JP2019129841A - Primer and method of detecting nut - Google Patents

Abstract

To provide a detection method whereby, when nuts with a risk of causing allergy (e.g. beach nut, pistachio) are contained in food raw materials, products or the like, even if their amounts are very small, they can be detected with high sensitivity, and a primer set for use in the method.SOLUTION: The present invention provides a PCR primer that has the nuts as a detection object, is specific to each object, and allows inspection under the same condition, and a method for detecting the nuts using the primer.SELECTED DRAWING: Figure 1

Description

  The present invention includes tree nuts that may cause allergies (almonds, beach nuts, Brazil nuts, butter nuts, cashews, chestnuts, tincapine, coconuts, ginkgo, hazelnuts, hickory nuts, litchi, macadamia nuts, pecan nuts, pine nuts, Detection of nuts that can be detected with high sensitivity even if the amount is small, when the nuts are included in food ingredients or products. The present invention relates to a method, and PCR primers, primer sets, and kits used in the method.

  Among the foods that can cause food allergies, the eight items of milk, eggs, fish, crustaceans, wheat, soybeans, peanuts, and nuts, which have a particularly large number of patients, are also called “The Big-8” In many countries and regions around the world, such as Canada, Singapore, and the EU, labeling for contained foods is mandatory.

Foods that may cause allergies can be unintentionally mixed in at the production, distribution, and processing stages. Therefore, as a food material or product provider, quality control is performed on whether or not they are mixed. It becomes important.

Methods for detecting characteristic proteins for milk and eggs (ELISA, Western blot, and immunochromatography), and methods for detecting characteristic DNA base sequences for fish (PCR) However, for crustaceans, wheat, soybeans, and peanuts, both detection methods have been established and are commercially available and available as test kits. On the other hand, nuts are a general term and include a very wide variety of biological species, and therefore a method for detecting them collectively as nuts has not been established.

In countries with the obligation to display tree nuts, for example, in the EU and Singapore, eight kinds of almonds, walnuts, pecan nuts, hazelnuts, macadamia nuts, Brazil nuts, cashew nuts, and pistachios are used. Nine species with fruits are listed. In the United States, there are 19 types in total, including beach nuts, butternuts, chestnuts, chincapine, coconuts, ginkgo, hickory nuts, lychee, pili nuts and shea nuts in addition to the above nine.

In Japan, unlike other countries, it is recommended that walnuts and cashew nuts should be individually labeled as “according to specific raw materials” rather than subjecting the nuts to the collective labeling. September 20, 25, the table of fasting 257). In recent years, with the westernization of Japanese dietary habits, the intake of nuts has increased, and in the future, the number of patients with food allergies to nuts other than walnuts and cashew nuts will increase, and the resulting increase in the number of patients that conform to specified raw materials There is also a great deal of addition.

  In order to inspect the presence or absence of tree nuts, a plurality of detection methods for individual tree nuts are combined. However, performing ELISA and Western blotting a plurality of times requires enormous labor and cost. On the other hand, in the case of the PCR method, if the PCR conditions are the same, a plurality of sets of reagents can be prepared and examined at the same time, which is considered useful as a nut detection method. In general, protein is less stable to various processing in the food production process than DNA, so the method for detecting protein may not be applicable to highly processed test foods. high. For this reason, the PCR method targeting a DNA base sequence, which is considered to be relatively stronger in processing than protein, is considered suitable for detection from food materials and products that have undergone various processing steps.

  Currently, for the 8 types of almonds, walnuts, pecan nuts, hazelnuts, macadamia nuts, Brazil nuts, cashew nuts, and pistachios, individual detection methods using the PCR method have been established and are commercially available and used as test kits. It is possible. The kit uses a real-time PCR method using a TaqMan probe to ensure detection specificity. However, since it requires equipment and reagents for real-time PCR, it is less expensive than a normal PCR method that does not use a probe. It takes. As described above, there are at least 19 kinds of nuts that may cause food allergy, and there are many nuts that cannot be detected by the kit.

Other methods for detecting the fruit of individual trees include detection of almonds, hazelnuts, cashews, and walnuts by PCR (Patent Documents 1, 2, 3, and 4). This is a detection method and cannot detect the fruits of multiple types of trees.

  In addition, for the purpose of analyzing the varieties of chestnuts, a method using an SSR marker has been reported (Non-Patent Document 1), but it is assumed that the test sample is a single species of plant, In the case of a sample mixed with plant species, it is difficult to specifically detect chestnuts because the PCR primer used is very likely to react with other plant DNA. Therefore, it cannot be used to specifically detect chestnut DNA in foods containing multiple plants.

  As a method for detecting coconut, a detection method using an immunochromatography method that targets coconut-specific protein has been established and is commercially available and usable as a test kit. There is no report about the detection method.

  There have been no reports on detection methods for beach nuts, butternuts, chincapine, ginkgo, hickory nuts, litchi, pili nuts, pine nuts and shea nuts.

  As mentioned above, nuts that can cause food allergies (almonds, beach nuts, brazil nuts, butter nuts, cashews, chestnuts, tincapine, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts In fact, no method has been reported to easily detect pyrnuts, pistachios, shea nuts, walnuts) under the same conditions, and there is a method that can scientifically verify whether these nuts are mixed in food ingredients and products. It is highly anticipated as a food quality control method.

CN 101643786A CN 101643787A CN 101792815A JP2009-279000, primer and method for detecting specific plant

Eiichi Inoue, Toshiya Yamamoto, Yasuaki Tsuki, Hiromi Matsuki, Hiroyuki Anzai, Hiromichi Hara, Analysis of Seven Chestnut Breeds from the Korean Peninsula Using SSR Markers; Sonoken, 7 (4): 475-480, 2008

  The present invention includes tree nuts that may cause allergies (almonds, beach nuts, Brazil nuts, butter nuts, cashews, chestnuts, tincapine, coconuts, ginkgo, hazelnuts, hickory nuts, litchi, macadamia nuts, pecan nuts, pine nuts, The main object is to provide a method capable of specifically and simultaneously detecting foods and products from food ingredients and products, and PCR primers, primer sets, and kits used in this method.

  In order to achieve the above-mentioned problems, the present inventors focused on the commonality and specificity in the gene sequences of the target nuts and other organisms from the molecular biological viewpoint, and the nuts that are food allergy-causing foods. (Almond, Beach nut, Brazil nut, Butter nut, Cashew nut, Chestnut, Chincapine, Coconut, Ginkgo, Hazelnut, Hickory nut, Lychee, Macadamia nut, Pecan nut, Pine nut, Pirnut, Pistachio, Shea nut, Walnut) We have eagerly studied how it can be detected. As a result, of almonds, beach nuts, Brazil nuts, butter nuts, cashew nuts, chestnuts, chincapine, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, pyrnuts, pistachios, shea nuts or walnuts By finding nucleotide sequences that are characteristic of each, and performing nucleic acid analysis such as PCR using these nucleotide sequences, almonds, beach nuts, Brazil nuts, butter nuts, cashew nuts, chestnuts, tincapine, coconuts, ginkgo, We found that hazelnuts, hickory nuts, litchi, macadamia nuts, pecan nuts, pine nuts, pili nuts, pistachios, shea nuts, or walnuts can be easily detected, and after further diligent investigations, they are It devised so that can be detected by the original, which resulted in the completion of the present invention. That is, the present invention relates to the following PCR primer set for nut detection, nut detection method, and nut detection kit.

Item 1. A PCR primer set according to any one of (1) to (34) below.
(1) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 9 to 23 in the sequence listing in SEQ ID NO: 1 on the 3 ′ end side;
A PCR primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 on the 3 ′ end side in SEQ ID NO: 2 in the sequence listing.
(2) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in SEQ ID NO: 3 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 4 in the sequence listing.
(3) a PCR primer consisting of DNA of a maximum of 30 bases including the base sequence of base numbers 9 to 23 in the sequence listing in SEQ ID NO: 5 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in the sequence listing at the 3 ′ end.
(4) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in the sequence listing in the sequence listing on the 3 ′ end side.
(5) a PCR primer consisting of DNA of a maximum of 30 bases comprising the base sequence of base numbers 6 to 20 in the sequence listing SEQ ID NO: 9 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 4-18 in the sequence listing, SEQ ID NO: 10 on the 3 ′ end side
(6) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 4 to 18 on the 3 ′ end side in SEQ ID NO: 11 in the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 4 to 18 in the sequence listing in the sequence listing on the 3 ′ end side.
(7) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in SEQ ID NO: 13 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 13 to 27 in SEQ ID NO: 14 in the sequence listing on the 3 ′ end side
(8) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in SEQ ID NO: 15 on the 3 ′ end side,
Primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 at the 3 ′ end in SEQ ID NO: 16 in the sequence listing
(9) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 17 in the sequence listing;
A PCR primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 9 to 23 in the sequence listing in the sequence listing on the 3 ′ end side.
(10) a PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in SEQ ID NO: 19 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 20 in the sequence listing.
(11) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in the sequence listing in SEQ ID NO: 21 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 22 in the sequence listing.
(12) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 4 to 18 on the 3 ′ end side in SEQ ID NO: 23 of the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 24 in the sequence listing.
(13) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 25 on the 3 ′ end side of the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 26 of the Sequence Listing.
(14) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 27 of the sequence listing;
A primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 4 to 18 in the sequence listing in the sequence listing on the 3 ′ end side.
(15) a PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 15 to 29 in SEQ ID NO: 30 in the sequence listing on the 3 ′ end side.
(16) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 31 of the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 4-18 in SEQ ID NO: 32 in the sequence listing on the 3 ′ end side.
(17) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in the sequence listing in SEQ ID NO: 33 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases comprising the base sequence of base numbers 6 to 20 in the sequence listing in the sequence listing on the 3 ′ end side.
(18) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side of the sequence listing
(19) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3 ′ end side
(20) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side of the sequence listing
(21) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 ′ end side
(22) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 10 on the 3 ′ end side of the sequence listing
(23) a PCR primer consisting of DNA of a maximum of 30 bases comprising the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 12 on the 3 ′ end side of the sequence listing
(24) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 on the 3 ′ end side of the sequence listing
(25) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 16 in the sequence listing on the 3 ′ end side
(26) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3 ′ end side
(27) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 19 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 20 on the 3 ′ end side of the sequence listing
(28) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 21 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 22 on the 3 ′ end side of the sequence listing
(29) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 23 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 24 in the sequence listing on the 3 ′ end side
(30) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 25 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 26 in the sequence listing on the 3 ′ end side
(31) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 27 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 28 in the sequence listing on the 3 ′ end side
(32) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 29 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 30 in the sequence listing on the 3 ′ end side
(33) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 31 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 32 in the sequence listing on the 3 ′ end side
(34) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 33 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 34 in the sequence listing on the 3 ′ end side

Item 2. The primer set according to (1) of claim 1.

Item 3. The primer set according to (2) of claim 1.

Item 4. The primer set according to (1) of claim 1.

Item 5. The primer set according to (1) of claim 1.

Item 6. The primer set according to (5) of claim 1.

Item 7. The primer set according to (1) of claim 1.

Item 8. The primer set according to (7) of claim 1.

Item 9. The primer set according to (1) of claim 1.

Item 10. The primer set according to (9) of claim 1.

Item 11. The primer set according to (10) of claim 1.

Item 12. The primer set according to (11) of claim 1.

Item 13. The primer set according to (12) of claim 1.

Item 14. The primer set according to (13) of claim 1.

Item 15. The primer set according to (14) of claim 1.

Item 16. The primer set according to (15) of claim 1.

Item 17. The primer set according to (16) of claim 1.

Item 18. The primer set according to (17) of Item 1.

Item 19. The primer set according to (18) of Item 1.

Item 20. The primer set according to (19) of Item 1.

Item 21. The primer set according to (20) of Item 1.

Item 22. The primer set according to (21) of Item 1.

Item 23. The primer set according to (22) of claim 1.

Item 24. The primer set according to (23) of claim 1.

Item 25. The primer set according to (24) of claim 1.

Item 26. The primer set according to (25) of Item 1.

Item 27. The primer set according to (26) of claim 1.

Item 28. The primer set according to (27) of Item 1.

Item 29. The primer set according to (28) of claim 1.

Item 30. The primer set according to (29) of claim 1.

Item 31. The primer set according to (30) of claim 1.

Item 32. The primer set according to (31) of Item 1.

Item 33. The primer set according to (32) of claim 1.

Item 34. The primer set according to (33) of claim 1.

Item 35. The primer set according to (34) of Item 1.

Item 36. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to any one of claims 2 to 35 using the DNA as a template, and a sample by detecting the amplified DNA And a method for detecting whether or not a tree nut is present therein.

Item 37: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 2 or 19 using the DNA as a template, and presence of almonds in the sample by detecting the amplified DNA And a method for detecting whether or not the almond is detected.

Item 38: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 3 or 20 using this DNA as a template, and beach nuts in the sample by detecting the amplified DNA. And a method for detecting beach nuts.

Item 39: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 4 or 21 using the DNA as a template, and detecting the amplified DNA, whereby Brazil nuts are contained in the sample. A method for detecting Brazil nuts, comprising the step of detecting whether or not it exists.

Item 40: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 5 or 22 using the DNA as a template, and presence of cashew nuts in the sample by detecting the amplified DNA And a method for detecting cashew nuts.

Item 41. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 6 or 23 using this DNA as a template, and a chestnut is present in the sample by detecting the amplified DNA Detecting a chestnut or not.

Item 42: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 7 or 24 using the DNA as a template, and presence of coconut in the sample by detecting the amplified DNA And a step of detecting whether or not the coconut is detected.

Item 43: A step of extracting DNA from a sample, a step of performing PCR using the primer set of claim 8 or 25 using the DNA as a template, and presence of ginkgo in the sample by detecting the amplified DNA A method for detecting gingko, comprising a step of detecting whether or not it is performed.

Item 44: A step of extracting DNA from a sample, a step of performing PCR using the primer set of claim 9 or 26 using the DNA as a template, and presence of hazelnuts in the sample by detecting the amplified DNA And a method of detecting whether or not a hazelnut is detected.

Item 45: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 10 or 27 using this DNA as a template, and detecting hickory nuts in the sample by detecting the amplified DNA. A method for detecting hickory nuts, the method including detecting whether or not it exists.

Item 46: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 11 or 28 using the DNA as a template, and presence of lychee in the sample by detecting the amplified DNA And a step of detecting whether or not the lychee is detected.

Item 47: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 12 or 29 using this DNA as a template, and macadamia nuts in the sample by detecting the amplified DNA. A method for detecting macadamia nuts, comprising a step of detecting whether or not it exists.

Item 48. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 13 or 30 using the DNA as a template, and detecting the amplified DNA, whereby pecan nuts are contained in the sample. A method for detecting pecan nuts, comprising the step of detecting whether or not it exists.

Item 49: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 14 or 31 using this DNA as a template, and a pine nut in the sample by detecting the amplified DNA. And a method for detecting whether or not a pine nut is present.

Item 50: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 15 or 32 using the DNA as a template, and the presence of pyrnuts in the sample by detecting the amplified DNA And a method for detecting whether or not a pilnut is detected.

Item 51: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 16 or 33 using the DNA as a template, and presence of pistachio in the sample by detecting the amplified DNA A method for detecting pistachios, comprising the step of detecting whether or not the

Item 52: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 17 or 34 using the DNA as a template, and presence of shea nuts in the sample by detecting the amplified DNA A method for detecting shea nuts, comprising the step of detecting whether or not

Item 53: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 18 or 35 using the DNA as a template, and the presence of walnuts in the sample by detecting the amplified DNA And a step of detecting whether or not the walnut is detected.

According to the present invention, nuts (almonds, beach nuts, Brazil nuts, butter nuts, cashew nuts, chestnuts, chincapine, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, which have high accuracy and detection sensitivity by nucleic acid analysis using PCR or the like. , Macadamia nuts, pecan nuts, pine nuts, pyrinuts, pistachios, shea nuts, walnuts), and whether or not the above nuts are contained in the test food ingredients or test foods. There is an effect that it is possible to carry out quality control inspections such as whether or not they have It also contributes to prevention of allergies and investigation of causative substances when allergic symptoms occur.

It is the photograph after the electrophoresis which showed the detection sensitivity of DNA at the time of using the primer set in this invention. (A) A photograph after electrophoresis showing the detection sensitivity of almond DNA in PCR using SEQ ID NO: 1 and SEQ ID NO: 2. (B) A photograph after electrophoresis showing the detection sensitivity of beach nut DNA in PCR using SEQ ID NO: 3 and SEQ ID NO: 4. (C) A photograph after electrophoresis showing the detection sensitivity of Brazil nut DNA in PCR using SEQ ID NO: 5 and SEQ ID NO: 6. (D) A photograph after electrophoresis showing the detection sensitivity of cashew nut DNA in PCR using SEQ ID NO: 7 and SEQ ID NO: 8. (E) A photograph after electrophoresis showing the detection sensitivity of chestnut DNA in PCR using SEQ ID NO: 9 and SEQ ID NO: 10. (F) A photograph after electrophoresis showing the detection sensitivity of coconut DNA in PCR using SEQ ID NO: 11 and SEQ ID NO: 12. (G) A photograph after electrophoresis showing the detection sensitivity of ginkgo DNA in PCR using SEQ ID NO: 13 and SEQ ID NO: 14. (H) A photograph after electrophoresis showing the detection sensitivity of hazelnut DNA in PCR using SEQ ID NO: 15 and SEQ ID NO: 16. (I) A photograph after electrophoresis showing the detection sensitivity of hickory nut DNA in PCR using SEQ ID NO: 17 and SEQ ID NO: 18. (J) Photograph after electrophoresis showing the detection sensitivity of lychee DNA in PCR using SEQ ID NO: 19 and SEQ ID NO: 20. (K) A photograph after electrophoresis showing the detection sensitivity of macadamia nut DNA in PCR using SEQ ID NO: 21 and SEQ ID NO: 22. (L) A photograph after electrophoresis showing the detection sensitivity of pecan nut DNA in PCR using SEQ ID NO: 23 and SEQ ID NO: 24. (M) A photograph after electrophoresis showing the detection sensitivity of pine nut DNA in PCR using SEQ ID NO: 25 and SEQ ID NO: 26. (N) A photograph after electrophoresis showing the detection sensitivity of pyrinut DNA in PCR using SEQ ID NO: 27 and SEQ ID NO: 28. (O) A photograph after electrophoresis showing the detection sensitivity of pistachio DNA in PCR using SEQ ID NO: 29 and SEQ ID NO: 30. (P) A photograph after electrophoresis showing the detection sensitivity of shea nut DNA in PCR using SEQ ID NO: 31 and SEQ ID NO: 32. (Q) A photograph after electrophoresis showing the detection sensitivity of walnut DNA in PCR using SEQ ID NO: 33 and SEQ ID NO: 34.

Hereinafter, the present invention will be described in detail.
PCR primer set for tree nut detection The present inventors have developed the following 17 kinds of PCR primer sets for tree nut detection in accordance with the above-mentioned purpose. The PCR primer set for detecting nuts of the present invention includes those having a base sequence characteristic of almonds, those having a base sequence characteristic of beach nuts, those having a base sequence characteristic of Brazil nuts, and features of cashew nuts Have a typical base sequence, have a base sequence characteristic of chestnut, have a base sequence characteristic of coconut, have a base sequence characteristic of hazelnut, have a base sequence characteristic of ginkgo Those having a base sequence characteristic of hickory nuts, those having a base sequence characteristic of lychee, those having a base sequence characteristic of macadamia nuts, those having a base sequence characteristic of pecan nuts, pilnuts Having a characteristic base sequence, having a characteristic base sequence of pine nuts, a characteristic base for pistachios Those having a row, having a characteristic nucleotide sequence in shea nut, and those having a characteristic nucleotide sequence walnut.

  Each primer set was designed as follows. The target nucleotide sequence is preferably one that has a large number of copies per cell from the viewpoint of improving sensitivity. The chloroplast rbcL (large subunit gene for ribulose-1,5-bisphosphate carboxylase / oxygenase) gene sequence, matk ( maturase-encoding gene) gene sequence, rRNA gene internal transcription spacer region 1 (ITS1) base sequence, and internal transcription spacer region 2 (ITS2) base sequence were selected as candidates. Acquire the sequences of various plants from a known DNA database (GenBank nucleotide sequence database), or obtain some plants by analyzing them independently, and create a multiple parallel sequence diagram of their enormous base sequences did. Among them, the ITS region has a fast evolution rate and can identify more closely related species, so it is suitable as a target sequence for various tree fruit-specific primers.

  When developing a primer set for detecting almonds, the target species is set to almonds (Prunus dulcis), and almonds and related peaches (Prunus percica) ), Prunes (Prunus domestica), ume (Prunus mume), plum (Prunus salicina), apricot (Prunus armeniaca), cherries (Prunus avium) ITS region nucleotide sequences were compared. The base sequence of the ITS region is highly homologous to related species, and it was difficult to select an almond-specific base sequence. A nucleotide sequence region could be selected, and a PCR primer set was newly designed from the nucleotide sequence region. At the time of design, the base sequence region of the organism species targeted for detection hybridizes under stringent conditions, but the ingenuity is designed so that it does not hybridize with species not targeted for detection. did.

  In developing a beach nut detection primer set, the target species is set to beach nuts (Fagus spp.), And the beach nuts and their related species are the same species. Genus chestnut (Castanea spp.), Cedar genus (Castanopsis spp.), Quercus genus (Quercus spp.), Walnut pecan genus hickory nut (Carya spp.), Pecan nut (Carya illinoinensis) The base sequences of the ITS regions of walnuts belonging to the genus Walnut (Juglans spp.) And hazelnuts (Corylus spp.) Were compared. A base sequence region specific to beach nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detection of Brazil nuts, the target species is set to Brazil nuts (Bertholletia excelsa). Brazil nuts and related species The same order Acetaceae shea butterberry genus shea nut (Vitellaria paradoxa), Acateaceae fulcrum miracle fruit (Synsepalum dulcificum), Oysteraceae Oyster oyster (Diospyros kaki), Oyster Oysteraceae tea (Camellia sinensis) The base sequences of the ITS regions of the Kiwifruit (Actinidia deliciosa) and the Vaccinium spp. A base sequence region specific to Brazil nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for the detection of cashew nuts, the target species was set to cashew nuts (Anacardium occidentale), and cashew nuts and related species of the same family Kinoki. The base sequences of the ITS regions of the genus Pistacia vera, the mango genus Mango (Mangifera indica), and the salamander genus pink pepper (Schinus molle) were compared. A base sequence region specific to cashew nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for chestnut detection, the target species for detection was set to chestnuts (Castanea spp.). Chincapine (Castanea pumila) is also a species of the chestnut genus and was therefore detected. Chestnuts and related species, Fagus spp., Fauna spp., Castanopsis spp., Quercus spp. (Carya spp.), Pecan nut (Carya illinoinensis), Walnut family walnut genus (Jugrans spp.), Birch family Hazel genus hazelnut (Corylus spp.) ITS region nucleotide sequences were compared. Although the base sequence of the ITS region is highly homologous to related species, it was difficult to select chestnut-specific base sequences, but multiple parallel sequence diagrams were compared in detail, and the region for the sense primer was used as a hickory nut , Selected from areas with high homology to pecan nuts, areas for antisense primers to be used as hickory nuts, low homology to pecan nuts, but areas with high homology to acorns, other than chestnuts for detection purposes By combining a sense primer that exhibits a crossing property with respect to a biological species (hickory nut, pecan nut) and an antisense primer that exhibits a crossing property with another biological species (acorn), the target detection target Hybridizes with stringent conditions, but hybridizes with non-detection species. A novel PCR primer set was designed and designed.

  In developing a PCR primer set for coconut detection, the target species is set to coconut (Cocos nucifera), and coconut and its related species, date palm The nucleotide sequences of the ITS regions of the genus Date palm (Phoenix dactylifera) and Euterpe oleracea were compared. A nucleotide sequence region specific to coconut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting ginkgo, the target species is set to Ginkgo (Ginko biloba), and the chloroplast matK gene sequence of ginkgo and other gymnosperms Compared. A gene sequence region specific to ginkgo was selected, and a PCR primer set was newly designed from the gene sequence region. At that time, the gene sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting hazelnuts, the target species is set to hazelnut (Corylus spp.), And hazelnuts and related walnuts are related species. Pecan Hickory Nuts (Carya spp.), Pecan Nuts (Carya illinoinensis), Walnuts Walnuts (Jugrans spp.), Chestnuts Chestnut Chestnut (Castanea spp.), Beech Family Beech Nuts (Fagus spp.), The base sequence of the ITS region of beechaceae (Castanopsis spp.) And the beech family Quercus spp. A base sequence region specific to hazelnut was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In the development of PCR primer sets for detecting hickory nuts, the target species for detection is set to hickory nuts (Carya spp.), Which are hickory nuts and related species. Walnuts from the same walnut family (Juglans spp.), Chestnuts from the chestnut family (Castanea spp.), Beech nuts from the beech family (Fagus spp.), Castanopsis spp. The base sequences of the ITS regions of the beech family Quercus spp. And the birch hazelnut hazelnut (Corylus spp.) Were compared. A base sequence region specific to hickory nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for lychee detection, the target species was set to lychee (Litchi chinensis), and lychee and its related species Rambutan. The nucleotide sequences of the ITS region of the genus Rambutan (Nephelium lappaceum) were compared. A nucleotide sequence region specific to lychee was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting macadamia nuts, the target species is set to macadamia nuts (Macadamia spp.), And macadamia nuts and related species. The base sequence of the ITS region of the same lotus genus Lotus (Nelumbo nucifera) was compared. A base sequence region specific to macadamia nut was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting pecan nuts, the species to be detected was set to pecan nuts (Carya illinoinensis). Pecan nuts are a kind of the above-mentioned hickory nuts (Pecan genus), but since they are the most popular among hickory nuts, we thought that it was necessary to distinguish pecan nuts from other hickory nuts. Pecan nuts and their related species, hickory nuts (Carya ovata, Carya laciniosa), walnuts of the same walnut family (Juglans spp.), Chestnuts of the chestnut family (Castanea spp.), Beech family Beech nuts (Fagus spp.), Beechaceae Shii (Castanopsis spp.), Beech family Quercus acorn (Quercus spp.), Birch family Hazelnut (Corylus spp.) The nucleotide sequences were compared. The base sequence of the ITS region is highly homologous to related species, and it was difficult to select a base sequence specific to pecan nuts. A nucleotide sequence region could be selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting pine nuts, the target species is set to pine nuts (Pinus spp.), And pine nuts and other gymnosperms. The nucleotide sequences of ITS regions were compared. A base sequence region specific to pine nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detection of pyrinuts, the target species for the detection was set to pyrinuts (Muclodiaceae orchidaceae, Canarium ovatum). Cashew nuts (Anacardium occidentale), Pistachio (Pistacia vera), Mansi of Mango (Mangifera indica), Pink pepper (Schinus molle), Salamander (Lepidoptera) The nucleotide sequences of the ITS regions of litchi (Litchi chinensis), rambutan (Nephelium lappaceum), and orange (Citrus sinensis) were compared. A base sequence region specific to pyrnuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for pistachio detection, the target species was set to Pistachio (Pistacia vera), and pistachio and its related species, cashew nutkin The nucleotide sequences of the ITS regions of the genus Cashew nut (Anacardium occidentale), the mango genus Mango (Mangifera indica), and the salamander genus pink pepper (Schinus molle) were compared. A base sequence region specific to pistachio was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for the detection of shea nuts, the target species of the detection was set to shea nuts (Vetellaria paradoxa). Miracle fruits of the genus (Synsepalum dulcificum), Brazilian nuts of the same scorpion family, Brazil nuts (Bertholletia excelsa), Oysters of the genus Oysters (Diospyros kaki), Teas of the genus Oysteraceae (Camellia sinensis), Matabi The base sequences of the ITS region of the genus Kiwifruit (Actinidia deliciosa) and the genus Vaccinium spp. Were compared. A base sequence region specific to shea nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting walnuts, the target species was set to walnuts (Juglans spp.). Since butternut (Juglans cinerea) is also a genus of walnut, it was selected as a detection target. The walnuts and their related species, Pecan Hickory nuts (Carya ovata, Carya laciniosa), Pecan nuts (Carya illinoinensis), Chestnut chestnuts (Castanea spp.), Beech The nucleotide sequences of the ITS region of beech nuts (Fagus spp.), Beechaceae shii (Castanopsis spp.), Beech family Quercus acorn (Quercus spp.), Birch hazelnut hazelnut (Corylus spp.) Compared. A nucleotide sequence region specific to walnuts was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In addition, each primer was designed so as not to cause hybridization between the sense primer and the antisense primer or hybridization by each primer itself, that is, to avoid so-called primer dimer formation as much as possible. . For example, in order to avoid the formation of primer dimers, base substitution is performed on the primers so as not to reduce the detection specificity and detection sensitivity of the primers. The bases of base numbers 3 and 4 in SEQ ID NO: 1, which is the sense primer of the almond detection primer, are originally A, but in order to avoid the formation of primer dimers by the sense primer itself, the detection specificity and detection of the primer T is used in place of A as a base substitution that does not lead to a decrease in sensitivity. Similarly, the base of base number 8 in SEQ ID NO: 10 from C to A, the base of base number 6 in SEQ ID NO: 15 from G to A, the base of base number 3 in SEQ ID NO: 21 from C to A, SEQ ID NO: In 24, the base of base number 4 is substituted from C to A, and the base of base number 7 is substituted from A to T.

Furthermore, in order to make the PCR reaction conditions by the above 17 types of primer sets the same, each PCR primer was designed so that the annealing conditions (annealing temperature, annealing time) that most affect the reaction conditions in the PCR reaction were the same. It was very difficult to make the annealing conditions for multiple types of PCR primers the same, but by examining the number of bases of the PCR primer and the base sequence of the primer in detail, each detection specificity was not impaired. The annealing conditions were the same.

  Although the base sequence of the primer provided by the present invention has been comprehensively described, a primer that does not have the intended performance (detection specificity, etc.) has been designed even if the primer is theoretically designed successfully. There is a case. For example, in the research stage of the present invention, in PCR using the PCR primer set for detecting pecan nuts consisting of SEQ ID NO: 69 and SEQ ID NO: 70, pecan nut DNA was used in spite of using a base sequence peculiar to pecan nuts. In addition, hickory nut (overtah hickory) DNA was detected and did not show the intended detection specificity. In this way, simply designing a primer logically does not necessarily obtain the intended performance (detection specificity, etc.), and may not have the required performance. In addition to logical design, further innovation and performance evaluation tests are important. The primer provided by the present invention is designed by further devising the logical design, and finally the performance evaluation test is cleared.

  Therefore, the nuts (almond, beach nut, brazil nut, butter nut, cashew nut, chestnut, chincapine) contained in various foods using a nucleic acid analysis technique such as PCR method using the PCR primer set for detecting nuts of the present invention. , Coconut, ginkgo, hazelnut, hickory nut, lychee, macadamia nut, pecan nut, pine nut, pyrinut, pistachio, shea nut, or walnut) -derived DNA can be detected simultaneously with high sensitivity and specificity.

Here, nucleic acid analysis refers to the presence or absence of a characteristic base sequence by analyzing the presence or absence of a characteristic base sequence depending on individual species, genus, or group in biological classification. It is an effective means for grasping the species, genus, or group of the organism, and is a method usefully used for detecting a specific microorganism or identifying a species.

The base sequences of the primers provided by the present invention are as follows.
Base number 12345678901234567890123456789
Sequence number 1 (almond S) AGTTCTAGTTTCAAAGCGGGGGC
Sequence number 2 (almond AS) ACGACGGGCAACCGAGGTC
Sequence number 3 (beach nut S) GCCTTTCGTCCCCAAACGGTC
Sequence number 4 (beach nut AS) TGCCACGGTCGCTTCGAATG
Sequence number 5 (Brazilian nut S) GACGAGTGGTGGATCACGACACG
Sequence number 6 (Brazil nut AS) TCGATGCCTTGCCGCTTCG
Sequence number 7 (cashew nut S) TGGCGTTCGGAACGAACCCG
Sequence number 8 (cashew nut AS) GCGATGCGGGCGGGCATAG
Sequence number 9 (chestnut S) GGAACGCGCCAAGGAAATCA
Sequence number 10 (chestnut AS) TCGCGCCAGCCCCGAACC
Sequence number 11 (coconut S) GACGCTCCGCCCCCTCGA
Sequence number 12 (coconut AS) GTGCGGCACGCACCTGGG
SEQ ID NO: 13 (Ginkgo S) GGTGCTCACTCCCCAGTCAGG
Sequence number 14 (Ginkgo AS) CATCTAGCATTTTGATCCTAACCACGG
Sequence number 15 (hazelnut S) ATGCCAGGGGCGAATCTTGTG
Sequence number 16 (hazelnut AS) GCTACAGGGTCACAGAGCACAAGAC
Sequence number 17 (hickory nut S) TGGGAGGGCACGATGAAAGC
Sequence number 18 (hickory nut AS) CGAGCGCAATAGGGTCGAGGAGAG
Sequence number 19 (Lyche S) GAGGCGTGGGGATGCGTTATC
Sequence number 20 (Lyche AS) CGAGAGCCTTACGCCGACCG
Sequence number 21 (Macadamia nut S) GCACCCCGTGTCTCTGTTCG
Sequence number 22 (Macadamia nut AS) CGATGTCCGAACAATGGCAAAG
Sequence number 23 (pecan nut S) ACGGTTGGGAGGGCACGA
Sequence number 24 (pecan nut AS) TGTAGTTGCGCTCGTCGCCC
Sequence number 25 (pine nut S) CAGGCGATGTTTCGTGGCG
Sequence number 26 (pine nut AS) CCCTACCCAATGGGAGGACAAG
SEQ ID NO: 27 (Pirinut S) TGGTCGTAACGAACCTCGGTGC
Sequence number 28 (Pyri nut AS) CGTCACGGCGGCGCTTTC
Sequence number 29 (pistachio S) GGTGTCGGTCGTATGCTTCTGCAT
Sequence number 30 (Pistachio AS) GTCGTTATTGATAATGAAAGAAGGCTACC
Sequence number 31 (Sheer nut S) GCGTTGCCTCGGCTAAAAACTC
Sequence number 32 (Sheer nut AS) GCGGTCAAGGCTCCGCAA
Sequence number 33 (walnut S) GGTTGGGAGGGCACGTTGAG
Sequence number 34 (walnut AS) CGACGGGTCACGAGGGTTTC
Moreover, as a primer which consists of DNA of 30 bases which this invention provides, the thing of the following base sequences can be raised, for example.
Sequence number 35 (almond S) cgacccgAGTTCTAGTTTCAAAGCGGGGGC
Sequence number 36 (almond AS) gacgaacgcacACGACGGGCAACCGAGGTC
Sequence number 37 (beach nut S) gggttcgcgGCCTTTCGTCCCCAAACGGTC
Sequence number 38 (beach nut AS) cggacgaggtTGCCACGGTCGCTTCGAATG
Sequence number 39 (Brazil nut S) acggcacGACGAGTGGTGGATCACGACACG
Sequence number 40 (Brazil nut AS) tggggtcgcggTCGATGCCTTGCCGCTTCG
Sequence number 41 (cashew nut S) cgacggtcggTGGCGTTCGGAACGAACCCG
Sequence number 42 (cashew nut AS) ggggtcgcgacGCGATGCGGGCGGGCATAG
Sequence number 43 (chestnut S) accccggcgcGGAACGCGCCAAGGAAATCA
Sequence number 44 (chestnut AS) gggaggccaactTCCGCCCAGCCCCGAACC
Sequence number 45 (coconut S) atcatgccaagcGACGCTCCGCCCCCTCGA
Sequence number 46 (coconut AS) ccgatggctgggGTGCGGCACGCACCTGGG
Sequence number 47 (Ginkgo S) gctctgaagGGTGCTCACTCCCCAGTCAGG
Sequence number 48 (Ginkgo AS) aatCATCTAGCATTTTGATCCTAACCACGG
Sequence number 49 (hazelnut S) acggcgtgcATGCCAGGGGCGAATCTTGTG
Sequence number 50 (hazelnut AS) gcgcaGCTACAGGGTCACAGAGCACAAGAC
Sequence number 51 (hickory nut S) caaaaacggtTGGGAGGGCACGATGAAAGC
Sequence number 52 (hickory nut AS) gcaagaaCGACGCAATAGGGTCGAGGAGAG
Sequence number 53 (Lychee S) gcctcggacGAGGCGTGGGGATGCGTTATC
Sequence number 54 (Lychee AS) gcttcagggtCGAGAGCCTTACGCCGACCG
Sequence number 55 (Macadamia nut S) gcgaagattgGCACCCCGTGTCTCTGTTCG
Sequence number 56 (Macadamia nut AS) cacgcacaCGATGTCCGAACAATGGCAAAG
Sequence number 57 (pecan nut S) cccctcccaaaaACGGTTGGGAGGGCACGA
Sequence number 58 (pecan nut AS) cgggaggccaTGTAGTTGCGCTCGTCGCCC
Sequence number 59 (pine nut S) ctgaaatgtggCAGGCGATGTTTCGTGGCG
Sequence number 60 (pine nut AS) taaatccgCCCTACCCAATGGGAGGACAAG
Sequence number 61 (Pyrnut S) accttcggTGGTCGTAACGAACCTCGGTGC
Sequence number 62 (Pyri nut AS) gtgcgggcgccgCGTCACGGCGGCGCTTTC
Sequence number 63 (pistachio S) tcgtcgGGTGTCGGTCGTATGCTTCTGCAT
Sequence number 64 (pistachio AS) aGTCGTTATTGATAATGAAAGAAGGCTACC
Sequence number 65 (Sheer nut S) cctgaattGCGTTGCCTCGGCTAAAAACTC
Sequence number 66 (Sheer nut AS) tgacctggggtcGCGGTCAAGGCTCCGCAA
Sequence number 67 (walnut S) cccaaaaaacGGTTGGGAGGGCACGTTGAG
Sequence number 68 (walnut AS) gggcaacacaCGACGGGTCACGAGGGTTTC

In the research stage of the present invention, the base sequences of primers that did not show the intended detection specificity are as follows.
Sequence number 69 (pecan nut S) CCCCAACACCTCGTATGATGTGTA
Sequence number 70 (pecan nut AS) TGTAGTTGCGCTCGTCGCCC
(S represents a sense primer and AS represents an antisense primer.)

  The present invention uses, as a first primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 9 to 23 in SEQ ID NO: 1 in the sequence list on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 2 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for almond detection.

  The present invention uses, as a second primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 4 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for beach nut detection.

  The present invention uses, as a third primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 9 to 23 in SEQ ID NO: 5 in the sequence list on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 6 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for Brazil nut detection.

  The present invention uses, as a fourth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 7 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for cashew nut detection.

  The present invention uses, as a fifth primer set, a PCR primer consisting of DNA of at least 15 bases and a maximum of 30 bases containing a base sequence of base numbers 6 to 20 in SEQ ID NO: 9 of the sequence list on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 10 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for chestnut detection.

  The present invention provides, as a sixth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 11 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 12 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for coconut detection.

  The present invention provides a seventh primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 13 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer composed of DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 13 to 27 in SEQ ID NO: 14 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for detecting ginkgo.

  The present invention uses, as an eighth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 7 to 21 in SEQ ID NO: 15 in the sequence list on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 11 to 25 in SEQ ID NO: 16 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for detecting hazelnuts.

  The present invention uses, as a ninth primer set, a PCR primer consisting of a DNA of a minimum of 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 17 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 9 to 23 on the 3 ′ end side in SEQ ID NO: 18 in the sequence table is an antisense primer. This primer set can be suitably used for detecting hickory nuts.

  The present invention provides, as a tenth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 7 to 21 in SEQ ID NO: 19 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 6 to 20 in the sequence number 20 in the sequence table on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for lychee detection.

  In the present invention, as an eleventh primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 21 in the sequence listing on the 3 ′ end side is used as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 8 to 22 in SEQ ID NO: 22 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for macadamia nut detection.

  The present invention provides, as a twelfth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 23 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 6 to 20 in SEQ ID NO: 24 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for pecan nut detection.

  The present invention provides, as a thirteenth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 25 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases containing the base sequence of base numbers 8 to 22 in SEQ ID NO: 26 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for pine nut detection.

  The present invention provides, as a fourteenth primer set, a PCR primer consisting of a DNA having a shortest of 15 and a maximum of 30 bases comprising the base sequence of base numbers 8 to 22 in SEQ ID NO: 27 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 4-18 in SEQ ID NO: 28 in the sequence table on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for detection of pyrnuts.

  The present invention provides, as a 15th primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 of the sequence listing on the 3 ′ end side as a sense primer, A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 bases and a maximum of 30 bases containing the base sequence of base numbers 15 to 29 in SEQ ID NO: 30 in the sequence table on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for pistachio detection.

  The present invention provides, as a 16th primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of nucleotide numbers 8 to 22 in the sequence listing 31 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 32 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for detecting shea nuts.

  The present invention provides, as a 17th primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 6 to 20 in SEQ ID NO: 33 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 6 to 20 in SEQ ID NO: 34 in the sequence table on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for walnut detection.

  In each primer, the length of the base sequence is 15 to 30 because the appropriate length of the base sequence as a primer for PCR is about 15 to 30, and 15 bases on the 3 ′ end side. It is important to specify the sequence about 15 at the 3 'end in the PCR-specific amplification reaction. The base sequence at the 5' end is slightly different or the sequence length is slightly different. Even so, the adverse effect on the PCR reaction itself is usually small.

  In the present invention, furthermore, as a preferred embodiment of the first primer set, a PCR primer (1 ′) (most preferably) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (2 ') (most preferred) consisting of DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side as a primer, and a primer composed of DNA of the base sequence of SEQ ID NO: 1 Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 2. This primer set can be suitably used for detecting almonds, and it is most preferable to use the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 as a set. A specific example of (1 ′) is the primer of SEQ ID NO: 35, and a specific example of (2 ′) is the primer of SEQ ID NO: 36.

  In the present invention, furthermore, as a preferred embodiment of the second primer set, a PCR primer (3 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (4 ') (most preferably) consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 4. This primer set can be suitably used for beach nut detection, and it is most preferable to use the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 as a set. A specific example of (3 ′) is the primer of SEQ ID NO: 37, and a specific example of (4 ′) is the primer of SEQ ID NO: 38.

  In the present invention, furthermore, as a preferred embodiment of the third primer set, a PCR primer (5 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (6 ') (most preferred) consisting of DNA of a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 6 on the 3' end side of the sequence listing as a primer (sense primer) Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 6. This primer set can be suitably used for Brazil nut detection, and it is most preferable to use the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 as a set. A specific example of (5 ′) is the primer of SEQ ID NO: 39, and a specific example of (6 ′) is the primer of SEQ ID NO: 40.

  In the present invention, furthermore, as a preferred embodiment of the fourth primer set, a PCR primer (7 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (8 ') (most preferred) consisting of DNA with a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 8 in the sequence listing on the 3' end side as a primer (primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 7) Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 8. This primer set can be suitably used for cashew nut detection, and it is most preferable to use the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 as a set. A specific example of (7 ′) is the primer of SEQ ID NO: 41, and a specific example of (8 ′) is the primer of SEQ ID NO: 42.

  In the present invention, furthermore, as a preferred embodiment of the fifth primer set, a PCR primer (9 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (10 ') (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3' end side as a primer, using a primer consisting of DNA of the base sequence of SEQ ID NO: 9) as a sense primer Proposes a primer set using a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 10 as an antisense primer. This primer set can be suitably used for chestnut detection, and it is most preferable to use the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 as a set. A specific example of (9 ′) is the primer of SEQ ID NO: 43, and a specific example of (10 ′) is the primer of SEQ ID NO: 44.

In the present invention, furthermore, as a preferred embodiment of the sixth primer set, a PCR primer (11 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (12 ') (most preferred) consisting of DNA with a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 12 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 12. This primer set can be suitably used for coconut detection, and it is most preferable to use the primer of SEQ ID NO: 11 and the primer of SEQ ID NO: 12 as a set. As a specific example of (11 ′), the primer of SEQ ID NO: 45 can be exemplified, and as a specific example of (12 ′), the primer of SEQ ID NO: 46 can be exemplified.

In the present invention, furthermore, as a preferred embodiment of the seventh primer set, a PCR primer (13 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (14 ') (most preferred) consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 14. This primer set can be suitably used for ginkgo detection, and it is most preferable to use the primer of SEQ ID NO: 13 and the primer of SEQ ID NO: 14 as a set. A specific example of (13 ′) is the primer of SEQ ID NO: 47, and a specific example of (14 ′) is the primer of SEQ ID NO: 48.

  In the present invention, furthermore, as a preferred embodiment of the eighth primer set, a PCR primer (15 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (16 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 16 in the sequence listing on the 3' end side (mostly a primer composed of DNA of the base sequence of SEQ ID NO: 15) (most preferred) Proposes a primer set using a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 16 as an antisense primer. This primer set can be suitably used for detecting hazelnut, and it is most preferable to use the primer of SEQ ID NO: 15 and the primer of SEQ ID NO: 16 as a set. A specific example of (15 ′) is the primer of SEQ ID NO: 49, and a specific example of (16 ′) is the primer of SEQ ID NO: 50.

  In the present invention, furthermore, as a preferred embodiment of the ninth primer set, a PCR primer (17 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (18 ') (most preferred) consisting of DNA consisting of a maximum of 30 bases containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 18. This primer set can be suitably used for detecting hickory nuts, and it is most preferable to use the primer of SEQ ID NO: 17 and the primer of SEQ ID NO: 18 as a set. A specific example of (17 ′) is the primer of SEQ ID NO: 51, and a specific example of (18 ′) is the primer of SEQ ID NO: 52.

  In the present invention, furthermore, as a preferred embodiment of the tenth primer set, a PCR primer (19 ′) (most preferred) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 19 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (20 ') (most preferred) consisting of DNA of up to 30 bases comprising the nucleotide sequence of SEQ ID NO: 20 on the 3' end side of the sequence listing as a sense primer. Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 20). This primer set can be suitably used for lychee detection, and it is most preferable to use the primer of SEQ ID NO: 19 and the primer of SEQ ID NO: 20 as a set. A specific example of (19 ′) is the primer of SEQ ID NO: 53, and a specific example of (20 ′) is the primer of SEQ ID NO: 54.

  In the present invention, as a preferred embodiment of the eleventh primer set, a PCR primer (21 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 21 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (22 ') (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 22 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 22. This primer set can be suitably used for macadamia nut detection, and it is most preferable to use the primer of SEQ ID NO: 21 and the primer of SEQ ID NO: 22 as a set. A specific example of (21 ′) is the primer of SEQ ID NO: 55, and a specific example of (22 ′) is the primer of SEQ ID NO: 56.

  In the present invention, as a preferred embodiment of the twelfth primer set, a PCR primer (23 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 23 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (24 ') (most preferred) consisting of DNA of a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 24 in the sequence listing on the 3' end side as a primer. Proposes a primer set using a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 24 as an antisense primer. This primer set can be suitably used for pecan nut detection, and it is most preferable to use the primer of SEQ ID NO: 23 and the primer of SEQ ID NO: 24 as a set. A specific example of (23 ′) is the primer of SEQ ID NO: 57, and a specific example of (24 ′) is the primer of SEQ ID NO: 58.

  In the present invention, furthermore, as a preferred embodiment of the thirteenth primer set, a PCR primer (25 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 25 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (26 ') (most preferred) consisting of DNA of up to 30 bases comprising the nucleotide sequence of SEQ ID NO: 26 in the sequence listing on the 3' end side as a primer, and a primer composed of DNA of the nucleotide sequence of SEQ ID NO: 25) Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 26). This primer set can be suitably used for pine nut detection, and it is most preferable to use the primer of SEQ ID NO: 25 and the primer of SEQ ID NO: 26 as a set. A specific example of (25 ′) is the primer of SEQ ID NO: 59, and a specific example of (26 ′) is the primer of SEQ ID NO: 60.

In the present invention, as a preferred embodiment of the 14th primer set, a PCR primer (27 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 27 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (28 ') (most preferred) consisting of DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 28 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 28). This primer set can be suitably used for detection of pyrnuts, and it is most preferable to use the primer of SEQ ID NO: 27 and the primer of SEQ ID NO: 28 as a set. A specific example of (27 ′) is the primer of SEQ ID NO: 61, and a specific example of (28 ′) is the primer of SEQ ID NO: 62.

  In the present invention, as a preferred embodiment of the fifteenth primer set, a PCR primer (29 ′) (most preferred) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 29 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (30 ') (most preferred) consisting of DNA of up to 30 bases comprising the nucleotide sequence of SEQ ID NO: 30 on the 3' end side of the sequence listing as a primer, and a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 29 Proposes a primer set using an antisense primer as a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 30). This primer set can be suitably used for pistachio detection, and it is most preferable to use the primer of SEQ ID NO: 29 and the primer of SEQ ID NO: 30 as a set. A specific example of (29 ′) is the primer of SEQ ID NO: 63, and a specific example of (30 ′) is the primer of SEQ ID NO: 64.

  In the present invention, furthermore, as a preferred embodiment of the 16th primer set, a PCR primer (31 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 31 in the sequence listing on the 3 ′ end side (most preferred) PCR primer (32 ') (most preferred) consisting of DNA with a maximum of 30 bases comprising the base sequence of SEQ ID NO: 32 in the sequence listing on the 3' end side as a primer, using a primer composed of DNA of the base sequence of SEQ ID NO: 31) as a sense primer Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 32). This primer set can be suitably used for detecting shea nuts, and it is most preferable to use the primer of SEQ ID NO: 31 and the primer of SEQ ID NO: 32 as a set. A specific example of (31 ′) is the primer of SEQ ID NO: 65, and a specific example of (32 ′) is the primer of SEQ ID NO: 66.

  In the present invention, a preferred embodiment of the seventeenth primer set further includes a PCR primer (33 ′) (most preferred) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 33 in the sequence listing on the 3 ′ end side. PCR primer (34 ') consisting of a maximum of 30 bases of DNA comprising the base sequence of SEQ ID NO: 34 in the sequence listing on the 3' end side (primer consisting of DNA having the base sequence of SEQ ID NO: 33) (most preferred) Proposes a primer set using an antisense primer as a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 34. This primer set can be suitably used for walnut detection, and it is most preferable to use the primer of SEQ ID NO: 33 and the primer of SEQ ID NO: 34 as a set. A specific example of (33 ′) is the primer of SEQ ID NO: 67, and a specific example of (34 ′) is the primer of SEQ ID NO: 68.

Tree nut detection method The tree nut detection method of the present invention includes a step of extracting DNA from a sample, a step of performing PCR using the primer set of the present invention using this DNA as a template, and detecting amplified DNA. The nuts (almonds, beach nuts, brazil nuts, cashews, chestnuts, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, pyrnuts, pistachios, shea nuts, walnuts) And detecting whether or not it exists.

  That is, it is possible to specifically detect nuts in a sample by subjecting the DNA in the sample to nucleic acid analysis by PCR or the like using the above-described PCR primer set for detecting nuts of the present invention. At this time, when detecting almonds, use the PCR primer set for almond detection, and similarly, beach nuts, Brazil nuts, cashew nuts, chestnuts, coconuts, ginkgo, hazelnuts, hickory nuts, litchi, macadamia nuts, pecan nuts, When detecting pine nuts, pyrnuts, pistachios, shea nuts and walnuts, PCR primer set for beach nut detection, PCR primer set for Brazil nut detection, PCR primer set for cashew nut detection, PCR primer set for chestnut detection, coconut PCR primer set for detection, PCR primer set for ginkgo detection, PCR primer set for hazelnut detection, PCR primer set for hickory nut detection, PCR primer set for lychee detection, PCR for macadamia nut detection Use PCR primer set for detecting primer, pecan nut detection, PCR primer set for detecting pine nuts, PCR primer set for detecting pyrnuts, PCR primer set for detecting pistachios, PCR primer set for detecting shea nuts, PCR primer set for detecting walnuts That's fine.

  The type of detection method (nucleic acid analysis) is not particularly limited, and a known method can be used as appropriate. For example, a method of PCR amplification using PCR primers, a method of detecting a PCR amplification product with a probe, and the like can be exemplified.

  As a method of PCR amplification using PCR primers, a target base sequence in DNA in a sample is selectively amplified using the above-described primer set for fruit detection of the present invention selected according to the detection purpose, and a PCR amplification product The method of measuring the presence or absence of is mentioned. Confirmation of the presence or absence of a PCR amplification product can usually be performed by separating the PCR amplification product by agarose gel electrophoresis and staining with nucleic acid such as ethidium bromide or cyber green I. When PCR is performed using a real-time PCR apparatus, the presence or absence of a PCR amplification product can be automatically confirmed by the detection system of the apparatus. For example, when Cyber Green I is added to the PCR reaction solution, the amount of PCR amplification product depending on the amount of fluorescence emitted when Cyber Green I binds to double-stranded DNA can be monitored for each cycle. When PCR amplification is observed depending on the amount of fluorescence, the presence and size of the amplification product may be confirmed by the agarose gel electrophoresis described above.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 1 and the primer set forth in SEQ ID NO: 2 is about 515 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that almonds were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 3 and the primer set forth in SEQ ID NO: 4 is about 75 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that beach nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 5 and the primer set forth in SEQ ID NO: 6 is about 91 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that Brazil nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 7 and the primer set forth in SEQ ID NO: 8 is about 102 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that cashew nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 9 and the primer set forth in SEQ ID NO: 10 is about 293 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that chestnut was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 11 and the primer set forth in SEQ ID NO: 12 is about 224 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that coconut was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 13 and the primer set forth in SEQ ID NO: 14 is about 186 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that ginkgo was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 15 and the primer set forth in SEQ ID NO: 16 is about 361 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that hazelnut was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 17 and the primer set forth in SEQ ID NO: 18 is about 543 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that hickory nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 19 and the primer set forth in SEQ ID NO: 20 is about 162 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that lychee was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 21 and the primer set forth in SEQ ID NO: 22 is about 111 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that macadamia nut was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 23 and the primer set forth in SEQ ID NO: 24 is about 468 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that pecan nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 25 and the primer set forth in SEQ ID NO: 26 is about 139 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that pine nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 27 and the primer set forth in SEQ ID NO: 28 is about 83 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that pyrnuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 29 and the primer set forth in SEQ ID NO: 30 is about 163 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that pistachio was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 31 and the primer set forth in SEQ ID NO: 32 is about 518 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that shea nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 33 and the primer set forth in SEQ ID NO: 34 is about 501 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that walnuts were present in the test sample.

  As a method for detecting a PCR amplification product with a probe, as represented by the Taq Man method, a fluorescent substance-labeled probe that hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe is used for PCR. There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is decomposed after hybridization with an amplification product with a real-time PCR apparatus. Examples of other methods for detecting a PCR amplification product with a probe include a Molecular Beacon method, a Cycleave PCR method, and a method using a hybrid probe. The PCR primer used in these methods may be any of the PCR primer sets for fruit detection of the present invention, and the target species from the internal base sequence of the PCR amplification product amplified by each PCR primer set. A base sequence region that is common to the regions may be separately selected, and a probe based on that region may be used.

  In the nut detection method of the present invention, the type of the test sample to be processed is not particularly limited. For example, examples of the test sample include food raw materials and processed foods. Examples of the food raw material include food raw materials that do not intentionally include separately produced nuts in a food raw material production plant that handles nuts. Examples of processed foods include confectionery, noodles, powdered soup, liquid soup, hot-air dried or freeze-dried ingredients, and various cooked foods containing these processed foods. Moreover, in the food manufacturing factory which handles a nut, the processed food which does not contain the nut produced separately is mentioned. In addition, when a processed food containing nuts is produced and then a processed food not containing nuts is produced, careful cleaning of the food production facility with the removal of the nut residue in mind is essential. From the viewpoint of confirming the effectiveness of this cleaning method and the presence or absence of the fruit residue of the food production facility, a wipe sample of the production facility is also included as a test sample.

  In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (Notice of Deputy Director of Consumer Affairs Agency, Food Inspection Method with Allergic Substances, March 26, 2014, Table 36) And various commercially available DNA extraction kits [eg Nucleon PhytoPure, plant and fungal DNA extraction kits (GE Healthcare Biosciences Corp., USA), DNA Extraction IsoplantII kit (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), etc.] can be applied to the above detection method as long as the sample can recover DNA. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from a sample by the above-described DNA extraction method.

Tree nut detection kit The present invention also relates to a tree nut detection kit. The configuration of the kit is not particularly limited as long as it includes at least one PCR primer set for fruit detection of the present invention.
Specifically, a PCR primer composed of DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 9 to 23 in SEQ ID NO: 1 on the 3 ′ end side, and the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 2 to 3 ′ Set with a PCR primer consisting of DNA of up to 30 bases included on the terminal side; PCR primer consisting of DNA of maximum 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 3 on the 3 ′ terminal side, and SEQ ID NO: 4 Set with a PCR primer consisting of DNA of up to 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in FIG. 5; Up to 30 containing the base sequence of base numbers 9 to 23 in SEQ ID NO: 5 on the 3 ′ end side A set of a PCR primer consisting of a base DNA and a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 6 on the 3 ′ end side; base numbers 6 to 20 of SEQ ID NO: 7 PCR consisting of up to 30 bases of DNA containing the base sequence at the 3 ′ end A set of a primer and a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 on the 3 ′ end side; the base sequence of base numbers 6 to 20 in SEQ ID NO: 9 is 3 ′ A set of a PCR primer consisting of a DNA with a maximum of 30 bases included on the terminal side and a PCR primer consisting of a DNA with a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 10 on the 3 ′ terminal side; SEQ ID NO: 11 PCR primers consisting of a DNA of up to 30 bases containing the base sequence of base numbers 4-18 in the 3 ′ end side and a maximum of 30 bases containing the base sequence of base numbers 4-18 in SEQ ID NO: 12 in the 3 ′ end side Set with PCR primer consisting of DNA; PCR primer consisting of DNA with a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 13 on the 3 ′ end side, and bases of base numbers 13 to 27 in SEQ ID NO: 14 From DNA of up to 30 bases containing the sequence at the 3 ′ end A PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 15 on the 3 ′ end side, and the base sequences of base numbers 11 to 25 in SEQ ID NO: 16 Set with PCR primer consisting of DNA of up to 30 bases included on the 3 ′ end side; PCR primer consisting of DNA of up to 30 bases including the base sequence of base numbers 6 to 20 in SEQ ID NO: 17 on the 3 ′ end side, and sequence Set with a PCR primer consisting of DNA of up to 30 bases containing the base sequence of base numbers 9 to 23 on the 3 ′ end side in No. 18; including the base sequence of base numbers 7 to 21 in SEQ ID NO: 19 on the 3 ′ end side A set of a PCR primer consisting of DNA of up to 30 bases and a PCR primer consisting of DNA of up to 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 20 on the 3 ′ end side; base number 6 in SEQ ID NO: 21 Maximum including ~ 20 base sequence at 3 'end A set of a PCR primer comprising 30 base DNA and a PCR primer comprising a maximum of 30 base DNA comprising the base sequence of base numbers 8 to 22 in SEQ ID NO: 22 on the 3 ′ end side; the base in SEQ ID NO: 23 of the sequence listing From PCR primers consisting of DNA of up to 30 bases containing the base sequence of numbers 4 to 18 on the 3 ′ end side, and DNA of up to 30 bases containing base sequences of base numbers 6 to 20 in SEQ ID NO: 24 on the 3 ′ end side A PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 25 on the 3 ′ end side, and the base sequence of base numbers 8 to 22 in SEQ ID NO: 26 Set with PCR primer consisting of DNA of up to 30 bases included on the 3 ′ end side; PCR primer consisting of DNA of maximum 30 bases including the base sequence of nucleotide numbers 8 to 22 in SEQ ID NO: 27 on the 3 ′ end side, and sequence The base sequence of base numbers 4-18 in number 28 is the 3 'end Set with a PCR primer consisting of DNA of up to 30 bases included on the end side; PCR primer consisting of DNA of up to 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 on the 3 ′ end side, and SEQ ID NO: 30 Set with a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 15 to 29 on the 3 ′ end side in the above; a maximum of 30 containing the base sequence of base numbers 8 to 22 in SEQ ID NO: 31 on the 3 ′ end side A set of a PCR primer consisting of a base DNA and a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 4-18 in SEQ ID NO: 32 on the 3 ′ end side; base numbers 6-20 in SEQ ID NO: 33 PCR primer consisting of a DNA with a maximum of 30 bases containing the nucleotide sequence of 3 'end side and a PCR primer consisting of a DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 34 at the 3' end side; Detection of trees containing one or more sets of Tsu door, and the like.

  Preferably, the PCR primer is composed of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side, and a DNA comprising a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side. Set with a PCR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 3 at the 3 ′ end and a DNA of up to 30 bases containing the base of SEQ ID NO: 4 at the 3 ′ end Set with a PCR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 5 at the 3 ′ end and a DNA of up to 30 bases containing the base of SEQ ID NO: 6 at the 3 ′ end Set with a PCR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 7 at the 3 'end and a DNA of up to 30 bases containing the base of SEQ ID NO: 8 at the 3' end Set with PCR primer; base sequence of SEQ ID NO: 9 on the 3 'end side A set of a PCR primer consisting of a maximum of 30 bases of DNA and a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 10 at the 3 ′ end; the base sequence of SEQ ID NO: 11 at the 3 ′ end A set of a PCR primer consisting of a maximum of 30 bases of DNA and a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 12 at the 3 ′ end; the base sequence of SEQ ID NO: 13 at the 3 ′ end A set of a PCR primer consisting of up to 30 bases of DNA and a PCR primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 14 at the 3 ′ end; the base sequence of SEQ ID NO: 15 at the 3 ′ end A set of a PCR primer consisting of up to 30 bases of DNA and a PCR primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 16 at the 3 ′ end; the base sequence of SEQ ID NO: 17 at the 3 ′ end PCR primers consisting of up to 30 bases of DNA and SEQ ID NO: 18 Set with a PCR primer consisting of a DNA with a maximum of 30 bases containing the base sequence on the 3 ′ end side; a PCR primer consisting of a DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 19 on the 3 ′ end side; Set with a PCR primer consisting of DNA of up to 30 bases containing the base sequence at the 3 ′ end; PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 21 at the 3 ′ end; Set with a PCR primer consisting of DNA of up to 30 bases containing the base sequence at the 3 ′ end; PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 23 in the sequence listing at the 3 ′ end, and sequence Set with a PCR primer consisting of up to 30 bases of DNA containing the base sequence of number 24 on the 3 ′ end; PCR primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 25 on the 3 ′ end, and sequence P consisting of DNA with a maximum of 30 bases containing the base sequence of number 26 on the 3 ′ end side Set with CR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 27 at the 3 ′ end and a DNA of up to 30 bases containing the base of SEQ ID NO: 28 at the 3 ′ end Set with a PCR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 29 at the 3 ′ end and a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 30 at the 3 ′ end Set with a PCR primer; consisting of a PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 31 at the 3 ′ end and a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 32 at the 3 ′ end Set with PCR primer; consisting of PCR primer consisting of up to 30 bases of DNA containing SEQ ID NO: 33 at the 3 ′ end and DNA of up to 30 bases containing SEQ ID NO: 34 at the 3 ′ end Nuts detection key containing one or more sets of PCR primers Door and the like.

Among them, a set of a PCR primer consisting of the base sequence of SEQ ID NO: 1 and a PCR primer consisting of the base sequence of SEQ ID NO: 2 is particularly preferable;
A set of a PCR primer consisting of the base sequence of SEQ ID NO: 3 and a PCR primer consisting of the base sequence of SEQ ID NO: 4; a PCR primer consisting of the base sequence of SEQ ID NO: 5 and a PCR primer consisting of the base sequence of SEQ ID NO: 6 Set; PCR primer consisting of the base sequence of SEQ ID NO: 7 and PCR primer consisting of the base sequence of SEQ ID NO: 8; PCR primer consisting of the base sequence of SEQ ID NO: 9 and PCR primer consisting of the base sequence of SEQ ID NO: 10 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 11 and a PCR primer consisting of the base sequence of SEQ ID NO: 12; a PCR primer consisting of the base sequence of SEQ ID NO: 13, and a PCR primer consisting of the SEQ ID NO: 14 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 15 and a PCR primer consisting of the base sequence of SEQ ID NO: 16; a base sequence of SEQ ID NO: 17 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 18; a set of a PCR primer consisting of the base sequence of SEQ ID NO: 19 and a PCR primer consisting of the base sequence of SEQ ID NO: 20; A set of a PCR primer consisting of a base sequence and a PCR primer consisting of a base sequence of SEQ ID NO: 22; a set of a PCR primer consisting of a base sequence of SEQ ID NO: 23 of the sequence listing and a PCR primer consisting of a base sequence of SEQ ID NO: 24 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 25 and a PCR primer consisting of the base sequence of SEQ ID NO: 26; a PCR primer consisting of the base sequence of SEQ ID NO: 27 and a PCR primer consisting of the base sequence of SEQ ID NO: 28; A set of a PCR primer consisting of the base sequence of SEQ ID NO: 29 and a PCR primer consisting of the base sequence of SEQ ID NO: 30; a salt of SEQ ID NO: 31 A set of a PCR primer consisting of the sequence and a PCR primer consisting of the base sequence of SEQ ID NO: 32; one or more sets of a PCR primer consisting of the base sequence of SEQ ID NO: 33 and a PCR primer consisting of the base sequence of SEQ ID NO: 34 A nut detection kit containing
Moreover, the nut detection kit etc. which contain each said primer set and the probe for detecting the PCR amplification product amplified with each said primer set, etc. are mentioned.

The kit can contain appropriate reagents and various containers according to the purpose of use. Specifically, polymerization reagents for synthesizing PCR primer extension products, such as heat-resistant DNA polymerase, deoxyribonucleotides, magnesium, and buffers for PCR reactions, and storage that can maintain their quality appropriately Containers and the like can be included.

Examples Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not construed as being limited to these examples. The present invention can be changed as appropriate without departing from the gist of the present invention.

Example 1
Confirmation of detection specificity of PCR primer set for tree nut detection for DNA derived from various animals, plants, fungi and bacteria <br/> To confirm the effectiveness of PCR analysis method using PCR primer set for tree nut detection of the present invention Furthermore, an experiment for examining the detection specificity of PCR for various organism-derived DNAs was performed as follows.

Purified human DNA used was purchased from Semain (CeMines, LLC, USA).

Purified DNA of cattle, pigs, chickens, shrimp, king crab, cuttlefish, sockeye salmon, and chub mackerel were frozen with the (muscle) flesh of each sample purchased from a store and then crushed with a multi-bead shocker (Yasui Kikai, Osaka) Prepared from samples using Nucleon PhytoPure, plant and fungal DNA extraction kits (GE Healthcare Biosciences Corp., USA), DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan), or DNeasy Blood & Tissue kit (Qiagen GmbH, Germany) I used something.

Pepper, Chinese yam, leek, coconut, date palm, acai, banana, macadamia nut (from Australia, Kenya), lotus root, groundnut, soybean, almond (from America, Spain), peach, prunes, ume, plum, apricot, cherry , Apple, loquat, strawberry, pumpkin, pecan nut, walnut (from USA, France), hazelnut, pilnut, cashew nut (from India, Vietnam), pistachio (from Iran, USA), mango, pink pepper, lychee, Rambutan, cabbage, Brazil nut, shea nut, miracle fruit, oyster, tea, kiwi fruit, blueberry, sesame, potato, carrot, ginkgo and pine nut were purchased from a store, and rice was obtained from a domestic farmer. For these purified DNAs, a portion of each sample (seed, pericarp, leaf, tuber) was washed with 70% ethanol, and then quickly washed with TE buffer, followed by a multi-bead shocker (Yasui Kikai, Osaka). ), Using Genomic-tip 20 / G (Qiagen GmbH, Germany), DNeasy plant Mini kits (Qiagen GmbH, Germany), Nucleon PhytoPure, plant and fungal DNA extraction kits, or DNA Extraction Isoplant II kit We used what we did.

  The purified DNA of buckwheat and wheat was prepared from buckwheat flour and wheat flour purchased from a store using Genomic-tip 20 / G.

  The purified corn DNA used was purchased from BioChain Institute, Inc., USA.

  The purified DNA of hickory nuts (overtah hickory) was prepared using DNeasy Plant Mini Kit from leaves distributed from the Botanical Gardens attached to the University of Tokyo Graduate School of Science.

  Purified DNA of chestnuts (Japanese chestnut, chrysanthemum, European chestnut) was prepared using the DNeasy Plant Mini Kit from leaves provided by the National Institute of Agricultural Sciences, National Agriculture and Food Research Organization.

  Purified DNA of chestnut (chincapine) was prepared using a DNeasy Plant Mini Kit from leaves distributed from Tama Forest Science Park, National Forest Research Institute.

  As the purified DNA of beech nuts (beech, dog beech), shii, and acorn (shirakashi), those prepared from leaves obtained from nature using the DNeasy Plant Mini Kit were used.

  Purified DNA of Pichia anomala (Pichia anomala IFO 0144) and Bacillus cereus (Bacillus cereus ATCC11950) was cultured in an appropriate medium, and then the puregene Yeast and Gram-Positive DNA Isolation kit ( Gentra Systems Inc., USA) was used. All purified DNAs have been subjected to RNA removal by RNase.

  SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, Each PCR primer described in 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34 was synthesized by Eurofin Genomics and used in the following PCR.

  After measuring the amounts of various animal, plant, fungal, and bacterial DNAs prepared as described above, the DNA concentration was adjusted to 10 ng / μL using sterile water. A 20 μL reaction solution containing 5 μL of the prepared DNA sample solution was prepared using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara Bio Inc., Japan) manufactured by Takara Bio Inc. This reagent contains TaKaRa Ex Taq HS (hot start type), dNTP Mixture, Mg2 + and SYBR Green I in the solution. The reaction solution was prepared as a composition containing 250 nM sense primer and 250 nM antisense primer based on SYBR Premix ExTaq. PCR reaction is performed with LightCycler (Roche Diagnostics GmbH, Germany), and amplification reaction conditions are as follows.

  After one cycle of 95 ° C for 1 minute, heat up to 95 ° C at a rate of 20 ° C / s, hold at that temperature for 5 seconds, then drop to 68 ° C at a rate of 20 ° C / s, The temperature was kept at the same temperature for 2 seconds, further heated to 72 ° C. at a rate of 10 ° C./second, and then subjected to 35 amplification cycles comprising 3 steps of keeping at the same temperature for 30 seconds. The PCR amplification product was recorded as the SYBR Green I-dependent fluorescence amount at the final step of each cycle. When amplification is confirmed from the amount of fluorescence, the PCR amplification product (5 μL of the reaction solution) is separated by 2% (wt / vol) agarose gel electrophoresis, and the amplification product is extracted using Gel DOC EZ (Bio Rad). The presence or absence of the amplification product was confirmed by visualization. OneMARK 100 (GeneDireX) was used as a molecular weight marker. When an amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are listed in Table 1. In the table, + (plus) indicates a positive PCR reaction, and-(minus) indicates a negative PCR reaction.

  When using PCR primers for almond detection (PCR primer set consisting of SEQ ID NOS: 1 and 2), an amplification product of around 515 bp was confirmed only when using almond (American and Spanish) DNA, and judged positive. (table 1). It was negative when related species such as peach DNA, prune DNA, plum DNA, plum DNA, apricot DNA, cherries DNA, and other species DNA including other plants were used (Table 1).

  In addition, when a beach nut detection PCR primer (PCR primer set consisting of SEQ ID NOs: 3 and 4) was used, an amplification product of about 75 bp was confirmed only when beach nut (beech, dog beech) DNA was used, and judged positive. (Table 1). Related species are chestnut (Japanese chestnut, chrysanthemum, European chestnut, chincapine) DNA, shii DNA, acorn (shirakashi) DNA, pecan nut DNA, hickory nut DNA, walnut (from America, France) DNA, hazelnut DNA, When using other species DNA including other plants, it was negative (Table 1).

  In addition, when PCR primers for Brazil nut detection (PCR primer set consisting of SEQ ID NOs: 5 and 6) were used, an amplification product of about 91 bp was confirmed only when Brazil nut DNA was used, and was determined to be positive (Table 1). ). When using related species such as Shea nut DNA, Miracle fruit DNA, Oyster DNA, Tea DNA, Kiwi fruit DNA, Blueberry DNA and other species DNA including other plants, it was negative (Table 1). ).

  In addition, when using cashew nut detection PCR primers (PCR primer set consisting of SEQ ID NOs: 7 and 8), an amplification product of around 102 bp was confirmed only when cashew nut (Indian and Vietnamese) DNA was used, and judged positive. (Table 1). When using related species pistachio (Iranian and American) DNA, mango DNA, pink pepper DNA, and other species DNA including other plants, it was negative (Table 1).

  In addition, when chestnut detection PCR primers (PCR primer set consisting of SEQ ID NOs: 9 and 10) were used, amplification products of around 293 bp were confirmed only when chestnut (Japanese chestnut, chrysanthemum, European chestnut, tincapine) DNA was used. The result was positive (Table 1). Includes related species such as beach nut (beech, beech) DNA, shii DNA, acorn (birch) DNA, pecan nut DNA, hickory nut DNA, walnut (American, French) DNA, hazelnut DNA, and other plants When other species DNA was used, it was negative (Table 1).

  In addition, when a coconut detection PCR primer (PCR primer set consisting of SEQ ID NOs: 11 and 12) was used, an amplification product of around 224 bp was confirmed only when coconut DNA was used, and was determined to be positive (Table 1). It was negative when related species such as date palm DNA, acai DNA, and other species DNA including other plants were used (Table 1).

  In addition, when PCR primers for detecting gingko (PCR primer set consisting of SEQ ID NOs: 13 and 14) were used, an amplification product of around 186 bp was confirmed only when gingko DNA was used, and it was determined to be positive (Table 1). When using other species DNA including other plants, it was negative (Table 1).

  When the hazelnut detection PCR primer (PCR primer set consisting of SEQ ID NOs: 15 and 16) was used, an amplification product of around 361 bp was confirmed only when hazelnut DNA was used, and was determined to be positive (Table 1). Related species such as pecan nut DNA, hickory nut DNA, walnut (American and French) DNA, chestnut (Japanese chestnut, chrysanthemum, European chestnut, chincapine) DNA, beach nut (beech, beech) DNA, shii DNA, acorn (Shirakashi) When using DNA or other species DNA including other plants, it was negative (Table 1).

  When PCR primers for detecting hickory nuts (PCR primer set consisting of SEQ ID NOs: 17 and 18) were used, amplification products of around 543 bp were confirmed only when hickory nut (overtaic hickory) DNA and pecan nut DNA were used. The result was positive (Table 1). Related species are walnut (American, French) DNA, chestnut (Japanese chestnut, chrysanthemum, European chestnut, Chinkapin) DNA, beach nut (beech, beech) DNA, hazelnut DNA, shy DNA, acorn (shirakashi) DNA, When using other species DNA including other plants, it was negative (Table 1).

  Further, when PCR primers for lychee detection (PCR primer set consisting of SEQ ID NOs: 19 and 20) were used, an amplification product of around 162 bp was confirmed only when lychee DNA was used, and was determined to be positive (Table 1). It was negative when using the related species Rambutan DNA or other species DNA including other plants (Table 1).

  In addition, when the PCR primer for detecting macadamia nut (PCR primer set consisting of SEQ ID NOs: 21 and 22) was used, an amplification product of around 111 bp was confirmed only when macadamia nut (Australia and Kenya) DNA was used. (Table 1). It was negative when related species such as lotus root DNA and other species including other plants were used (Table 1).

  In addition, when PCR primers for pecan nut detection (PCR primer set consisting of SEQ ID NOs: 23 and 24) were used, an amplification product of around 468 bp was confirmed only when pecan nut DNA was used, and was determined to be positive (Table 1). ). Related species are hickory nut (overtah hickory) DNA, walnut (from USA, France) DNA, chestnut (Japanese chestnut, chrysanthemum, European chestnut, chincapine) DNA, beach nut (beech, beech) DNA, hazelnut DNA, Negative results were obtained when shii DNA, acorn DNA, and other species DNA including other plants were used (Table 1).

  In addition, when using a pine nut detection PCR primer (PCR primer set consisting of SEQ ID NOs: 25 and 26), an amplification product of around 139 bp was confirmed only when pine nut DNA was used, and determined to be positive ( table 1). When using other species DNA including other plants, it was negative (Table 1).

  In addition, when a PCR primer for detection of pyrinut (PCR primer set consisting of SEQ ID NOs: 27 and 28) was used, an amplification product of about 83 bp was confirmed only when pyrnuts DNA was used, and was determined to be positive (Table 1). Related species including cashew nut (Indian, Vietnamese) DNA, pistachio (Iranian, American) DNA, mango DNA, pink pepper DNA, lychee DNA, rambutan DNA, orange DNA, and other plants including other plants When species DNA was used, it was negative (Table 1).

  In addition, when pistachio detection PCR primers (PCR primer set consisting of SEQ ID NOs: 29 and 30) were used, amplification products of around 163 bp were confirmed only when pistachio (Iran, USA) DNA was used, and judged positive (Table 1). When using related species such as cashew nut (Indian and Vietnamese) DNA, mango DNA, pink pepper DNA and other species DNA including other plants, it was negative (Table 1).

  In addition, when the PCR primer for detecting shea nut (PCR primer set consisting of SEQ ID NOs: 31 and 32) was used, an amplification product of about 518 bp was confirmed only when shea nut DNA was used, and it was determined to be positive (Table 1). It was negative when using related species such as Miracle Fruit DNA, Brazil Nut DNA, Oyster DNA, Tea DNA, Kiwi Fruit DNA, Blueberry DNA, and other species DNA including other plants ( table 1).

  In addition, when PCR primers for walnut detection (PCR primer set consisting of SEQ ID NOs: 33 and 34) were used, amplification products of around 501 bp were confirmed only when walnut (American and French) DNA was used and judged positive. (Table 1). Related species, pecan nut DNA, hickory nut (over-hickory) DNA, chestnut (Japanese chestnut, chrysanthemum, European chestnut, chincapine) DNA, beach nut (beech, beech) DNA, hazelnut DNA, shy DNA, acorn (shirakashi) ) DNA and other species including other plants were negative (Table 1).

Example 2
Confirmation of PCR Detection Sensitivity Using Tree Fruit Detection PCR Primer Set In order to examine PCR detection sensitivity using the tree fruit detection PCR primer set used in Example 1, the following experiment was performed. Almond (from USA), beach nut (beech), Brazil nut, cashew nut (from India), chestnut (Chugokuguri), coconut, hazelnut, ginkgo, lychee, macadamia nut (from Australia) prepared in Example 1, pecan nut , Pine nuts, pyrnuts, pistachios (from USA), shea nuts, and walnuts (from USA) diluted in sterile water, 1 fg / μl, 10 fg / μl, 100 fg / μl, 1 pg / μl A dilution series of 10 pg / μl and 100 pg / μl DNA solutions was prepared, and 1 μL of these diluted test DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1. After the PCR reaction, the presence or absence of the amplified product was confirmed by agarose gel electrophoresis.

  As shown in Fig. 1, the detection sensitivity when using PCR primers for almond detection (PCR primer set consisting of SEQ ID NOs: 1 and 2) is 100 fg DNA / analysis, and PCR primers for beach nut detection (SEQ ID NO: Detection sensitivity when using PCR primer set consisting of 3 and 4) is 10 fg DNA / analysis, and detection when using PCR primer for Brazil nut detection (PCR primer set consisting of SEQ ID NO: 5 and 6) Sensitivity is 100 fg DNA / analysis, and detection sensitivity is 1 pg DNA / analysis when using PCR primers for cashew nut detection (PCR primer set consisting of SEQ ID NOs: 7 and 8), PCR primer for chestnut detection Detection sensitivity when using (PCR primer set consisting of SEQ ID NO: 9 and 10) is 1 pg DNA / analysis, PCR primer for detecting coconut (PC consisting of SEQ ID NO: 11 and 12) The detection sensitivity when using the R primer set is 100 pg DNA / analysis, and the detection sensitivity when using the PCR primer set for detecting ginkgo (PCR primer set consisting of SEQ ID NOs: 13 and 14) is 100 fg DNA Detection sensitivity when using PCR primers for detection of hazelnut (PCR primer set consisting of SEQ ID NOs: 15 and 16) is 100 fg DNA / analysis, and PCR primers for detection of hickory nuts (SEQ ID NO: 17 and Detection sensitivity when using PCR primer set consisting of 18) is 100 fg DNA / analysis, and detection sensitivity when using PCR primer for lychee detection (PCR primer set consisting of SEQ ID NO: 19 and 20) is 100 fg DNA / analysis, and the detection sensitivity when using the PCR primer for detecting macadamia nut (PCR primer set consisting of SEQ ID NOs: 21 and 22) is 100 fg DNA / analysis. The detection sensitivity when using PCR primers for detecting pecan nuts (PCR primer set consisting of SEQ ID NOs: 23 and 24) is 10 fg DNA / analysis, and PCR primers for detecting pine nuts (SEQ ID NOs: 25 and 26). The detection sensitivity is 100 fg DNA / analysis, and the detection sensitivity is 100 when using the PCR primer for detection of pyrinut (PCR primer set consisting of SEQ ID NOs: 27 and 28). Detection sensitivity when using pistachio detection PCR primer (PCR primer set consisting of SEQ ID NOs: 29 and 30) is 100 fg DNA / analysis and shea nut detection PCR primer (SEQ ID NO: 31) Detection sensitivity is 10 fg DNA / analysis, and PCR primer set for walnut detection (PCR primer set consisting of SEQ ID NOs: 33 and 34) is used. The detection sensitivity was 1 fg DNA / analysis.

Example 3
Detection of DNA derived from nuts in foods containing nuts by PCR using PCR primer sets for detecting nuts PCR analysis using PCR primer sets for detecting nuts of the present invention for commercial foods containing various nuts as raw materials is as follows The practicality of the present invention was examined.

  Commercial foods (Table 2) clearly containing various nuts as raw materials were prepared, and 10 to 100 g was pulverized with a multi-bead shocker. Each DNA was extracted from 2 g of the mixed crushed material using Genomic-tip 20 / G kit. At the time of extraction, RNA was also removed by RNase. After measuring the amount of the extracted food sample DNA, the concentration of the food sample DNA was adjusted to 10 ng / μL using sterilized water. Since it was difficult to obtain commercially available foods containing beach nuts, hickory nuts and shea nuts as raw materials, 10 pg of each DNA was added to a coconut sable (Nisshin Cisco) DNA solution (10 ng / μL) as an alternative sample. The one added at a concentration of / μL was used. 5 μL of these prepared DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1 using the PCR primer set for tree nut detection used in Example 1. When amplification is confirmed from the amount of fluorescence, the PCR amplification product (5 μL of the reaction solution) is separated by 2% (wt / vol) agarose gel electrophoresis, and the amplification product is extracted using Gel DOC EZ (Bio Rad). The presence or absence of the amplification product was confirmed by visualization. OneMARK 100 (GeneDireX) was used as a molecular weight marker. When an amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are listed in Table 2. In the table, + (plus) indicates a positive PCR reaction, and-(minus) indicates a negative PCR reaction. Furthermore, the PCR amplification product amplified from the food sample DNA was directly sequenced from both directions using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), and then the base sequence was determined using the Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems). Was analyzed. Analyze the analyzed base sequence data with GenBank nucleotide sequence database (BLAST search) or the DNA database owned by the inventors, and assign the species of DNA derived from PCR amplification products based on the similarity of the base sequence. Identified.

  As a result, when using almond detection PCR primers (PCR primer set consisting of SEQ ID NO: 1 and 2), almond-containing foods such as Really Nutty Muesli (Dorset Cereal) and Petit Chocolate Leaf Pie (El Madron) DNA Only, an amplification product of around 515 bp was confirmed and judged positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the nucleotide sequence analysis of the PCR amplification product, the nucleotide sequence of the PCR amplification product amplified from the DNA derived from Really Nutty Muesli (Dorset Cereal) and Petit Chocolate Leaf Pi (El Madron) matches the ITS nucleotide sequence of Almond did. That is, PCR using the PCR primer does not detect almond-derived DNA or other DNA from almond-free food samples in multiple commercially available foods, but can specifically detect almond-derived DNA from almond-containing food samples. confirmed.

  In addition, when PCR primers for detecting beach nuts (PCR primer set consisting of SEQ ID NOs: 3 and 4) are used, derived from an alternative sample of food containing beach nuts [coconut sable with added 50pg beach nut DNA (Nisshin Cisco)] Only in DNA, an amplification product of around 75 bp was confirmed and judged positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of the beach nut-containing food matched the ITS base sequence of beach nut. That is, PCR using the PCR primer does not detect beach nut-derived DNA or other DNA from a beach nut-free food sample in a plurality of commercially available foods, but a small amount of beach added to the beach nut-free food. It was confirmed that the nut-derived DNA could be specifically detected.

  In addition, when using PCR primers for detection of Brazil nuts (PCR primer set consisting of SEQ ID NOs: 5 and 6), amplification products of around 91 bp only in DNA derived from Brazil nut-containing foods, Really Nutty Muesli (Dorset Cereal) Was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Really Nutty Muesli (Dorset cereal) coincided with the ITS base sequence of Brazil nut. In other words, PCR using the PCR primer does not detect Brazil nut-derived DNA or other DNA from Brazil nut-free food samples, but specifically detects Brazil nut-derived DNA from Brazil nut-containing food samples. It was confirmed that it could be detected.

  In addition, when PCR primers for detecting cashew nuts (PCR primer set consisting of SEQ ID NOS: 7 and 8) are used, DNA derived from cashew nut-containing foods, such as Really Nutty Muesli (Dorset Cereal) and Triple Nuts Chocolate (Merry Chocolate Company) Only, an amplification product of about 102 bp was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the nucleotide sequence analysis of the PCR amplification product, the nucleotide sequence of the PCR amplification product amplified from the DNA derived from Really Nutty Muesli (Dorset Cereal) and Triple Nuts Chocolate (Merry Chocolate Company) matches the ITS nucleotide sequence of cashew nut did. That is, PCR using the PCR primer does not detect cashew nut-derived DNA or other DNA from cashew nut-free food samples in a plurality of commercially available foods, but can specifically detect cashew nut-derived DNA from cashew nut-containing food samples. confirmed.

  In addition, when using chestnut detection PCR primers (PCR primer set consisting of SEQ ID NOs: 9 and 10), an amplification product of around 293 bp was confirmed only in chestnut bun (Yamahisa YK) -derived DNA, which is a chestnut-containing food. , Positive. When DNA from other food samples was used, it was negative (Table 2). As a result of analysis of the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Kuri bun (Yamahisa YK) coincided with the chestnut ITS base sequence. That is, PCR using the PCR primer does not detect chestnut-derived DNA or other DNA from chestnut-free food samples in multiple commercial foods, but confirms that chestnut-derived DNA can be specifically detected from contained food samples did.

  In addition, when PCR primer for detecting coconut (PCR primer set consisting of SEQ ID NOs: 11 and 12) is used, in coconut-containing foods, triple nut chocolate (Merry Chocolate Company) and coconut sable (Nisshin Cisco) DNA Only an amplification product of around 224 bp was confirmed and judged positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from triple nut chocolate (Merry Chocolate Company) and coconut sable (Nisshin Cisco) matched the ITS base sequence of coconut. . That is, PCR using the PCR primer does not detect coconut-derived DNA or other DNA from coconut-free food samples in multiple commercially available foods, but can specifically detect coconut-derived DNA from coconut-containing food samples. confirmed.

  In addition, when PCR primers for detection of ginkgo (PCR primer set consisting of SEQ ID NOs: 13 and 14) were used, amplification products of around 186 bp were confirmed only in DNA derived from Ginkgo-containing food, Ginnan Yotsugi (Yamagishi Motors). , Positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Kinnan Yoro (Yamagishi Motors) matched the chloroplast matK gene sequence of Ginkgo. That is, PCR using the PCR primers does not detect ginkgo-derived DNA or other DNA from ginko-free food samples in multiple commercially available foods, but can specifically detect gingko-derived DNA from ginkgo-containing food samples. confirmed.

  In addition, when PCR primers for detecting hazelnuts (PCR primer set consisting of SEQ ID NOs: 15 and 16) are used, amplification products of around 361 bp are present only in DNA derived from the hazelnut-containing food, Really Nutty Muesli (Dorset Cereal). Confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Really Nutty Muesli (Dorset cereal) matched the ITS base sequence of hazelnut. That is, PCR using the PCR primers does not detect hazelnut-derived DNA or other DNA from hazelnut-free food samples in multiple commercially available foods, but can specifically detect hazelnut-derived DNA from hazelnut-containing food samples. confirmed.

  In addition, when PCR primers for detecting hickory nuts (PCR primer set consisting of SEQ ID NOs: 17 and 18) are used, derived from alternative samples of foods containing hickory nuts [coconut sable with added 50 pg hickory nut DNA (Nisshin Cisco)] Only in triple nut chocolate (Merry Chocolate Company), which is a food containing DNA and pecan nuts, an amplification product of around 543 bp was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the substitute sample of the food containing hickory nuts and the DNA derived from triple nut chocolate (Merry Chocolate Company) is the ITS base sequence of hickory nuts. Matched. In other words, PCR using the PCR primer does not detect hickory-derived DNA or other DNA from hickory nut-free food samples in a plurality of commercially available foods, but does not detect pecan nut-containing food samples and hickory nut-free foods. It was confirmed that a small amount of added hickory nut-derived DNA could be specifically detected.

  In addition, when PCR primers for lychee detection (PCR primer set consisting of SEQ ID NOs: 19 and 20) were used, amplification products of around 162 bp were confirmed only in DNA derived from fruit therapy white peach (Fujikko), which is a lychee-containing food. And determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the fruit therapy white peach (Fujikko) -derived DNA was identical to the ITS base sequence of litchi. That is, PCR using the PCR primer does not detect lychee-derived DNA or other DNA from lychee-free food samples in multiple commercially available foods, but can specifically detect lychee-derived DNA from lychee-containing food samples. confirmed.

  In addition, when the PCR primer for detecting macadamia nut (PCR primer set consisting of SEQ ID NOs: 21 and 22) is used, the amplification product of around 111 bp only in the macadamia nut-containing food, petit chocolate leaf pie (El Madron) -derived DNA Was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from petit chocolate leaf pie (El Madron) coincided with the ITS base sequence of macadamia nut. That is, PCR using the PCR primer does not detect macadamia nut-derived DNA or other DNA from macadamia nut-free food samples in a plurality of commercially available foods, but specifically identifies macadamia nut-derived DNA from macadamia nut-containing food samples. It was confirmed that it could be detected.

  When PCR primers for detecting pecan nuts (PCR primer set consisting of SEQ ID NOS: 23 and 24) are used, amplification products of around 468 bp are produced only in triple nut chocolate (Merry Chocolate Company), which is a pecan nut-containing food. Confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from triple nut chocolate (Merry Chocolate Company) coincided with the ITS base sequence of pecan nut. That is, PCR using the PCR primer does not detect pecannut-derived DNA or other DNA from pecannut-free food samples in multiple commercial foods, but specifically detects pecannut-derived DNA from pecannut-containing food samples. It was confirmed that it could be detected.

  In addition, when using PCR primers for detection of pine nuts (PCR primer set consisting of SEQ ID NOs: 25 and 26), only 139 bp of spaghetti sauce basil (Sb food) that only mixes pine nuts-containing food Amplification product was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the spaghetti sauce basil (S.B. food) as much as possible matched the ITS base sequence of pine nuts. That is, PCR using the PCR primer does not detect pine nut-derived DNA or other DNA from pine nut-free food samples in a plurality of commercially available foods, but does not detect pine nut-derived food samples. It was confirmed that DNA could be specifically detected.

  In addition, when PCR primer for detection of pyrinut (PCR primer set consisting of SEQ ID NOs: 27 and 28) is used, amplification product of around 83 bp is confirmed only in LA2PU CRISPY PILINUT with Garlic, which is a food containing pyrnuts. And determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from LA2PU CRISPY PILINUT with Garlic (Royal Conzern) coincided with the ITS base sequence of pyrinut. That is, PCR using the PCR primer does not detect pyrinut-derived DNA or other DNA from food samples containing no pyrnuts in a plurality of commercially available foods, but can specifically detect pyrinut-derived DNA from food samples containing pyrnuts. confirmed.

  In addition, when PCR primers for pistachio detection (PCR primer set consisting of SEQ ID NOs: 29 and 30) were used, amplification products of around 163 bp were confirmed only in pistachio-containing foods, petit chocolate leaf pie (El Madron) -derived DNA And determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Petit Chocolate Leaf Pi (El Madron) coincided with the ITS base sequence of pistachio. That is, PCR using the PCR primer does not detect pistachio-derived DNA or other DNA from pistachio-free food samples in multiple commercial foods, but can specifically detect pistachio-derived DNA from pistachio-containing food samples. confirmed.

  In addition, when using PCR primers for detecting shea nuts (PCR primer set consisting of SEQ ID NOS: 31 and 32), only for DNA derived from alternative samples of food containing shea nuts [coconut sable with added 50pg shea nut DNA (Nisshin Cisco)] An amplification product of around 518 bp was confirmed and judged positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of the shea nut-containing food matched the ITS base sequence of shea nut. That is, PCR using the PCR primer does not detect shea nut-derived DNA or other DNA from a shea nut-free food sample in a plurality of commercially available foods, but does not detect a small amount of shea nut-derived DNA added to the shea nut-free food sample. It was confirmed that it could be detected specifically.

  In addition, when PCR primers for walnut detection (PCR primer set consisting of SEQ ID NOs: 33 and 34) were used, amplification products of around 501 bp were confirmed only in DNA from walnut-containing food, Azuki walnut Danish (Shikishima bread) And determined to be positive. When DNA from other food samples was used, it was negative (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Azuki walnut Danish (Shikishima bread) was consistent with the ITS base sequence of walnuts. That is, PCR using the PCR primer does not detect walnut-derived DNA or other DNA from walnut-free food samples in multiple commercial foods, but can specifically detect walnut-derived DNA from walnut-containing food samples. confirmed.

Claims (4)

  A PCR primer consisting of a DNA with a maximum of 30 bases including the base sequence of base numbers 7 to 21 in the sequence table in SEQ ID NO: 3 on the 3 ′ end side, and 3 base sequences of base numbers 6 to 20 in SEQ ID NO: 4 in the sequence list A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases included at the end.   A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 29 in the sequence listing on the 3 ′ end side, and 3 base sequences of base numbers 15-29 in SEQ ID NO: 30 in the sequence listing A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases included at the end.   A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 1 using the DNA as a template, and beach nuts are present in the sample by detecting the amplified DNA. And a method for detecting beach nuts.   A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 2 using the DNA as a template, and whether pistachio is present in the sample by detecting the amplified DNA And a method for detecting whether or not.

Images