such as methyl (2-propenyl) ketone and (3-butenyl) methyl ketone; alkyl (haloalkyl) ketones such as (3-chloropropyl) methyl ketone; 2- (alkoxycarbonyl) 2- (protected amino) aldehydes such as amino) -3-cyclohexylpropionaldehyde; and alkylthioaliphatic aldehydes such as 3-methylthiopropionaldehyde.

In the step of producing the optically active cyanohydrin in the method of the present invention, a solvent containing at least one organic solvent selected from the group consisting of alcohol solvents, ester solvents, ether solvents and carboxylic acid solvents is used as a reaction solvent. Used.

Examples of the alcohol solvent include aliphatic alcohols such as methanol, ethanol, propanol, isopropanol, 1-butanol, 2-butanol, isobutanol, t-butanol, hexanol, n-amyl alcohol and cyclohexanol. ,
Benzyl alcohol and the like. Examples of the ester solvent include aliphatic esters such as methyl formate, methyl acetate, ethyl acetate, butyl acetate, and methyl propionate.

Examples of the ether solvent include diethyl ether, dipropyl ether, diisopropyl ether, dibutyl ether, t-butyl methyl ether,
Examples include aliphatic ethers such as dimethoxyethane and tetrahydrofuran. Examples of the carboxylic acid-based solvent include aliphatic carboxylic acids such as acetic acid.

The reaction solvent used in the present invention may be, in addition to the above solvents, n-pentane, n-hexane, cyclohexane,
Hydrocarbon solvents such as benzene, toluene and xylene, p
It may contain an aqueous buffer of H7 or less, for example, citrate buffer, phosphate buffer, acetate buffer and the like.

In the process for producing optically active cyanohydrin in the method of the present invention, when a carbonyl compound represented by the above formula (I) is used as a raw material, the following formula (II) corresponding to the compound is used:

Embedded image (Wherein, R ¹ and R ² have the same meanings as described above, and C ^* represents an asymmetric carbon atom). In the method of the present invention, the optically active cyanohydrin is obtained in the first step. Without isolating the obtained optically active cyanohydrin,
Used for the hydrolysis reaction in the second step.

In the method of the present invention, the first
The alcohol solvent, ester solvent, ether solvent and / or carboxylic acid solvent used as the reaction solvent in the step are removed. When a hydrocarbon solvent such as n-pentane, n-hexane, cyclohexane, benzene, toluene, or xylene is used together with these organic solvents, the hydrocarbon solvent does not need to be removed. Examples of the method of removing the solvent include, for example, a method of evaporating under normal pressure or reduced pressure, a method of extracting with water, and the like.
The method of evaporating under reduced pressure is preferred because it is simple and has little effect on the second step.

The removal of the reaction solvent in the first step in the present invention is carried out when the content of the alcohol-based solvent, ester-based solvent, ether-based solvent and carboxylic acid-based solvent in the reaction mixture to be subjected to the hydrolysis reaction is less than 10% by weight. And more preferably less than 5% by weight.

The hydrolysis reaction in the second step in the method of the present invention is preferably carried out using a mineral acid. Examples of the mineral acid used here include hydrochloric acid, sulfuric acid, nitric acid, boric acid, phosphoric acid, perchloric acid, and preferably hydrochloric acid.

The amount of the mineral acid used is preferably 1 to 10 equivalents to the optically active cyanohydrin contained in the reaction mixture subjected to the hydrolysis reaction. When the use amount of the mineral acid exceeds 10 equivalents to the optically active cyanohydrin, it is economically disadvantageous and the recovery rate decreases. On the other hand, when the use amount is less than 1 equivalent to the optically active cyanohydrin, the reaction becomes slow. It does not proceed sufficiently, or the optical purity of the desired optically active α-hydroxycarboxylic acid decreases. The amount of the mineral acid used is 2 to 8 with respect to the optically active cyanohydrin.
More preferably, it is equivalent.

In the hydrolysis reaction, the maximum temperature during the reaction is 40
It is preferable to carry out under conditions such that the temperature is up to 90C. When the maximum temperature during the reaction exceeds 90 ° C., by-products and coloring increase, while when the maximum temperature during the reaction is less than 40 ° C., the reaction does not proceed sufficiently, and in any case, The optical purity of the desired optically active α-hydroxycarboxylic acid decreases. The maximum temperature during the reaction is more preferably 40 to 80 ° C. Further, the reaction time during which the reaction temperature is lower than 40 ° C. is preferably 15 hours or less, and more preferably 3 hours or less.

In the hydrolysis reaction, a reaction solvent may be used, but it has no particular effect, and the yield and the optical purity may be reduced. Therefore, it is preferable not to use a solvent other than water. Further, the content of water in the reaction mixture at the start of the reaction, including the amount contained in the mineral acid used, is preferably 7 to 50 equivalents, and more preferably 10 to 40 equivalents to the optically active cyanohydrin. It is even more preferred. After completion of the reaction, in order to isolate the target α-hydroxycarboxylic acid from the reaction solution (which may be a slurry), the reaction solution is extracted with an organic solvent and, if necessary, washed with water. The solvent may be evaporated and dried.

As described above, an optically active α-hydroxycarboxylic acid can be produced by converting the cyano group of the optically active cyanohydrin into a carboxyl group while maintaining the configuration of the optically active cyanohydrin.

[0029]

EXAMPLES The present invention will be described below with reference to examples and comparative examples, but the present invention is not limited to the following examples. (Preparation Example 1) Preparation of S-hydroxynitrile lyase (Preparation of S-hydroxynitrile lyase) S-hydroxynitrile lyase was prepared by genetic engineering using yeast Saccharomyces cerevisiae as a host. That is, first, total mRNA was extracted from cassava leaves according to a conventional method. Next, cDNA synthesis was performed using the obtained mRNA as a template to prepare cDNA. On the other hand, literature [Arch. Bioche
m. Biophys. 311, 496-502 (1994)], the following primers were synthesized based on the sequence of the S-hydroxynitrile lyase gene derived from cassava.

Sense primer: ggggaattcatggtaactgc
acattttgttctgattc (SEQ ID NO: 1) Antisense primer: ggggtcgacctcacggattagaagcc
gccg (SEQ ID NO: 2) PCR using the synthesized primers and the above cDNA as template
(90 ° C., 30 seconds; 55 ° C., 30 seconds; 72 ° C., 60 seconds; 35 cycles in total) to obtain the S-hydroxynitrile lyase gene. When the gene sequence was analyzed, it was consistent with the sequence shown in the literature.

Next, the obtained PCR fragment was inserted into the expression vector Y.
By inserting between the Ep352-GAP promoter and terminator, the yeast episomal expression vector YEp3
52-GC was prepared. The yeast Saccharomyces cerevisiae Inv-Sc1 strain is transformed by a conventional method, and a recombinant yeast YEp352-GC- containing the expression vector YEp352-GC is selected by selecting a strain that grows in a minimal selection medium not containing uracil. S2 strain was obtained.

Next, the obtained recombinant yeast strain YEp352-G
C-S2 strain was transformed into YNBDCas liquid medium (6.7 g / L Yeast nitrogen b
By culturing in ase without amino acid (manufactured by Difco), 20 g / L glucose, 20 g / L casamino acid, 40 mg / mL L-tryptophan) for 24 hours, S-hydroxynitrile lyase was produced intracellularly. The cells were collected from the recombinant culture by centrifugation and disrupted using a bead mill. The lysate was centrifuged to prepare a crude enzyme solution, which was roughly purified by ammonium sulfate fractionation.
An S-hydroxynitrile lyase solution was used in the following experiments.

(Immobilization of S-hydroxynitrile lyase) The S-hydroxynitrile lyase prepared as described above was immobilized on Micro Bead Silica Gel 300A (manufactured by Fuji Silysia Chemical Ltd.). Immobilization of the enzyme was performed using an S-hydroxynitrile lyase solution (activity: 64 U / ml, 0.02 M
200 g of carrier is added to 1.0 L of HEPES-Na buffer (pH 6.0), and 4 ° C
For 24 hours to adsorb and immobilize the enzyme protein on the carrier.

(First Step: Optically Active Cyanohydrin Synthesis Reaction Using Immobilized Enzyme) (Example 1) Immobilized enzyme 200 was placed in a 2 L flask.
g, saturated with 10 mM phosphate buffer (pH 5.5)
-Butyl methyl ether (tBME) 1.2 L, benzaldehyde 127.2 g (2.0 mol) and hydrocyanic acid 4
9.2 g (3.0 mol) was charged and stirred at 20 ° C. for 1 hour. After completion of the reaction, the amount and optical purity of the obtained cyanohydrin were determined by analyzing the reaction solution using HPLC.

Example 2 A reaction was carried out in the same manner as in Example 1 except that ethyl acetate was used instead of tBME as a solvent.

Example 3 Benzaldehyde, hydrocyanic acid and sodium acetate were each added to a 5 L flask having a capacity of 0.1 L.
25 wt% containing M, 0.3M and 0.05M concentrations
A 5.0% aqueous methanol solution and 50 g of the immobilized enzyme were charged, and the reaction was carried out in the same manner as in Example 1.

Reference Example A reaction was carried out in the same manner as in Example 1 except that hexane was used instead of tBME as a solvent. Table 1 shows the results of the above reactions.

[0038]

[Table 1] (Second step: hydrolysis reaction) (Example 1A) After filtering the reaction solution of Example 1 to remove the immobilized enzyme, 2.3 g of paratoluenesulfonic acid monohydrate was used.
Is added and shaken, a quarter of the obtained reaction solution (corresponding to 0.5 mol of the starting material) is taken, concentrated using an evaporator until the tBME content becomes 2 wt%, and then reflux condenser is used. And transferred to a 300 mL flask with. 156 g of 35% hydrochloric acid (1.5 mol of HCl) was added thereto, and the mixture was stirred at room temperature for 1 hour, and further stirred at 70 ° C. for 5 hours. After cooling to room temperature, 175 g of ethyl acetate was added and the mixture was shaken in a separatory funnel, and then the organic layer was separated from the aqueous layer. The aqueous layer was extracted again with 175 g of ethyl acetate. The obtained organic layer was combined with the previously obtained organic layer, and washed with 50 g of water.
The organic layer thus obtained was dried under reduced pressure, washed with 80 g of toluene and dried, and 71.7 g of s-mandelic acid was obtained.
I got The purity (including the R-form) as mandelic acid was 98.8% by HPLC, and the optical purity was 99.0% e.
e.

(Example 1B) The content of tBME was 5 wt.
The reaction was carried out in the same manner as in Example 1A except that the content was changed to%.

(Example 2A) After removing the immobilized enzyme by filtering the reaction solution of Example 1, the content of ethyl acetate in the raw material was reduced to 3 wt% using one quarter of the obtained reaction solution. Then, the reaction was carried out in the same manner as in Example 1A.

(Example 2B) The content of ethyl acetate was reduced to 5 w
The reaction was carried out in the same manner as in Example 2A except that the amount was changed to t%.

(Example 3A) Using the reaction solution obtained in Example 3, filtration was performed to obtain p-toluenesulfonic acid monohydrate (0.58).
g, and the mixture was shaken. The entire amount of the obtained reaction solution was concentrated to a methanol content of 5 wt%, and the reaction was carried out in the same manner as in Example 1A.

(Reference Example) The reaction solution obtained in the reference example of the first step was filtered to remove the immobilized enzyme.
Using 1/15, the hexane content in the raw material was reduced to 15 wt%
Then, the reaction was carried out in the same manner as in Example 1A.

(Comparative Examples 1 to 4) The reaction was carried out in the same manner as in Example except that the amount of the solvent remaining in the raw material for the hydrolysis reaction was changed. Table 2 shows the results of the hydrolysis reaction.

[0045]

[Table 2] Note: The carboxylic acid yield is based on the obtained carboxylic acid (including R-form)
Was calculated from the yield and HPLC purity, and this was calculated based on the mol number of cyanohydrin (including R-form) obtained in the first step.

[0046]

According to the present invention, an optically active α-hydroxycarboxylic acid can be produced in high yield and high purity.

[0047]

[Sequence List] SEQUENCE LISTING <110> NIPPON SHOKUBAI CO., LTD. <120> The process of synthesis of optical active α-hydroxycarboxylic ac id <130> P00-0255 <160> 2 <210> 1 <211> 37 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 1 ggggaattca tggtaactgc acattttgtt ctgattc 37 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 2 ggggtcgacc tcacggatta gaagccgccg 30

[0048]

[Free text of Sequence Listing] SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA

Continuation of the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (reference) C12N 15/09 ZNA C07M 7:00 C07M 7:00 C12N 15/00 ZNAA (72) Inventor ▲ Sat ▼ ▲ Hashi ▼ Yukio 1-25-25 Kannondai, Tsukuba-shi, Ibaraki F-term (reference) of Nippon Shokubai Co., Ltd. AD16 BB15 BB17 BC10 BC19 BC31 BE01 BJ50 BN10 BS10

Claims (3)

[Claims] 1. An optical method comprising reacting a carbonyl compound with hydrogen cyanide using a solvent containing at least one organic solvent selected from the group consisting of alcohol solvents, ester solvents, ether solvents and carboxylic acid solvents. A method for producing an optically active α-hydroxycarboxylic acid, comprising: producing an active cyanohydrin, removing the organic solvent in the reaction solvent, and performing a hydrolysis reaction without isolating the optically active cyanohydrin. 2. The method according to claim 1, wherein the content of the organic solvent in the reaction mixture subjected to the hydrolysis reaction is less than 10% by weight. 3. The method according to claim 1, wherein the hydrolysis reaction is performed using a mineral acid.