JP4385262B2 - Primer and specific plant detection method - Google Patents

Description

  The present invention is intended to detect kiwifruit, walnuts, apples, sweet potatoes, bananas, and soybeans in a specific plant that may cause allergies, and when the specific plant is contained in a food material or product, The present invention relates to a method for detecting a specific plant that enables detection with high sensitivity even in a small amount, and a PCR primer, primer set, and kit used in the method.

  From the viewpoint of preventing the occurrence of health hazards for people with a specific allergic constitution, among foods that have been found to cause food allergies, it is necessary to display them, especially considering the number of cases and severity. For processed foods that contain high wheat, buckwheat, egg, milk, and peanuts (hereinafter referred to as “specified raw materials”), it shall be stated in the product that the specified raw materials are included (Ministry of Health, Labor and Welfare, Pharmacy Foods On the enforcement of the Ministerial Ordinance to revise a part of the Ministerial Ordinance concerning the notification of the Director of Health, the Food Sanitation Law Enforcement Regulations and the ingredient standards of milk and dairy products, etc., March 15, 2001; In addition, abalone, squid, shrimp, crab, salmon, mackerel, chicken, pork, how much, beef, gelatin, orange, kiwifruit, walnut, soybean, matsutake, peach, yam, apple and banana According to research on the elucidation of food allergies and allergens, serious health hazards have been seen at certain frequencies in the past in research on the elucidation of food allergies and allergens. Therefore, for processed foods that contain these as raw materials, it is recommended that efforts be made to indicate as much as possible that the foods are included as raw materials (Ministry of Health, Labor and Welfare) As for the enforcement of ministerial ordinances to revise a part of the ministerial ordinances on milk and dairy product ingredient standards, etc., March 15, 2001, Shokuhatsu No. 79) ( Regarding the enforcement of the Ordinance for Enforcement of the Ordinance for Enforcement of the Goods Sanitation Act and the Ministerial Ordinance on Milk and Dairy Product Component Standards, etc. No. 1224002 from Shokuyasu).

  Food ingredients that may cause allergies, especially allergen-causing animals and plants, can be mixed in unintended traces in the production, distribution, and processing stages. It is important to perform quality control of whether or not

  Methods for detecting wheat, buckwheat, egg, milk, and peanuts, which are “specific raw materials”, have been established using ELISA, Western blot, or PCR, and such detection methods are commercially available as test kits. (The Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, Department of Food and Drug Administration, General Manager of Food Health, Notice of foods containing allergens, November 6, 2002, No. 1106001) On the other hand, detection methods for “similar to specified raw materials” have been reported in chicken, pork and beef (Japanese Patent Laid-Open No. 2003-230383 “Primer for detection of beef, pork and chicken”) (Meyer R., C. Hofelein, J. Luthy, and U. Candrian; Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food; Journal of AOAC International, 78: 1542-1551, 1995) (Takamitsu Matsunaga, Kiyohiro Shibata, Junichi Yamada, Yu Shinmura; Meat speciation of meat and meat products by multiplex PCR method; Journal of Japanese Society for Food Science and Technology, 46: 187-194, 1999), Abalone, Squid, Shrimp, Crab, Salmon, Mackerel, How much, Gelatin , Orange, kiwifruit, walnut, soy, matsutake, peach, yam, apple and banana detection methods have not been reported to date. Therefore, it is currently difficult to perform quality control with scientific verification regarding the presence or absence of contamination of specific animals and plants corresponding to “things based on specific raw materials” for which these detection methods are unclear.

  When detecting target organisms from food ingredients and products that have undergone various processing steps, a method that detects proteins characteristic of the target organisms (ELISA), as established by the “specific raw material” testing method Method and Western blot method) and methods that detect DNA base sequences that are characteristic of the organism to be detected (PCR method) are promising methods. , November 06, 2002, Food Departure No. 1106001). In general, proteins are less stable to various processings in the food production process than DNA, and therefore, the method for detecting proteins is likely not applicable to highly processed test foods. Therefore, the detection method targeting DNA base sequences, which are considered to be relatively stronger in processing than protein, is a method for examining the presence of target organisms in food ingredients and products that have undergone various processing steps. As a promising method. In addition, DNA sequences of animals and plants have base sequences with a large copy number such as rRNA gene clusters. If such a multi-copy base sequence can be used as a target sequence, the sensitivity of the detection method can be increased. It becomes possible. Further, when the base sequence of chloroplast-derived DNA or mitochondrial-derived DNA existing in a plurality of cells is used as a target sequence, it similarly contributes to improvement in sensitivity of the detection method.

  When a genetically modified crop or the like is detected by PCR, the DNA base sequence to be detected is limited to the recombined DNA base sequence. On the other hand, in the case of animals and plants existing in nature, there is no clear knowledge as to which base sequence to select as a detection target from an infinite number of DNA base sequences. In addition, for various animals and plants, there is no clear knowledge as to whether or not it is effective when the selected base sequence is a detection target. Proteins specific to the animals and plants to be detected are selected and targeted to detect the DNA base sequence that encodes the proteins, but in this case, they are specific to each animal and plant. Specific proteins need to be selected. Even if such a specific protein can be selected, the required detection sensitivity may not be obtained if the number of copies of the DNA base sequence is small. It becomes inconvenient.

As a method for identifying or classifying species and varieties of kiwifruit as a test sample, PCR analysis based on RAPD (Non-patent Document 1) and simple sequence repeat polymorphisms of chloroplasts (Non-patent Document 2) has been reported. . In these methods, DNA extracted from a sample whose main test sample is kiwifruit or a single species of plant can be used as a sample, but due to the characteristics of the method, in the case of a sample in which multiple plant species are mixed, Since the PCR primer used is very likely to react with other plant DNA, it is difficult to specifically detect kiwifruit. Therefore, these methods cannot be used to specifically detect kiwifruit DNA in foods containing multiple plants.

In addition, to analyze the molecular phylogeny of the genus Walnut, the ITS (internal transcribed spacer) region of the rRNA gene and the 5.8S rRNA gene sequence or the chloroplast matK (maturase-encoding gene) gene sequence are compared and analyzed. A method has been reported (Non-Patent Document 3). These methods compare the nucleotide sequence analysis of PCR amplification products amplified by universal PCR primers that can amplify the above genes of various plants other than the genus genus, and include plant DNA other than the genus Of course, PCR amplification products derived from such plant DNA are also produced. Therefore, in the case of a sample in which a plurality of plant species are mixed, it is very difficult to specifically detect the genus Walnut by these methods.

Specifically, based on the relationship between the ITS region of various organisms obtained from a known DNA database (GenBank nucleotide sequence database) and the multiplex parallel sequence diagram regarding the 5.8S rRNA gene sequence and the PCR primer sequence, the rRNA gene in the above-mentioned document PCR primer sets [ITS5A (F) (ccttatcatttagaggaaggag: SEQ ID NO: 29) and ITS4 (R) (tcctccgcttattgatatgc: SEQ ID NO: 30)) that amplify the ITS region and 5.8S rRNA gene sequence of It is expected to detect a wide variety of plants such as Gramineae (rice, corn), Solanum (tobacco), Argiaceae (Telebesian companion) and Orchidaceae (Cakiran companion).
Similarly, PCR primer sets [trnK1 (F) (ctcaacggtagagtactcg: SEQ ID NO: 31) and trnK2r (R) that amplify matK in the above-mentioned literature from the relationship between the multiple parallel sequence diagram for the matK gene sequence of chloroplast and the PCR primer sequence. ) (Aactagtcggatggagtag: SEQ ID NO: 32)] is predicted to detect plants of the family Gramineae (rice, corn) and solanaceae (tobacco, potato) in addition to walnuts of the walnut family.

  In addition, to classify apple species and varieties, methods using RAPD markers, methods for comparative analysis of rRNA gene ITS region and 5.8S rRNA gene sequence, or chloroplast matK gene sequence have been reported ( Non-patent document 4). These methods can use DNA extracted from a sample whose main test sample is an apple or a single species of plant as a sample. However, due to the characteristics of the method, this method is used for samples in which multiple plant species are mixed. Since it is highly possible that the PCR primer reacts with other plant DNA, it is difficult to specifically detect apples. Therefore, this method cannot be used to specifically detect apple DNA in foods containing multiple plants.

  In addition, a method using a RAPD marker (Non-Patent Document 5) has been reported to classify varieties and varieties in detail. This method can be used as a sample of DNA extracted from a sample whose main test sample is a potato or a single species of plant, but it is used in the case of a sample in which multiple plant species are mixed due to the characteristics of the method. Since PCR primers that are highly likely to react with other plant DNAs, it is difficult to specifically detect potatoes. Therefore, this method cannot be used to specifically detect yam DNA in foods containing multiple plants.

  Many methods for classifying banana seeds and varieties in detail have been reported. For example, in a report using PCR-RFLP (non-patent document 6) relating to the ITS region of the rRNA gene, PCR primers specifically recognizing banana cultivated banana and wild ITS regions are used. The PCR primer used in this method is capable of amplifying banana plant-derived DNA, and the difference in the number of fragments and the length of the fragments generated after digestion (cutting) of the amplification product with a restriction enzyme. It is possible to classify the species and varieties of Banana plants. However, the cross-reactivity of the PCR primer to other organisms, ie. There is no description regarding the detection specificity, and there is also no description that the DNA of a banana genus plant can be generally identified from a sample containing a plurality of animals and plants such as processed foods. Therefore, it is difficult to say that the method for specifically detecting banana genus plant DNA in foods containing a plurality of animals and plants is a well-validated method.

  As a method for detecting soybean, a plurality of methods using an ELISA method or a PCR method have already been reported. For example, in a PCR method for detecting genetically modified soybeans, PCR primers for confirming the presence of soybean DNA in a test sample are used. Although it is considered that the PCR primer has sufficient ability to detect soy DNA in genetically modified soybean testing, the target DNA of this PCR primer is chromosomal DNA, and generally its detection sensitivity is It is expected to be lower than PCR primers targeting mitochondrial DNA or chloroplast DNA.

  The presence or absence of contamination of a specific plant of interest in a food material or product can be examined by examining whether a gene sequence specific for the plant is detected in the food material or product. However, the test method can detect DNA derived from the target plant, but it is strongly desired that the method does not detect a plurality of non-target animal and plant-derived DNAs constituting food ingredients and products.

As described above, abalone, squid, shrimp, crab, salmon, mackerel, how much, gelatin, orange, kiwifruit, walnut, soybean, matsutake, peach, yam, apple, and banana No clear detection method has been reported (patent applications for abalone, squid, shrimp, crab, salmon, mackerel by the present inventors, but unpublished at this time). A method capable of scientifically verifying whether or not it is mixed in food ingredients or products is awaited as a quality control method for food.
Huang H., Z. Li, J. Li, TL Kubisiak, and DR Layne; Phylogenetic Relationships in Actinidia as Revealed by RAPD Analysis; Journal of the American Society for Horticultural Science, 127: 759-766, 2002 Weising K, and RC Gardner; A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms; Genome, 42: 9-19, 1999 Stanford AM, R. Harden, and CR Parks; Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data; American Journal of Botany, 87: 872-882, 2000 Forte AV, AN Ignatov, VV Ponomarenko, DB Dorokhov, and NI Savelyev; Phylogeny of the Malus [apple tree] species, inferred from its morphological traits and molecular DNA analysis; Genetika, 38: 1357-1369, 2002 Hayashimitsu, Hironobu Shiwachi, Michio Tojo; Morphological characters in Yams (Dioscorea spp.) And classification of lines by RAPD method; Kagoshima University Research Center for the Pacific Islands, Occasional Papers No.34, 145-157, 2001 Nwakanma DC, M. Pillay, BE Okoli, and A. Tenkouano; PCR-RFLP of the ribosomal DNA internal transcribed spacers (ITS) provides markers for the A and B genomes in Musa L .; Theoretical and Applied Genetics, 108: 154- 159, 2003

  The present invention relates to a method capable of specifically detecting kiwifruit, walnuts, apples, potatoes, bananas, or soybeans from food ingredients and products among specific animals and plants that may cause allergies, and PCR used in this method It is an object to provide a primer, a primer set, and a kit.

  In order to solve the above problems, the present inventors focused on commonality and specificity in gene sequences of plants and other organisms to be detected from a molecular biological viewpoint, From the "similar things", we have intensively studied methods that can detect kiwifruit, walnuts, apples, yams, bananas, soybeans (in the present invention, these are referred to as "specific plants") with high sensitivity. As a result, Kiwifruit, walnuts, apples, yams, bananas or soybeans were found to have characteristic base sequences, and nucleic acid analysis such as PCR using these base sequences, Kiwifruit, walnuts, The inventors have found that apples, yams, bananas, and soybeans can be easily detected, and have made extensive studies to complete the present invention.

  That is, the present invention provides the following specific plant detection method, PCR primer, PCR primer set, and PCR kit.

Item 1. The PCR primer according to any one of (1) to (24) below.
(1) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in the sequence listing on the 3 ′ end side.
(2) A PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 12 to 26 in SEQ ID NO: 2 in the sequence listing on the 3 ′ end side.
(3) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side.
(4) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 4 on the 3 ′ end side in the sequence listing.
(5) A PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 5 in the sequence listing on the 3 ′ end side.
(6) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 9 to 23 in the sequence listing at the 3 ′ end side.
(7) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side.
(8) A PCR primer comprising DNA of a maximum of 30 bases comprising the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.
(9) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 9 in the sequence listing on the 3 ′ end side.
(10) A PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 10 in the sequence listing on the 3 ′ end side.
(11) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in the sequence listing on the 3 ′ end side.
(12) A PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 12 in the sequence listing on the 3 ′ end side.
(13) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing.
(14) A PCR primer comprising DNA of a maximum of 30 bases comprising the base sequence of SEQ ID NO: 2 in the sequence listing on the 3 ′ end side.
(15) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side in the sequence listing.
(16) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3 ′ end side.
(17) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side.
(18) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 6 in the sequence listing on the 3 ′ end side.
(19) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side.
(20) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.
(21) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side.
(22) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side.
(23) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side.
(24) A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 ′ end side.

  Item 2. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 11 to 25 in SEQ ID NO: 1 in the sequence listing on the 3 ′ end side.

  Item 3. Item 2. The PCR primer according to Item 1, consisting of a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 12 to 26 in SEQ ID NO: 2 in the sequence listing on the 3 ′ end side.

  Item 4. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 11 to 25 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side.

  Item 5. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 11 to 25 in SEQ ID NO: 4 in the sequence listing on the 3 ′ end side.

  Item 6. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 5 in the sequence listing.

  Item 7. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 9-23 in SEQ ID NO: 6 in the sequence listing on the 3 ′ end side.

  Item 8. Item 8. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side.

  Item 9. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.

  Item 10. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 9 on the 3 ′ end side.

  Item 11. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 10 of the sequence listing.

  Item 12. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 7 to 21 in SEQ ID NO: 11 in the sequence listing on the 3 ′ end side.

  Item 13. Item 2. The PCR primer according to Item 1, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 5 to 19 on the 3 ′ end side in SEQ ID NO: 12 in the sequence listing.

  Item 14. Item 3. The PCR primer according to Item 2, consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing.

  Item 15. Item 4. The PCR primer according to Item 3, consisting of DNA of a maximum of 30 bases comprising the base sequence of SEQ ID NO: 2 in the sequence listing on the 3 ′ end side.

  Item 16. Item 5. The PCR primer according to Item 4, comprising a maximum of 30 bases of DNA comprising the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side.

  Item 17. Item 6. The PCR primer according to Item 5, consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side of the sequence listing.

  Item 18. Item 7. The PCR primer according to Item 6, comprising a DNA of 30 nucleotides at the maximum containing the nucleotide sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side.

  Item 19. Item 8. The PCR primer according to Item 7, consisting of DNA of a maximum of 30 bases comprising the base sequence of SEQ ID NO: 6 in the sequence listing on the 3 ′ end side.

  Item 20. Item 9. The PCR primer according to Item 8, consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side.

  Item 21. Item 10. The PCR primer according to Item 9, consisting of DNA of a maximum of 30 bases comprising the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.

  Item 22. Item 11. The PCR primer according to Item 10, comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side.

  Item 23. Item 12. The PCR primer according to Item 11, comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side.

  Item 24. Item 13. The PCR primer according to Item 12, comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side.

  Item 25. Item 14. The PCR primer according to Item 13, comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 ′ end side.

Item 26. The PCR primer set according to any of (25) to (36) below.
(25) A PCR primer set comprising the primer according to Item 2 and the primer according to Item 3.
(26) A PCR primer set comprising the primer according to item 4 and the primer according to item 5.
(27) A PCR primer set comprising the primer according to item 6 and the primer according to item 7.
(28) A PCR primer set comprising the primer according to item 8 and the primer according to item 9.
(29) A PCR primer set comprising the primer according to Item 10 and the primer according to Item 11.
(30) A PCR primer set comprising the primer according to Item 12 and the primer according to Item 13.
(31) A PCR primer set comprising the primer according to item 14 and the primer according to item 15.
(32) A PCR primer set comprising the primer according to Item 16 and the primer according to Item 17.
(33) A PCR primer set comprising the primer according to Item 18 and the primer according to Item 19.
(34) A PCR primer set comprising the primer according to item 20 and the primer according to item 21.
(35) A PCR primer set comprising the primer according to item 22 and the primer according to item 23.
(36) A PCR primer set comprising the primer according to item 24 and the primer according to item 25.

  Item 27. A PCR primer set comprising the primer according to Item 2 and the primer according to Item 3.

  Item 28. A PCR primer set comprising the primer according to Item 4 and the primer according to Item 5.

  Item 29. A PCR primer set comprising the primer according to Item 6 and the primer according to Item 7.

  Item 30. A PCR primer set comprising the primer according to Item 8 and the primer according to Item 9.

  Item 31. A PCR primer set comprising the primer according to Item 10 and the primer according to Item 11.

  Item 32. A PCR primer set comprising the primer according to Item 12 and the primer according to Item 13.

  Item 33. A PCR primer set comprising the primer according to Item 14 and the primer according to Item 15.

  Item 34. A PCR primer set comprising the primer according to Item 16 and the primer according to Item 17.

  Item 35. A PCR primer set comprising the primer according to Item 18 and the primer according to Item 19.

  Item 36. A PCR primer set comprising the primer according to Item 20 and the primer according to Item 21.

  Item 37. A PCR primer set comprising the primer according to Item 22 and the primer according to Item 23.

  Item 38. A PCR primer set comprising the primer according to Item 24 and the primer according to Item 25.

  Item 39. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to any one of Items 26 to 38 using the DNA as a template, and identifying the amplified DNA in the sample A method for detecting a specific plant, comprising the step of detecting whether or not the plant is present.

  Item 40. The step of extracting DNA from the sample, the step of performing PCR using the primer set of Item 27 or 33 using this DNA as a template, and the presence of kiwifruit in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising the step of detecting whether or not there is.

  Item 41. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 28 or 34 using this DNA as a template, and whether a walnut is present in the sample by detecting the amplified DNA A method for detecting a specific plant, comprising a step of detecting whether or not.

  Item 42. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 29 or 35 using this DNA as a template, and whether apples are present in the sample by detecting the amplified DNA A method for detecting a specific plant, comprising a step of detecting whether or not.

  Item 43. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to Item 30 or 36 using the DNA as a template, and whether there is any odor in the sample by detecting the amplified DNA A method for detecting a specific plant, comprising a step of detecting whether or not.

  Item 44. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 31 or 37 using the DNA as a template, and whether banana is present in the sample by detecting the amplified DNA A method for detecting a specific plant, comprising a step of detecting whether or not.

  Item 45. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to Item 32 or 38 using the DNA as a template, and whether the soybean is present in the sample by detecting the amplified DNA A method for detecting a specific plant, comprising a step of detecting whether or not.

  Item 46. Item 39. A kit comprising one or more primer sets according to any one of Items 26 to 38.

  According to the present invention, it is possible to detect DNA derived from a specific plant (kiwifruit, walnut, apple, yam, banana, soybean) with high accuracy and detection sensitivity by nucleic acid analysis using PCR or the like. There is an effect that it is possible to perform a quality control inspection such as whether or not the specific plant is mixed in the food or whether or not it is used. It also contributes to prevention of food allergies and investigation of causative substances when allergic symptoms occur.

Hereinafter, the present invention will be described in detail.
PCR primer set for specific plant detection PCR primer set for specific plant detection of the present invention includes those having a characteristic base sequence for kiwifruit, those having a characteristic base sequence for walnuts, and apples Those having a characteristic base sequence for potatoes, those having a characteristic base sequence for potatoes, those having a characteristic base sequence for bananas, and those having a characteristic base sequence for soybeans is there.

  A PCR primer set for kiwifruit detection, a PCR primer set for walnut detection, and a PCR primer set for apple detection were designed as follows. That is, matK (maturase-encoding gene) gene sequences of chloroplasts of various plants were obtained from a known DNA database (GenBank nucleotide sequence database), and apples were obtained by independently analyzing the gene sequences. Moreover, it acquired by analyzing the said gene sequences, such as an apple, a pear, a strawberry, an orange, and a yuzu, as a related plant. Furthermore, after creating a multiple parallel sequence diagram of these enormous base sequences, by comparing in detail the properties such as similarity and specificity of those base sequences, it is specific to each of kiwifruit, walnut, and apple Specific gene sequence regions were selected, and primer sets were newly designed from these regions. At the time of design, the gene sequence region of the species of interest to be detected hybridizes under stringent conditions, but the design is devised so that it does not hybridize to the species not targeted for detection. did.

  Moreover, the PCR primer set for detecting sweet potatoes, the PCR primer set for detecting bananas, and the PCR primer set for detecting soybeans were designed as follows. That is, mitochondrial rbcL (large subunit gene for riburose-1,5-bisphosphate carboxylase) gene sequences of various plants were obtained from known DNA databases. The banana was obtained by analyzing the gene sequence independently. Furthermore, it acquired by analyzing the said gene sequences, such as an apple, a pear, an orange, a yuzu, a leek, as a related plant uniquely. After creating a multiple parallel sequence diagram of these enormous base sequences, by comparing in detail the properties such as similarity and specificity of those base sequences, the potato, banana, and soy specific Gene sequence regions were selected, and primer sets were newly designed from these regions. At the time of design, the gene sequence region of the species of interest to be detected hybridizes under stringent conditions, but the design is devised so that it does not hybridize to the species not targeted for detection. did.

  In the PCR analysis using the PCR primer set for detecting a specific plant according to the present invention, the target sample may be a processed product. When analyzing a processed product, since the DNA may be degraded or fragmented, a PCR primer that forms a PCR amplification product having a short length of about 100 to 500 bp is preferable for high-sensitivity analysis. Therefore, when designing PCR primers, the PCR amplification product was designed so that the length of the PCR amplification product was 500 bp or less. Moreover, making the PCR reaction conditions of these PCR primer sets the same contributes to a reduction in the number of PCR reactions in actual analysis. Therefore, in PCR reactions, PCR primers are designed so that the annealing temperature is the same as the annealing temperature and the annealing time of the PCR primer that most influences the reaction conditions. Primers were designed. Furthermore, when designing each PCR primer set, avoid the formation of so-called primer dimers as much as possible so as not to cause hybridization between the sense primer and the antisense primer or hybridization by the individual primers themselves. Invented.

  Therefore, using the PCR method using the PCR primer set for detecting a specific plant of the present invention and the method of nucleic acid analysis for confirming the amplification product thereby, kiwifruit, walnut, apple, yam, banana contained in various foods , And soybean-derived DNA can be detected with high sensitivity and specificity.

  Here, nucleic acid analysis refers to the presence or absence of a characteristic base sequence by analyzing the presence or absence of a characteristic base sequence depending on individual species, genus, or group in biological classification. It is an effective means for grasping the species, genus, or group of the organism, and is a method usefully used for detecting a specific microorganism or identifying a species.

The base sequences of the primers provided by the present invention are as follows. S represents a sense primer and AS represents an antisense primer.
Sequence number 1 (kiwi fruit S): GTGGTGTCAACCAGGAAGGATTCAG
Sequence number 2 (kiwifruit AS): CTGGCTTACTAACGGGATGTCCTAAG
Sequence number 3 (walnut S): GATCTATATTGTTGGAAAATGTAGC
Sequence number 4 (walnut AS): GGTTAGAATCATTAGTGGAAATCAG
Sequence number 5 (apple S): GTAATCCACGATTATTCTTGC
Sequence number 6 (apple AS): ACGAAGACTTCTTCTACAGGATC
Sequence number 7 (Yamaimo S): TTTCAAAGACCTACGAGCC
Sequence number 8 (Yamaimo AS): GCATCTCAATAGGGGACGG
Sequence number 9 (banana S): TCGTCACCTATTGGGATGC
Sequence number 10 (banana AS): GCTTTAATAAGTGCTTCGGTG
Sequence number 11 (soybean S): TTCCGAGTAACTCCTCAACCA
Sequence number 12 (soybean AS): CCAGCAACAGGTTCAAGGC
In addition, each of the above primers may be a primer having a maximum of 30 bases as a whole by adding an arbitrary sequence to the 5 ′ end side. Examples of the primer comprising 30 base DNA include those having the following base sequences. (S represents a sense primer, and AS represents an antisense primer. The lower case base symbols of SEQ ID NOs: 13 to 20 below are added so as to be primers of 30 bases in the primers of SEQ ID NOs: 1 to 12, respectively. Represents the generated base.)
Sequence number 13 (kiwi fruit S): tacatGTGGTGTCAACCAGGAAGGATTCAG
Sequence number 14 (kiwi fruit AS): cagaCTGGCTTACTAACGGGATGTCCTAAG
Sequence number 15 (walnut S): aataGATCTATATTGTTGGAAAATGTAGC
Sequence number 16 (walnut AS): atttttGGTTAGAATCATTAGTGGAAATCAG
Sequence number 17 (apple S): tttcaaaaaGTAATCCACGATTATTCTTGC
Sequence number 18 (apple AS): atcattaACGAAGACTTCTTCTACAGGATC
Sequence number 19 (Yamaimo S): aatgtatttggTTTCAAAGACCTACGAGCC
Sequence number 20 (Yamaimo AS): ggtttaatagtGCATCTCAATAGGGGACGG
Sequence number 21 (banana S): aacaagtatggTCGTCACCTATTGGGATGC
Sequence number 22 (banana AS): tcggcctgcGCTTTAATAAGTGCTTCGGTG
Sequence number 23 (soybean S): ttggcagcaTTCCGAGTAACTCCTCAACCA
Sequence number 24 (soybean AS): gattttcttccCCAGCAACAGGTTCAAGGC
The present invention proposes, as a first primer, a PCR primer consisting of DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 11 to 25 in SEQ ID NO: 1 in the sequence listing on the 3 ′ end side. Next, as a second primer, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 12 to 26 in SEQ ID NO: 2 in the sequence listing on the 3 ′ end side is proposed. The first and second primers can be suitably used for kiwifruit detection.

  These first primer set and second primer set both bind specifically to the matK gene of kiwifruit chloroplasts when donated to PCR, but the matK gene of chloroplasts from other organisms Since it does not amplify detectably, it can be used as a primer set for PCR to detect kiwifruit DNA. In addition, by using a primer set in which the first primer is a sense primer and the second primer is an antisense primer, the DNA can be detected with high sensitivity.

  Further, as a preferred embodiment of the first primer, a PCR primer (1 ′) (most preferably the base of SEQ ID NO: 1) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing PCR primer (2 ') (most preferably, consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side as a preferred embodiment of the second primer as a primer comprising the DNA of the sequence) A primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 2 is proposed. These primers can be suitably used for kiwifruit detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 are used as a set. A specific example of (1 ′) consisting of 30 bases is the primer of SEQ ID NO: 13, and a specific example of (2 ′) is the primer of SEQ ID NO: 14.

  In addition, the present invention proposes a PCR primer comprising a DNA having a maximum of 15 bases and a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side as the third primer. Next, as a fourth primer, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 11 to 25 in SEQ ID NO: 4 in the sequence listing on the 3 ′ end side is proposed. The third and fourth primers can be suitably used for detection of walnuts.

  These third and fourth primer sets both donate to PCR and both specifically bind to the walnut chloroplast matK gene, but detect the chloroplast matK gene from other organisms. Since it does not amplify as much as possible, it can be used as a primer set for PCR to detect walnut DNA. In addition, by using a primer set in which the third primer is a sense primer and the fourth primer is an antisense primer, the DNA can be detected with high sensitivity.

  Further, as a preferred embodiment of the third primer, a PCR primer (3 ′) (most preferably, the nucleotide sequence of SEQ ID NO: 3) comprising DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 3 on the 3 ′ end side of the sequence listing As a preferred embodiment of the fourth primer, a PCR primer (4 ′) consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 4 on the 3 ′ end side (most preferably SEQ ID NO: 4) We propose a primer consisting of 4 base sequence DNA). These primers can be suitably used for detection of walnuts. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 are used as a set. A specific example of (3 ′) consisting of 30 bases is the primer of SEQ ID NO: 15, and a specific example of (4 ′) is the primer of SEQ ID NO: 16.

  In addition, the present invention proposes a PCR primer consisting of DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 5 in the sequence listing on the 3 ′ end side as the fifth primer. Next, as a sixth primer, a PCR primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of nucleotide numbers 9 to 23 in SEQ ID NO: 6 in the sequence listing on the 3 ′ end side is proposed. The fifth and sixth primers can be suitably used for apple detection.

  These fifth and sixth primer sets both donate to PCR and specifically bind to the matK gene of apple chloroplasts, but detect matK genes of chloroplasts from other organisms. Since it does not amplify as much as possible, it can be used as a primer set for PCR to detect apple DNA. In addition, the DNA can be detected with high sensitivity by using a primer set in which the fifth primer is a sense primer and the sixth primer is an antisense primer.

  Further, as a preferred embodiment of the fifth primer, a PCR primer (5 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 5) As a preferred embodiment of the sixth primer, a PCR primer (6 ′) consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 6 on the 3 ′ end side (most preferably a sequence) We propose a primer consisting of DNA of the base sequence number 6. These primers can be suitably used for apple detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 are used as a set. A specific example of (5 ′) consisting of 30 bases is the primer of SEQ ID NO: 17, and a specific example of (6 ′) is the primer of SEQ ID NO: 18.

  In addition, the present invention proposes a PCR primer consisting of DNA of 15 bases and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side as the seventh primer. Next, as an eighth primer, a PCR primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side is proposed. The seventh and eighth primers can be suitably used for detecting sweet potato.

  These 7th and 8th primer sets both donate to PCR, and both specifically bind to the rbcL gene of potato plastis, but detect rbcL gene of chloroplasts from other organisms Since it does not amplify as much as possible, it can be used as a primer set for PCR to detect yam. In addition, the DNA can be detected with high sensitivity by using a primer set in which the seventh primer is a sense primer and the eighth primer is an antisense primer.

  Further, as a preferred embodiment of the seventh primer, a PCR primer (7 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 7) As a preferred embodiment of the eighth primer, a PCR primer (8 ') consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 8 on the 3' end side (most preferably a sequence) We propose a primer consisting of DNA of the base sequence number 8). These primers can be suitably used for detecting potatoes. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 are used as a set. A specific example of (7 ′) consisting of 30 bases is the primer of SEQ ID NO: 19, and a specific example of (8 ′) is the primer of SEQ ID NO: 20.

  In addition, the present invention proposes a PCR primer consisting of DNA of 15 bases and 30 bases at the shortest containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 9 in the sequence listing on the 3 ′ end side as the ninth primer. Next, as a tenth primer, a PCR primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 10 in the sequence list on the 3 ′ end side is proposed. The ninth and tenth primers can be suitably used for banana detection.

  These 9th and 10th primer sets both donate to PCR and both specifically bind to the rbcL gene of banana chloroplasts, but detect rbcL genes of chloroplasts from other organisms Since it does not amplify as much as possible, it can be used as a primer set for PCR to detect yam. Further, by using a primer set in which the ninth primer is a sense primer and the tenth primer is an antisense primer, the DNA can be detected with high sensitivity.

  Further, as a preferred embodiment of the ninth primer, a PCR primer (9 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 9 As a preferred embodiment of the tenth primer, a PCR primer (10 ') (most preferably a sequence consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3' end side) as a preferred embodiment of the tenth primer We propose a primer consisting of DNA with the nucleotide sequence of number 10. These primers can be suitably used for banana detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 are used as a set. A specific example of (9 ′) consisting of 30 bases is the primer of SEQ ID NO: 21, and a specific example of (10 ′) is the primer of SEQ ID NO: 22.

  In addition, the present invention proposes a PCR primer consisting of DNA of 15 bases and 30 bases at the shortest containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 11 in the sequence listing on the 3 ′ end side as the eleventh primer. Next, as a twelfth primer, a PCR primer consisting of a DNA having a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 12 in the sequence listing on the 3 ′ end side is proposed. The eleventh and twelfth primers can be suitably used for soybean detection.

  These eleventh and twelfth primer sets both bind specifically to the rbcL gene in soy chloroplasts when donated to PCR, but detect rbcL genes in chloroplasts from other organisms Since it does not amplify as possible, it can be used as a primer set for PCR to detect soybean DNA. Further, by using a primer set in which the eleventh primer is a sense primer and the twelfth primer is an antisense primer, the DNA can be detected with high sensitivity.

  In addition, as a preferred embodiment of the eleventh primer, a PCR primer (11 ′) (most preferably the nucleotide sequence of SEQ ID NO: 11) comprising DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 11 in the sequence listing at the 3 ′ end As a preferred embodiment of the twelfth primer, a PCR primer (12 ′) consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 12 on the 3 ′ end side (most preferably a sequence) We propose a primer consisting of DNA of the base sequence number 12). These primers can be suitably used for soybean detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 11 and the primer of SEQ ID NO: 12 are used as a set. A specific example of (11 ′) consisting of 30 bases is the primer of SEQ ID NO: 23, and a specific example of (12 ′) is the primer of SEQ ID NO: 24.

  In each of the primers, the length of the base sequence is 15 to 30. The appropriate length of the base sequence as a primer for PCR is about 15 to 30, and the minimum length of 15 or more on the 3 ′ end side In order to specify the base sequence, about 15 3 ′ end sides are important in PCR-specific amplification reactions, and the 5 ′ end side base sequences are slightly different or the sequence lengths are slightly different. This is because the adverse effects on the PCR reaction itself are usually small.

  In addition, each primer was designed so as not to cause hybridization between the sense primer and the antisense primer or hybridization by each primer itself, that is, to avoid so-called primer dimer formation as much as possible. . For example, in order to avoid the formation of primer dimers, base substitution is performed on the primers so as not to reduce the detection specificity and detection sensitivity of the primers. The base of nucleotide number 6 in SEQ ID NO: 8 which is an antisense primer for detecting potato is originally C in the case of odor, but in order to avoid primer dimer formation by the primer itself, the detection specificity of the primer As a base substitution that does not lead to a decrease in detection sensitivity, T is adopted instead of C. Similarly, the base of base number 6 in SEQ ID NO: 9 is substituted from C to A, and the base of base number 8 in SEQ ID NO: 10 is substituted from A to T. In addition, in order to avoid the formation of primer dimers by the sense primer and the antisense primer, the base of base number 9 in SEQ ID NO: 7 is replaced with A in the case where it is originally a nuisance. Even if such substitution is performed, it is difficult to predict that each target plant can actually be detected specifically.

As mentioned above, although the base sequence of the primer which this invention provides has been described comprehensively, even the primer designed theoretically cannot have the intended performance (detection specificity and detection sensitivity). Primers may be designed. For example, in the research stage of the present invention, PCR using a PCR primer set for detection of walnuts consisting of the following SEQ ID NO: 25 and SEQ ID NO: 4 showed some low detection sensitivity (100 pg DNA / reaction). In addition, in PCR using the apple detection PCR primer set consisting of SEQ ID NO: 26 and SEQ ID NO: 27, not only apple DNA but also peach DNA and almond DNA are used in spite of using a base sequence peculiar to apples. Detected and did not show the intended detection specificity. Furthermore, even in PCR using the soybean detection PCR primer set consisting of SEQ ID NO: 28 and SEQ ID NO: 12, not only soy DNA but also buckwheat DNA is detected despite the use of a base sequence peculiar to soybean. Did not show the intended detection specificity. In this way, simply designing a primer logically does not necessarily provide the intended performance (detection specificity or sensitivity), and may not have the required performance. In addition to logical design, further innovation and performance evaluation tests are important. The primer provided by the present invention is designed by further devising the logical design, and finally the performance evaluation test is cleared.
Sequence number 25 (walnut S): GATTTAGGCAACATGACTTCCTATC
Sequence number 26 (apple S): GATCCTGTAGAAGAAGTCTTCG
Sequence number 27 (apple AS): GAGACCACACATAAGAATGACAC
Sequence number 28 (soybean S): GCATGAAGAAGCAGGTGCC
(S represents a sense primer and AS represents an antisense primer.)
Specific plant detection method The specific plant detection method of the present invention comprises a step of extracting DNA from a sample, a step of performing PCR using the primer set of the present invention described above using this DNA as a template, and an amplified DNA. And detecting whether or not kiwifruit, walnut, apple, yam, banana, or soybean is present in the sample.

  That is, by using the PCR primer set for detecting a specific plant of the present invention to analyze nucleic acid of DNA in a sample by PCR or the like, it is possible to specifically detect a specific plant in the sample. At this time, when detecting kiwifruit, use a PCR primer set for kiwifruit detection, and when detecting walnuts, apples, yams, bananas, and soybeans, PCR primer sets for walnut detection, A PCR primer set for apple detection, a PCR primer set for yam detection, a PCR primer set for banana detection, and a PCR primer set for soybean detection may be used.

  The type of detection method (nucleic acid analysis) is not particularly limited, and a known method can be used as appropriate. For example, a method of detecting a PCR amplification product by agarose electrophoresis, a method of detecting a PCR amplification product by fluorescence, a method of detecting a PCR amplification product by a probe, and the like can be exemplified.

  The method of detecting a PCR amplification product by agarose electrophoresis is to selectively amplify a target base sequence in DNA in a sample using the above-described specific plant detection primer set of the present invention selected according to the detection purpose, In this method, the presence or absence of a PCR amplification product is detected by agarose electrophoresis. PCR amplification products can be separated by agarose gel electrophoresis and performed by staining with nucleic acid such as ethidium bromide or cyber green I.

  The method of fluorescence detection of a PCR amplification product is a method in which PCR is performed using a real-time PCR apparatus and the presence or absence of the PCR amplification product is automatically confirmed by a detection system of the apparatus. For example, when Cyber Green I is added to the PCR reaction solution, the amount of PCR amplification product depending on the amount of fluorescence emitted when Cyber Green I binds to double-stranded DNA can be monitored for each cycle. Furthermore, it is possible to confirm whether or not the PCR amplification product is the target amplification product by performing a melting curve analysis of the PCR amplification product after the PCR and deriving a melting temperature (Tm) value of the PCR amplification product from the analysis. Depending on the situation, it may be difficult to make a determination based on the Tm value. In such a case, the presence and size of the amplification product may be confirmed by the agarose gel electrophoresis described above.

  Specifically, the Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 1 and the primer set forth in SEQ ID NO: 2 is about 83.9 ° C., and the size of the PCR amplification product is about 242 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that kiwifruit was present in the test sample.

  The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 3 and the primer set forth in SEQ ID NO: 4 is about 80.1 ° C., and the size of the PCR amplification product is about 120 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that a walnut was present in the test sample.

  The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 5 and the primer set forth in SEQ ID NO: 6 is about 81.8 ° C., and the size of the PCR amplification product is about 172 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that an apple was present in the test sample.

  The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 7 and the primer set forth in SEQ ID NO: 8 is about 87.2 ° C., and the size of the PCR amplification product is about 139 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that potatoes were present in the test sample.

  The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 9 and the primer set forth in SEQ ID NO: 10 is about 84.8 ° C., and the size of the PCR amplification product is about 186 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that banana was present in the test sample.

  The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 11 and the primer set forth in SEQ ID NO: 12 is about 88.7 ° C., and the size of the PCR amplification product is about 158 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that soybean was present in the test sample.

  As a method for detecting a PCR amplification product with a probe, as represented by the Taq Man method, a fluorescent substance-labeled probe that hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe is used for PCR. There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is decomposed after hybridization with an amplification product with a real-time PCR apparatus. In addition, examples of methods for detecting a PCR amplification product with a probe include a Molecular Beacon method, a Cycleave PCR method, and a method using a hybrid probe. The PCR primer used in these methods may be any of the PCR primer sets for detecting a specific plant of the present invention, and the target organism from the internal base sequence of the PCR amplification product amplified by each PCR primer set. A base sequence region common to the species may be separately selected, and a probe based on that region may be used.

  In the method for detecting a specific plant of the present invention, the type of the test sample to be used is not particularly limited.

  For example, examples of the test sample include food raw materials and processed foods. Examples of the food raw material include food raw materials that do not intentionally include a specific plant that is separately produced in a food raw material production plant that handles the specific plant. Examples of processed foods include confectionery, noodles, powdered soup, liquid soup, hot-air dried or freeze-dried ingredients, and various cooked foods containing these processed foods. Moreover, in the food manufacturing factory which handles a specific plant, the processed food which does not contain the specific plant produced separately is mentioned. Moreover, after manufacturing the processed food containing a specific plant, when manufacturing the processed food which does not contain a specific plant, the careful cleaning operation | work of the food manufacturing equipment in consideration of the removal of a specific plant residue is essential. From the viewpoint of confirming the effectiveness of this cleaning method and the presence or absence of a specific plant residue in the food production facility, a wiping sample of the production facility is also cited as a test sample.

In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (Notice of the Director of Food Health Department, Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare; 1106001) and various commercially available DNA extraction kits [eg Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Biosciences Corp., USA), DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), etc.] can be applied to the above detection method as long as the sample can recover DNA. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from a sample by the above-described DNA extraction method.
Specific plant detection kit The present invention also provides a specific plant detection kit. The configuration of the kit is not particularly limited as long as it includes at least one PCR primer set for detecting a specific plant of the present invention described above.

Specifically, a primer composed of a DNA having a maximum of 30 bases including the base sequence of base numbers 11 to 25 in SEQ ID NO: 1 on the 3 ′ end side, and the base sequence of base numbers 12 to 26 in SEQ ID NO: 2 to the 3 ′ end Set with primers consisting of DNA of up to 30 bases on the side;
Primer consisting of DNA of up to 30 bases containing the base sequence of base numbers 11-25 in SEQ ID NO: 3 on the 3 ′ end side, and up to 30 containing the base sequence of base numbers 11-25 in SEQ ID NO: 4 on the 3 ′ end side Set with primers consisting of base DNA;
Primer consisting of a DNA with a maximum of 30 bases containing the base sequence of base numbers 7-21 in SEQ ID NO: 5 on the 3 ′ end side and a maximum of 30 containing the base sequence of base numbers 9-23 in SEQ ID NO: 6 on the 3 ′ end side Set with primers consisting of base DNA;
A primer composed of a DNA having a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 7 on the 3 ′ end side, and a maximum of 30 including the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 on the 3 ′ end side Set with primers consisting of base DNA;
Primer consisting of a DNA with a maximum of 30 bases containing the base sequence of base numbers 5-19 in SEQ ID NO: 9 on the 3 'end side, and a maximum of 30 containing the base sequence of base numbers 7-21 in SEQ ID NO: 10 on the 3' end side A set of primers consisting of a base DNA; and a primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 11 on the 3 ′ end side, and of base numbers 5 to 19 of SEQ ID NO: 12 Specific plant detection kits that include one or more sets of primers composed of DNA consisting of a maximum of 30 bases containing a base sequence on the 3 ′ end side can be mentioned.

And, as a preferable one, a primer consisting of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side and a primer consisting of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side Set with;
A set of a primer composed of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side and a primer composed of a DNA of a maximum of 30 bases including the base sequence of SEQ ID NO: 4 on the 3 ′ end side;
A set of a primer composed of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side and a primer consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side;
A set of a primer composed of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 on the 3 ′ end side and a primer composed of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 on the 3 ′ end side;
A set of a primer consisting of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 9 on the 3 ′ end side and a primer consisting of a DNA base of up to 30 bases containing the base sequence of SEQ ID NO: 10 on the 3 ′ end side; and a sequence One or more sets of a primer consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of No. 11 on the 3 ′ end side and a primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID No. 12 on the 3 ′ end side Specific plant detection kits containing

  Among them, as a particularly preferable one, a set of a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2; a primer consisting of the base sequence of SEQ ID NO: 3 and a base sequence of SEQ ID NO: 4 A set consisting of a primer consisting of the base sequence of SEQ ID NO: 5 and a primer consisting of the base sequence of SEQ ID NO: 6; a primer consisting of the base sequence of SEQ ID NO: 7 and a primer consisting of the base sequence of SEQ ID NO: 8 A set consisting of a primer consisting of the base sequence of SEQ ID NO: 9 and a primer consisting of the base sequence of SEQ ID NO: 10; and a primer consisting of the base sequence of SEQ ID NO: 11 and a primer consisting of the base sequence of SEQ ID NO: 12 Specific plant detection kits containing at least one set of

This kit may include each of the above primer sets and a probe for detecting a PCR amplification product amplified by each of the primer sets. Furthermore, this kit can contain appropriate reagents and various containers according to the purpose of use. Specifically, polymerization reagents for synthesizing PCR primer extension products, such as heat-resistant DNA polymerase, deoxyribonucleotides, magnesium, and buffers for PCR reactions, and storage that can maintain their quality appropriately Containers and the like can be included.
EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not construed as being limited to these examples. The present invention can be changed as appropriate without departing from the gist of the present invention.
Example 1
Confirmation of detection specificity of PCR primer set for specific plants against various animal, plant, fungus, and bacteria-derived DNA In order to confirm the effectiveness of PCR analysis method using PCR primer set for specific plants of the present invention, An experiment to examine the detection specificity of PCR for the derived DNA was performed as follows.

  Purified DNA from humans, cows, pigs, chickens, Xenopus, and sturgeon was purchased from CeMines, LLC, USA.

  Purified DNA of sesame mackerel, salmon (salmon salmon), Japanese squid, Japanese tiger crab, and black tiger shrimp is frozen with a multi-bead shocker (Yasui Kikai, Osaka) after freezing the (muscle) flesh of each sample purchased from the store. From the prepared samples, those prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Biosciences Corp., USA) or DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan) were used.

  The purified DNA of black cockroach was washed with 70% ethanol, washed with TBS buffer [150 mM NaCl, 50 mM Tris-HCl (pH 7.6)], and then crushed with a multi-bead shocker Was prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits.

  Kiwi fruit (green and gold), sarunasi (baby kiwi), matatabi, tea, walnuts (from America and China), chestnut, hazelnut, grapes, apples (Fuji, Jonagold, Mutsu, Wanglin, and Jade) , Pear (Saisui, La France), yam (Nagato, Yamanouchi and Yamato), banana (Philippine, Monkey Banana, Morado Banana), soybean (yellow, black, and green), Kintokimame, Azuki , Kidney beans, potatoes, cabbage, orange (Chile, Australian), mandarin oranges, and leeks are purchased from a store, peach (Shimizu white peach, white birch), apricot, almond, raspberry, strawberry, taro, yuzu, sudachi, and Rice was obtained from domestic farmers. These purified DNAs were obtained by washing a part of each sample (seed, pericarp, leaf, or tuber) with 70% ethanol, and then adding TE buffer [10 mM Tris-HCL (pH 8.0), 0.1 Immediately wash with mM EDTA] and use Nucleon PhytoPure, plant and fungal DNA extraction kits, DNeasy plant Mini kits (Qiagen GmbH, Germany) or DNA Extraction Isoplant II kit from samples crushed with multi-bead shocker (Yasui Kikai, Osaka) Was used.

  The purified buckwheat DNA used was a buckwheat flour purchased from a store using a multi-bead shocker, and a pulverized sample prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits.

Purified wheat and corn DNA was purchased from BioChain Institute, Inc., USA.
Purified DNA of Aspergillus niger IFO 9642, Saccharomyces cerevisiae IFO 0282, Escherichia coli JCM 1649 ^T , and Bacillus cereus DSM 4312 After culturing in a suitable medium, a solution prepared from the culture solution using Puregene Yeast and Gram-Positive DNA Isolation kit (Gentra Systems Inc., USA) was used.
All purified DNAs have been subjected to RNA removal by RNase.

  Each PCR primer set forth in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 is synthesized by Operon Biotechnologies GmbH, Germany. Were used in the following PCR.

After measuring the amount of various animal, plant, fungal, and bacterial DNA prepared as described above, using sterile water, the concentration of animal, plant, and fungal DNA is 1 ng / μL, and the concentration of bacterial DNA is 50 pg. / μL. A 20 μL reaction solution containing the prepared 1 μL DNA sample solution was prepared using an R-PCR version of Takara Bio's Ex Taq kit (Takara Bio Inc., Japan). This kit includes 10X R-PCR buffer (Mg ²⁺ free), 250 mM MgCl ₂ solution, 10 mM dNTP mixture, and 5 unit / μL Taq DNA polymerase (hot start type). The reaction solution is based on R-PCR buffer, 0.005% SYBR Green I (FMC Bioproducts, USA), 250 nM sense primer, 250 nM antisense primer, 200 μM dNTP mixture (200 μM each of dATP, dTTP, dCTP, And dGTP), 0.05 unit / μL Taq DNA polymerase, and 2.5 mM MgCl ₂ (for walnut and soybean detection primers), or 2.0 mM MgCl ₂ (for kiwifruit, apples, yam, and banana detection primers) It was prepared as a composition containing. PCR reaction is performed with LightCycler (Roche Diagnostics GmbH, Germany), and amplification reaction conditions are as follows.
After one cycle of 95 ° C for 1 minute, heat up to 95 ° C at a rate of 20 ° C / s, hold at that temperature for 5 seconds, then drop to 64 ° C at a rate of 20 ° C / s, The temperature was maintained at the same temperature for 2 seconds, further increased to 72 ° C. at a rate of 10 ° C./second, and then subjected to 35 amplification cycles consisting of 3 steps of maintaining at the same temperature for 20 seconds. The PCR amplification product was recorded as the SYBR Green I-dependent fluorescence amount at the final step of each cycle. At the end of the amplification cycle, the melting curve was raised to 95 ° C at a rate of 20 ° C / s, then dropped to 60 ° C at a rate of 20 ° C / s, kept at the same temperature for 10 seconds, and then 0.2 ° C It was obtained by recording the fluorescence intensity every 0.2 seconds during a slow temperature increase to 97 ° C. at a rate of / sec. The Tm value of the PCR amplification product obtained from the melting curve by the PCR device software was used to estimate the presence or absence of a specific amplification product by PCR. In addition, the PCR amplification product (2 μL of the reaction solution) is separated by 1.6% (wt / vol) agarose gel electrophoresis, the gel after separation is stained with ethidium bromide, and the amplification product is visualized under UV irradiation. Thus, the presence or absence of the amplification product was confirmed. A 100 bp DNA Ladder (New England BioLabs Inc., USA) was used as a molecular weight marker. The results of these PCRs are listed in Table 1. + (Plus) in the table indicates that an amplification product of the target size was detected by electrophoresis, and-(minus) indicates that the amplification product was not detected.

When using PCR primers for detecting kiwifruit (PCR primer set consisting of SEQ ID NOS: 1 and 2), only when using kiwifruit (green species, gold species) DNA, monkey (baby kiwi) DNA, and matatabi DNA 242 Amplification products around bp were confirmed (Table 1), and the Tm value of these amplification products was about 83.9 ° C. When other species including other plants were used, amplification products were not found (Table 1). Matatabi's Sarnas (Baby Kiwi) ( Actinidia arguta ), which is morphologically very similar to the Kiwifruit ( Actinidiadeliciosa , Actinidia chinensis ), contains more Actinidin, known as the main allergen of Kiwifruit, than Kiwifruit Are known (Minaka Yamanaka, Tadachika Ota, Tetsuo Fukuda, Ichiro Nishiyama; Varietal differences in actinidine concentration and protease activity in fruit juices of the genus Matatabi; Journal of Japanese Society of Food Science and Technology, 51: 491-494, 2004). The PCR using the PCR primers detected Sarnasashi and Matabi in addition to Kiwifruit belonging to the genus Matabi. Based on the relationship between the multiplex sequence of the matK gene sequence of chloroplasts of various organisms known and uniquely analyzed, and the PCR primer sequence, PCR using the PCR primer is the Kiwifruit DNA of the genus Matabiaceae, (Baby Kiwi) It is strongly suggested not to detect DNA of other species, including Fujiyama Yanagi DNA of the genus Clematoclethra, which is a related family, and other plants, although it can detect DNA, Shimashimanashi DNA, and Matabi DNA ing.

  In addition, PCR products for detection of walnuts (PCR primer sets consisting of SEQ ID NOs: 3 and 4) were confirmed to have amplification products of around 120 bp only when walnut (American, Chinese) DNA was used (Table 1). The Tm value of the amplification product of was about 80.1 ° C. Amplification products were not observed when DNA of other species including other nuts and plants was used (Table 1). In addition, PCR using the PCR primer is based on the walnut DNA of the genus Walnut belonging to the order of the walnut genus Walnut from the relationship between the multiplex sequence of the matK gene sequence of chloroplasts of various organisms that were known and uniquely analyzed, and the PCR primer sequence. In addition, it can detect oniguri DNA, persal guru DNA of the same family and the same family, and Sawa walnut DNA of the same family Pterocaria, but it is a closely related species of hickory DNA of the same family, Pekan, and birch family It has been strongly suggested not to detect hazelnut hazelnut DNA, chestnut DNA of the same species Beechaceae, and other species DNA including other plants.

  In addition, when using PCR primers for detecting apples (PCR primer set consisting of SEQ ID NOs: 5 and 6), only when using apple (Fuji, Jonagold, Mutsu, Wanglin, and Hongyu) DNA, it is around 172 bp. An amplification product was confirmed (Table 1), and the Tm value of this amplification product was about 81.8 ° C. No amplification products were found when using related species such as pear (Yoshimizu, La France) DNA, peach (Shimizu white peach, white birch) DNA, and other species DNA including other plants (Table) 1). In addition, from the relationship between multiple parallel sequence diagrams of the chloroplast matK gene sequences of known and uniquely analyzed organisms and PCR primer sequences, PCR using the PCR primers is an apple of the Rosaceae family, Fuji, Jonagold, Mutsu, Wanglin, and Hongdama) DNA can be detected, but the related species are the Pear DNA of the same family of the same subfamily, Pear (La France) DNA, the same family of the same family Hawthorn Hawthorn DNA, Peach subfamily Prunus DNA, Almond DNA, Apricot DNA, Chalk cherry DNA, Rose subfamily Rose DNA, Hermanus DNA, Subfamily Raspberry raspberry, Cloudberry It has been strongly suggested that it does not detect blackberry, strawberry DNA of the same family Roseaceae, and other species DNA including other plants.

  In addition, when using Yamimo detection PCR primers (PCR primer set consisting of SEQ ID NOs: 7 and 8), amplification products of around 139 bp were confirmed only when Yamomo (Nagato, Yamanouchi, Yamatoen) was used (Table 1) The Tm value of these amplification products was about 87.2 ° C. Amplification products were not observed when DNA of other species including other mosses and plants was used (Table 1). From the relationship between the multiplex parallel sequence of chloroplast rbcL gene sequences of known and uniquely analyzed organisms and the PCR primer sequence, PCR using the PCR primer is a yam of the genus Yamano, Yamagata, Nagamine. However, it is strongly suggested not to detect other species DNA including other plant species, such as Tasiloimo DNA belonging to the genus Tasiloimo, which is a related species.

  When PCR primers for banana detection (PCR primer set consisting of SEQ ID NOs: 9 and 10) are used, amplification products of around 186 bp are confirmed only when banana (Philippine, Monkey Banana, Morado Banana) DNA is used. (Table 1), the Tm value of these amplification products was about 84.8 ° C. When other species including other plants were used, amplification products were not found (Table 1). In addition, PCR using the PCR primer detects a banana belonging to the genus Bacillus from the order of the PCR primer sequence, based on the relationship between the multiplex sequence of the rbcL gene sequence of chloroplasts of various organisms known and uniquely analyzed and the PCR primer sequence. Yes, but strongly suggests that it does not detect closely related species, Encete DNA of the family Ensete, Musella DNA of the Family Musella, ginger DNA of the same ginger family, and other species including other plants Has been.

  In addition, when using soybean detection PCR primers (PCR primer set consisting of SEQ ID NOS: 11 and 12), amplification products of around 158 bp were confirmed only when soybean (yellow, black, green) DNA was used. (Table 1), the Tm value of these amplification products was about 88.7 ° C. When DNA of other species including plants such as other beans was used, amplification products were not observed (Table 1). In addition, PCR using the PCR primer can detect soybeans of the leguminous soybean genus based on the relationship between the multiplex sequence of the rbcL gene sequences of chloroplasts of various organisms that have been known and uniquely analyzed and the PCR primer sequences. , Common bean common bean genus DNA, azuki bean DNA, kintoki bean DNA, cousin genus kudu DNA, peanut genus peanut DNA, genus broad bean DNA, pea DNA, and others It is strongly suggested not to detect DNA of other species including other plants.

Example 2
Confirmation of PCR Detection Sensitivity Using Specific Plant PCR Primer Set To examine the PCR detection sensitivity using the specific plant PCR primer set used in Example 1, the following experiment was conducted.
Diluted each of the kiwifruit (green seed), walnut (from USA), apple (Fuji), yam (Nagato), banana (from the Philippines), and soybean (yellow line) prepared in Example 1 with sterile water , 1 pg / μL, 10 pg / μL, 100 pg / μL, 1000 pg / μL of a dilution series of DNA solutions, and 1 μL of these diluted test DNA solutions were used in the PCR reaction described in Example 1. Under conditions, it was subjected to PCR. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 1, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis.
As shown in Fig. 1, the detection sensitivity when using the PCR primer for detecting kiwifruit (PCR primer set consisting of SEQ ID NOs: 1 and 2) is 1 pg DNA / analysis, and the PCR primer for detecting walnuts (SEQ ID NO: SEQ ID NO: Detection sensitivity when using PCR primer set consisting of 3 and 4) is 10 pg DNA / analysis, and detection sensitivity when using PCR primer for apple detection (PCR primer set consisting of SEQ ID NO: 5 and 6) Is 1 pg DNA / analysis, and the detection sensitivity when using PCR primer for detecting sweet potato (PCR primer set consisting of SEQ ID NO: 7 and 8) is 1 pg DNA / analysis, and PCR primer for banana detection ( The detection sensitivity when using PCR primer sets of SEQ ID NOs: 9 and 10 was 1 pg DNA / analysis, and PCR primers for detection of soybean (PCR primer sets consisting of SEQ ID NOs: 11 and 12) were used. Detection sensitivity of the case was 10 pg DNA / analysis.
Example 3
Detection of specific plant-derived DNA in foods containing specific animals and plants by PCR using PCR primer set for specific plants Specific plants of the present invention for commercial foods containing kiwifruit, walnuts, apples, potatoes, bananas, or soybeans as raw materials The PCR analysis using the PCR primer set was performed as follows to examine the practicality of the present invention.

  Commercial foods (Table 2) that were specified to contain kiwifruit, walnuts, apples, yam, bananas, or soybeans as raw materials were prepared, and 1 to 10 g of each was ground with a multi-bead shocker. Each DNA was extracted from 0.1-1 g of the crushed material using Nucleon PhytoPure, plant and fungal DNA extraction kits, or DNeasy plant Mini kits (Qiagen GmbH, Germany). At the time of extraction, RNA was also removed by RNase. After measuring the amount of the extracted food sample DNA, the concentration of the food sample DNA was adjusted to 10 ng / μL using sterilized water. 1 μL of these prepared DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1 using the PCR primer set for specific plants used in Example 1. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 2, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis. The results of these PCRs are listed in Table 2. + (Plus) in the table indicates that an amplification product of the target size was detected by agarose electrophoresis, and-(minus) indicates that the amplification product was not detected. The results of agarose electrophoresis of these PCRs are shown in FIG. 2 (A, B, C, D, E, and F). Furthermore, the PCR amplification product amplified from the food sample DNA was directly sequenced in both directions using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), and the base sequence was then applied using the Applied Biosystems 310 Genetic Analyzer (Applied Biosystems). Was analyzed. Analyze the analyzed base sequence data with GenBank nucleotide sequence database (BLAST search) or the DNA database owned by the inventors, and assign the species of DNA derived from PCR amplification products based on the similarity of the base sequence. Identified.

  As a result, when PCR primers for detection of kiwifruit (PCR primer set consisting of SEQ ID NOs: 1 and 2) were used, amplification products of around 242 bp only in kiwifruit-containing foods, DNA derived from kiwifruit yogurt (Danone) [Table 2, FIG. 2 (A)], and the Tm value of this amplified product was about 84.0 ° C. When DNA from other food samples was used, amplification products were not found [Table 2, Fig. 2 (A)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the kiwifruit yogurt (Danone) -derived DNA matched the matK gene sequence of the kiwifruit chloroplast. That is, PCR using the PCR primer does not detect kiwifruit-derived DNA or other DNA from kiwifruit-free food samples in multiple commercial foods, but specifically detects kiwifruit-derived DNA from kiwifruit-containing food samples. It was confirmed that it could be detected.

  In addition, when PCR primers for walnut detection (PCR primer set consisting of SEQ ID NOs: 3 and 4) are used, only walnut-containing foods such as mixed nut (ion) and walnut bread (Yonemukan Tamaya) -derived DNA are used. Amplification products around bp were confirmed [Table 2, FIG. 2 (B)]), and the Tm value of these amplification products was about 79.9 ° C. When DNA from other food samples was used, amplification products were not observed [Table 2, Fig. 2 (B)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the mixed nut (ion) and walnut bread (Yonemukan Tamaya) is the same as the matK gene sequence of walnut chloroplasts. Matched. That is, PCR using the PCR primer does not detect walnut-derived DNA or other DNA from walnut-free food samples in multiple commercial foods, but can specifically detect walnut-derived DNA from walnut-containing food samples. confirmed.

  Also, when using apple detection PCR primers (PCR primer set consisting of SEQ ID NOs: 5 and 6), only apple-containing food, dried fruit & nut granola (ion) and fruit chips (ion) derived DNA, Amplification products of around 172 bp were confirmed [Table 2, Fig. 2 (C)], and the Tm value of these amplification products was about 82.2 ° C. When DNA from other food samples was used, amplification products were not observed [Table 2, Fig. 2 (C)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from dried fruit & nut granola (ion) and fruit chips (ion) is the matK gene of apple chloroplasts. Matched the sequence. That is, PCR using the PCR primer does not detect apple-derived DNA or other DNA from apple-free food samples in multiple commercial foods, but can specifically detect apple-derived DNA from apple-containing food samples. confirmed.

  In addition, when using the PCR primer for detecting yam (PCR primer set consisting of SEQ ID NOs: 7 and 8), the noodle part of chicken ramen (Nissin Foods) and Donbei Kitsune Udon, which are foods containing yam, (Nisshin Foods) ) And okonomiyaki (derived from Takuno Sugano) DNA, amplification products of around 139 bp were confirmed [Table 2, Fig. 2 (D)], and the Tm value of these amplification products was about 86.3 ° C. . When DNA from other food samples was used, amplification products were not found [Table 2, Figure 2 (D)]. As a result of nucleotide sequence analysis of PCR amplification products, PCR amplification was performed from DNA derived from chicken ramen (Nisshin Foods), Donbei Kitsune Udon noodles (Nisshin Foods), and okonomiyaki powder (derived from Takumi Sugano). The base sequence of the product matched the rbcL gene sequence of potato potato. In other words, PCR using the PCR primer does not detect yam-derived DNA or other DNA from yam-free food samples in multiple commercial foods, but can specifically detect yam-derived DNA from yam-containing food samples. confirmed.

  In addition, when PCR primers for banana detection (PCR primer set consisting of SEQ ID NOs: 9 and 10) are used, banana-containing foods such as dried fruit & nut granola (ion), fruit chips (ion), pocky banana ( Amplification products of around 186 bp were confirmed only in DNA derived from Glyco) and Popois Banana Chips (Kitano) [Table 2, Fig. 2 (E)]. The Tm value of these amplification products was about 85.3 ° C. It was. When DNA from other food samples was used, amplification products were not observed [Table 2, Figure 2 (E)]. In addition, as a result of nucleotide sequence analysis of PCR amplification products, PCR amplification amplified from DNA derived from dried fruits & nuts granola (ion), fruit chips (ion), pocky banana (glyco), and popis banana chips (kitano) The base sequence of the product matched the rbcL gene sequence of banana chloroplast. That is, PCR using the PCR primer does not detect banana-derived DNA or other DNA from banana-free food samples in multiple commercial foods, but can specifically detect banana-derived DNA from banana-containing food samples. confirmed.

  Furthermore, when using PCR primers for detecting soybeans (PCR primer set consisting of SEQ ID NOS: 11 and 12), the soy-containing food, Donbei Kitsune Udon Noodle Fried Site (Nisshin Foods) and Nisshin Noodle Experts Only in the DNA derived from the attached soup (Nisshin Foods), amplification products of around 158 bp were confirmed [Table 2, Fig. 2 (F)], and the Tm value of these amplification products was about 88.5 ° C. When DNA from other food samples was used, amplification products were not observed [Table 2, Fig. 2 (F)]. As a result of the base sequence analysis of the PCR amplification product, the base of the PCR amplification product amplified from the DNA of Donbei Kitsune udon fried (Nisshin Foods) and Nisshin Noodle Master soup (Nissin Foods) The sequence matched the rbcL gene sequence of soybean chloroplasts. That is, PCR using the PCR primer does not detect soy-derived DNA or other DNA from soybean-free food samples in multiple commercial foods, but can detect soybean-derived DNA specifically from soybean-containing food samples. confirmed.

It is a figure which shows the detection sensitivity of DNA in PCR using the PCR primer set of this invention. It is a figure which shows the result of having detected the specific plant in foodstuffs by PCR using the PCR primer set of this invention.

Claims (3)

(1-1) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in SEQ ID NO: 1 on the 3 ′ end side ;
(2-1) A PCR primer set comprising a PCR primer comprising a maximum of 30 bases of DNA comprising the base sequence of base numbers 12 to 26 in SEQ ID NO: 2 in the sequence listing on the 3 ′ end side . (1-2) PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side ;
(2-2) A PCR primer set comprising a PCR primer consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3 ′ end side . A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 1 or 2 using the DNA as a template, and kiwifruit is present in the sample by detecting the amplified DNA. And a method of detecting whether or not the kiwifruit is detected.

Images