JP5700592B2 - Primer and specific animal detection method - Google Patents

Description

The present invention is intended to detect sesame, melon in specific plants that may cause allergies, and tuna, yellowtail, horse mackerel, octopus, scallops in specific animals,
When a specific animal is contained in a food material or product, the detection method of a specific plant that enables detection with high sensitivity even if the amount is very small, and PCR primers and primers used in the method It relates to sets and kits.

From the viewpoint of preventing the occurrence of health hazards for people with certain food allergic diseases, it is highly necessary to display foods that have been shown to cause food allergies, especially considering the number of cases and severity Wheat, buckwheat, egg, milk, and peanuts are designated as “special ingredients” by the Ministerial Ordinance, and abalone, squid, shrimp, crab, salmon, mackerel, which have been seen to have serious health hazards at a certain frequency in the past. , Chicken, pork, how much, beef, gelatin, orange, kiwi fruit, walnuts, soybeans, matsutake, peach, yam, apples were defined as "according to specific raw materials" by notification (Ministry of Health, Labor and Welfare) Regarding the enforcement of ministerial ordinances, etc. that amend some of the ministerial ordinances regarding the notification of the Director of Food Health, the Food Sanitation Law Enforcement Regulations, and the standards for ingredients of milk and dairy products, etc.
March 15th, food departure No. 79). For processed foods containing “specified raw materials”, it is required to indicate that the food is included in the product, and for processed foods containing “specified raw materials”, indicate that the food is included as much as possible. It was recommended that efforts be made. The allergic food system has been reviewed as appropriate based on research on the actual state of food allergies and the elucidation of allergy-inducing substances since then. In December 2004, bananas were classified as “according to specified raw materials”. In June 2014, shrimp and crab that cause serious symptoms with a large number of cases were added to “Specified raw materials”, and “Specified raw materials” became 7 items and “Same as specified raw materials” became 18 items (Food Regarding the enforcement of ministerial ordinances to amend some of the ministerial ordinances regarding the hygiene law enforcement regulations and the ingredient standards for milk and dairy products, etc., March 15, 2001, Eisei No. 79, revised December 24, 2004 No. 1224002) (Regarding the enforcement of the ministerial ordinance to revise a part of the Food Sanitation Law Enforcement Regulations, June 3, 2008
Sun, food safety departure No. 0603001).

According to a nationwide immediate food allergy monitoring survey conducted every three years from the perspective that food allergy-causing foods change with the changing times, "specific ingredients", "
Other than “same as specified raw materials”, sesame, melon, tuna, burdock, horse mackerel, tara, tako,
It has been found that the number of cases of scallops causing food and the number of anaphylactic shock cases are large (March 2007, Joint Conference on Food Labeling). Depending on the survey year, the number of cases caused by these foods may be equal to or greater than the number of apple cases included in “same as specified raw materials”. It is considered that there is a great possibility that it will be added to “same as specified raw materials” by the review. Also,
Sesame is required in EU, Canada, Australia and New Zealand, and molluscs such as shellfish, squid and octopus are required to be labeled on the product as containing the food in the EU.
Food ingredients that may cause allergies, especially allergen-causing animals and plants, can be mixed in unintended traces in the production, distribution, and processing stages. It is important to perform quality control of whether or not

As detection methods for wheat, buckwheat, egg, milk, peanuts, shrimp and crab, which are “specific raw materials”
Methods using ELISA, Western blot, or PCR have been established, and the detection methods other than shrimp and crab PCR are commercially available and available as test kits (Ministry of Health, Labor and Welfare) Notification of the Director-General of Food Health Department, Pharmacy Department, Food Inspection Methods with Allergic Substances, November 06, 2002, Diet No. 1106001, Revised January 22, 2009, Food Safety No. 0122001).
Detection methods for “same as specified raw materials” are chicken, pork, beef (JP 2003-230383, primer for detection of beef, pork, chicken), abalone, squid, salmon, mackerel (JP 2003-230383, Detection methods using primers and specific animals), kiwifruit, walnuts, soybeans, sweet potatoes, apples and bananas (Japanese Patent Laid-Open No. 2006-333729, detection methods for primers and specific plants) have been established using the PCR method. It is commercially available and available as a test kit.
Although it is not commercially available and available as a test kit, gelatin is an ELISA.
Detection method by the method (Keito Doi et al .: Abstracts of the 94th Annual Meeting of the Japanese Society for Food Hygiene, 2007)
Momo is a detection method by PCR (Watanabe S. et al .: Proceedings of the 95th Annual Meeting of the Japan Society for Food Hygiene, 200
8) has been reported. However, the detection method of sesame, melon, tuna, burdock, horse mackerel, octopus and scallops of foods that cause food allergies, which are considered to have great potential to be added to `` something similar to specified raw materials '', is currently There is no clear report. Therefore, it is currently difficult to perform quality control with scientific verification regarding the presence or absence of specific animals and plants corresponding to food allergy causing foods for which these detection methods are unclear.

When detecting target organisms from food ingredients and products that have undergone various processing steps, a method that detects proteins characteristic of the target organisms (ELISA), as established by the “specific raw material” testing method Method and Western blot method) and methods that detect DNA base sequences that are characteristic of the organism to be detected (PCR method) are promising methods. , November 6, 2002, food departure No. 1106001, amended January 22, 2009, food safety departure No. 0122001). In general, proteins are less stable to various processings in the food production process than DNA, and therefore, the method for detecting proteins is likely not applicable to highly processed test foods. Therefore, the detection method targeting DNA base sequences, which are considered to be relatively stronger in processing than protein, is a method for examining the presence of target organisms in food ingredients and products that have undergone various processing steps. As a promising method. In addition, DNA sequences of animals and plants have base sequences with a large copy number such as rRNA gene clusters. If such a multi-copy base sequence can be used as a target sequence, the sensitivity of the detection method can be increased. It becomes possible. Further, when the base sequence of chloroplast-derived DNA or mitochondrial-derived DNA existing in a plurality of cells is used as a target sequence, it similarly contributes to improvement in sensitivity of the detection method.

  When a genetically modified crop or the like is detected by PCR, the DNA base sequence to be detected is limited to the recombined DNA base sequence. On the other hand, in the case of animals and plants that exist in nature, there is no clear knowledge as to which base sequence to select as a detection target from a myriad of DNA base sequences. There is no clear knowledge about the effectiveness. Proteins specific to the animals and plants to be detected are selected and targeted to detect the DNA base sequence that encodes the proteins, but in this case, they are specific to each animal and plant. Specific proteins need to be selected. Even if such a specific protein can be selected, the required detection sensitivity may not be obtained if the number of copies of the DNA base sequence is small. It becomes inconvenient.

  As a method for detecting sesame, a method using an ELISA method or a PCR method has already been reported. For example, in a method using the PCR method (Non-Patent Document 1), a PCR primer that amplifies the sesame 2S alubumin gene is used. In PCR using this sesame detection PCR primer, it is shown that sesame DNA is specifically detected and nuts DNA such as almonds and hazelnuts are not detected, but sesame, an edible plant of sesame related species, We have not confirmed that perilla DNA is not detected. Moreover, the target DNA of this PCR primer is chromosomal DNA, and its detection sensitivity is generally expected to be lower than that of PCR primers targeting mitochondrial DNA or chloroplast DNA.

In order to classify molecular phylogeny of cucumber genus melon, which is the test sample, a method using a RAPD (randomly amplified polymorphic DNA) marker (Non-patent Document 2) or AFLP (amplifi)
ed fragment length polymorphism) marker (Non-Patent Document 3) has been reported. These methods can use DNA extracted from a sample whose main test sample is a melon or a single species of plant as a sample. However, due to the characteristics of the method, this method is used for samples in which multiple plant species are mixed. Since the PCR primer to be reacted has a high possibility of reacting with other plant DNAs, it is difficult to specifically detect melon. Therefore, these methods cannot be used to specifically detect melon DNA in foods containing multiple plants.

In addition, a discrimination method using a multiplex PCR method targeting a cytochrome b gene sequence of mitochondrion in order to discriminate a fish species of the mackerel family Tuna belonging to the genus Tuna, Skipjack, Suma, Soudagatsu, Allothunnus Has been reported (Non-Patent Document 4). The PCR primer used in this method detects not only the tuna genus which is the test sample, but also the bonito DNA of the tuna family Tuna bonito genus. Can not be used.

In addition, in order to discriminate the fish species of processed rainbow trout, a discrimination method using PCR-restriction fragment length polymorphism targeting the mitochondrial ND5 protein gene sequence has been reported (Non-patent Document 5). ). The PCR primers used in this method can amplify DNA extracted from the genus Maji and Nishimaji, but the cross-reactivity of the PCR primer to other organisms, i.e., detection specificity. There is no description of sex, and it is not a well-validated method as a method for specifically detecting hydrangea DNA belonging to other subfamily, such as Shimaji and Muroji.

In addition, PCR-restriction fragment length polymorphism method and multiplex PCR targeting the mitochondrial cytochrome b gene sequence to discriminate the fish species of three commercially important codaceae (Spodoptera, Madara, Komai) Discrimination method using the method has been reported (Non-patent Document 6). The PCR primers used in these methods can amplify DNA extracted from three species of Codaceae (Spodoptera, Madara, Komai), but the PCR primer's cross-reactivity to other organisms, That is, there is no description of detection specificity, and the method for specifically detecting cod DNA is not a well-validated method.

In addition, mitochondrial cytochrome oxidase III gene sequence and cytochrome oxidase II can be used to identify or estimate species of cephalopods (squid and octopus friends).
A method for comparing a DNA base sequence amplified by a PCR primer targeting a gene sequence with a known base sequence has also been reported (Non-patent Document 7). The PCR primer used in this method can amplify DNA extracted from cephalopods as the main component, but the PCR primer's cross-reactivity to other organisms, ie detection. There is no description of specificity, and further, there is no description that cephalopod DNA in a sample containing a plurality of animals and plants such as food can be specifically detected. Therefore, it is not a well-validated method for specifically detecting cephalopod DNA in foods containing a plurality of animals and plants.

In addition, a method for comparative analysis of 16S rRNA gene sequences has been reported in order to perform molecular phylogeny classification of scallops (Patent Document 1). The PCR primer used in this method can amplify DNA extracted from a sample whose main component is scallop, but the PCR primer's cross-reactivity to other organisms, that is, detection specificity. Further, there is no description that scallop DNA can be specifically detected in a sample containing a plurality of animals and plants such as food. In addition, PCR amplification products are long, about 1.3 kbp and about 1.5 kbp, and are unsuitable for detecting scalloped DNA in samples such as processed foods that have undergone DNA fragmentation. The method for specifically detecting scallop DNA in the inside is not a well-validated method.

The presence or absence of the target specific animal or plant in the food material or product can be examined by examining whether a gene sequence specific to the animal or plant is detected in the food material or product.
However, the test method can detect DNA derived from the target plant, but it is strongly desired that the method does not detect a plurality of non-target animal and plant-derived DNAs constituting food ingredients and products.

As mentioned above, sesame, melon, tuna, yellowtail, horse mackerel, tara, octopus are food allergens that are food allergens and are likely to be added to “similar to specific ingredients”. No clear detection method for scallops has been reported,
A method that can scientifically verify whether or not these specific animals and plants are mixed in food ingredients and products is awaited as a quality control method for food.

JP 2001-321184, scallop system analysis method

Brzezinski JL; Detection of sesame seed DNA in foods using real-time PCR; Journal of food Protection, 70 (4): 1333-6, 2007 Katsunori T., Atuhi N., Yukari A., Yoshiteru S., Hidetaja N., Hiromichi Y, and Kenji K; Molecular characterization of South and East Asi an melon, Cucumis melo L., and the origin og Group Conomon var. makuwa and var .conomon revealed by RAPD analysis; Euphytica, 153: 233-247, 2007 Kazutoshi Y., Hiroyoshi I., Yukari A., Ken-o T., Maki K., Yo shihiko T., and Kenji K .; Genetic Relationship among East and South Asian Me lon (Cucumis melo L.) Revealed by AFLP Analysis; Breeding Science, 55: 197-20 6, 2005 Michelini E., Cevenini L., Mezzanotte L., Simoni P., Baraldi ni M., De L., and Roda A; One-step triplex-polymerase chain reaction aasay f or the authentication of yellowfin (Thunnus albacares), bigeye (Thunnus obseus), and skipjack (Katsuwonus pelamis) tuna DNA from fresh, frozen and canned tuna samples .; Journal of agiricultual and food chemistry, 55 (19): 7638-47, 2007 Yasuharu T., Takami M., and Michiaki Y; Complete mitochondri al DNA sequence of Atlantic horse mackerel Trachurus trachurus and molecular identification of two commercially importane species T. trachurus and T. japo nicus using PCR-RFLP; FISHERIES SCIENCE, 72: 1054 -1065, 2006 Takashi Yanagimoto, Toru Kitamura; mtDNA cytochrome b gene identifies three species of codaceae around Hokkaido; Nippon Suisan Gakkaihi, 68 (6): 893-899, 2002 Bonnaud L., R. Boucher-Rodoni, and M. Monnerot; Phylogeny of cephalopods inferred from mitochondrial DNA sequences; Molecular Phylogenet ics and Evolution, 7: 44-54, 1997

The present invention relates to a method capable of specifically detecting sesame, melon, tuna, burdock, horse mackerel, octopus, and scallop among specific animals and plants that may cause allergies, and to this method. The main purpose is to provide PCR primers, primer sets and kits to be used.

In order to achieve the above-mentioned problems, the present inventors pay attention to the commonality and specificity in the gene sequences of animals and plants to be detected and other organisms from the viewpoint of molecular biology. Of foods that cause food allergies that are considered to be added to sesame, melon, tuna, yellowtail, horse mackerel, octopus, scallop (in the present invention, these are referred to as `` specific animals and plants ''). The method that can be detected with sensitivity was studied earnestly. As a result, we found a base sequence characteristic of each of sesame, melon, tuna, burdock, horse mackerel, octopus, or scallop, and by performing nucleic acid analysis such as PCR using these base sequences, It has been found that sesame, melon, tuna, yellowtail, horse mackerel, octopus or scallop can be easily detected, and further intensive studies have been made to complete the present invention. That is, the present invention relates to the following PCR primer set for detecting specific animals and plants, a method for detecting specific animals and plants, and a kit for detecting specific animals and plants.

Item 1. The PCR primer set according to any one of (1) to (16) below.
(1) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 13 to 27 in SEQ ID NO: 1 in the sequence listing on the 3 ′ end side;
A PCR primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 2 in the sequence listing.
(2) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 9 to 23 on the 3 ′ end side in SEQ ID NO: 3 in the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in the sequence listing on the 3 ′ end side.
(3) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 5 on the 3 ′ end side of the sequence listing;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 6 on the 3 ′ end side of the sequence listing.
(4) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 7 in the sequence listing;
A primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 9 to 23 in the sequence listing at the 3 ′ end.
(5) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 9 of the sequence listing;
PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 in the sequence listing in SEQ ID NO: 10 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 11 in the sequence listing
(6) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 12 in the sequence listing;
A PCR primer comprising DNA of 30 nucleotides at the maximum containing the nucleotide sequence of nucleotide numbers 4 to 18 in SEQ ID NO: 13 in the sequence listing on the 3 ′ end side.
Primer set consisting of
(7) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in SEQ ID NO: 14 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 8 to 22 in the sequence listing in the sequence listing on the 3 ′ end side
(8) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 16 in the sequence listing on the 3 ′ end side;
PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 17 of the sequence listing on the 3 ′ end side;
PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 18 of the sequence listing on the 3 ′ end side,
Primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 9 to 23 on the 3 ′ end side in SEQ ID NO: 19 in the sequence listing
(9) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing, and a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 of the sequence listing on the 3 ′ end side Primer set consisting of DNA PCR primers
(10) A PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side of the sequence listing and a maximum of 30 bases containing the base sequence of SEQ ID NO: 4 of the sequence list on the 3 ′ end side Primer set consisting of DNA PCR primers
(11) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side of the sequence listing
(12) A PCR primer composed of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 on the 3 ′ end side of the sequence listing, and a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 of the sequence listing on the 3 ′ end side Primer set consisting of DNA PCR primers
(13) a PCR primer composed of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side;
PCR primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 10 on the 3 ′ end side of the sequence listing, and DNA of up to 30 bases containing the base sequence of SEQ ID NO: 11 of the sequence listing on the 3 ′ end side Primer set consisting of PCR primers
(14) A PCR primer consisting of a DNA having a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 12 on the 3 ′ end side of the sequence listing, and a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 of the sequence listing on the 3 ′ end side Primer set consisting of DNA PCR primers
(15) A PCR primer consisting of a DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 14 on the 3 ′ end side of the sequence listing, and a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 of the sequence listing on the 3 ′ end side Primer set consisting of DNA PCR primers
(16) A PCR primer consisting of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 16 on the 3 ′ end side of the sequence listing, and a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 of the sequence listing on the 3 ′ end side A PCR primer consisting of DNA, a PCR primer consisting of up to 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 18 in the sequence listing on the 3 ′ end side, and a nucleotide sequence of SEQ ID NO: 19 in the sequence listing on the 3 ′ end side Primer set consisting of PCR primers consisting of up to 30 bases of DNA

Item 2. The primer set according to (1) of claim 1.

Item 3. The primer set according to (2) of claim 1.

Item 4. The primer set according to (1) of claim 1.

Item 5. The primer set according to (1) of claim 1.

Item 6. The primer set according to (5) of claim 1.

Item 7. The primer set according to (1) of claim 1.

Item 8. The primer set according to (7) of claim 1.

Item 9. The primer set according to (1) of claim 1.

Item 10. The primer set according to (9) of claim 1.

Item 11. The primer set according to (10) of claim 1.

Item 12. The primer set according to (11) of claim 1.

Item 13. The primer set according to (12) of claim 1.

Item 14. The primer set according to (13) of claim 1.

Item 15. The primer set according to (14) of claim 1.

Item 16. The primer set according to (15) of claim 1.

Item 17. The primer set according to (16) of claim 1.

Item 18. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to any one of claims 2 to 15 using the DNA as a template, and a sample by detecting the amplified DNA A method for detecting a specific animal and a specific plant, comprising the step of detecting whether or not the specific animal and the specific plant are present therein.

Item 19. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 2 or 10 using this DNA as a template, and detecting sesame in the sample by detecting the amplified DNA. A method for detecting a specific plant, comprising a step of detecting whether or not the plant exists.

Item 20. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 3 or 11 using this DNA as a template, and melon in the sample by detecting the amplified DNA. A method for detecting a specific plant, comprising a step of detecting whether or not the plant exists.

Item 21. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 4 or 12 using this DNA as a template, and a tuna in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising the step of detecting whether or not it exists.

Item 22. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 5 or 13 using this DNA as a template, and detecting the amplified DNA, A method for detecting a specific animal, comprising the step of detecting whether or not it exists.

Item 23. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 6 or 14 using the DNA as a template, and detecting the amplified DNA A method for detecting a specific animal, comprising the step of detecting whether or not it exists.

Item 24: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 7 or 15 using the DNA as a template, and presence of tart in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising: detecting whether or not

Item 25: A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 8 or 16 using the DNA as a template, and detecting tuna in the sample by detecting the amplified DNA. A method for detecting a specific animal, comprising the step of detecting whether or not it exists.

Item 26. A step of extracting DNA from a sample, a step of performing PCR using the primer set according to claim 9 or 17 using the DNA as a template, and platting in the sample by detecting the amplified DNA And a step of detecting whether or not a specific animal is present.

According to the present invention, it is possible to detect DNA derived from a specific animal or plant (sesame, melon, tuna, yellowtail, horse mackerel, octopus, scallop) with high accuracy and detection sensitivity by nucleic acid analysis using PCR or the like. There is an effect that it is possible to perform a quality control inspection such as whether or not the specific animal or plant is mixed in the food material or the test food or whether it is used. Also,
It also contributes to prevention of allergies and investigation of causative substances when allergic symptoms occur.

It is the photograph after the electrophoresis which showed the detection sensitivity of DNA at the time of using the primer set in this invention. (A) A photograph after electrophoresis showing the detection sensitivity of sesame DNA in PCR using SEQ ID NO: 1 and SEQ ID NO: 2. (B) A photograph after electrophoresis showing the detection sensitivity of melon DNA in PCR using SEQ ID NO: 3 and SEQ ID NO: 4. (C) A photograph after electrophoresis showing the detection sensitivity of bluefin tuna DNA in PCR using SEQ ID NO: 5 and SEQ ID NO: 6. (D) A photograph after electrophoresis showing the sensitivity of detection of yellowtail DNA in PCR using SEQ ID NO: 7 and SEQ ID NO: 8. (E) A photograph after electrophoresis showing the detection sensitivity of horse mackerel DNA in PCR using SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11. (F) A photograph after electrophoresis showing the detection sensitivity of madara DNA in PCR using SEQ ID NO: 12 and SEQ ID NO: 13. (G) A photograph after electrophoresis showing the detection sensitivity of octopus DNA in PCR using SEQ ID NO: 14 and SEQ ID NO: 15. (H) A photograph after electrophoresis showing the detection sensitivity of scallop DNA in PCR using SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. It is the photograph after the electrophoresis which showed the detection of the DNA derived from the specific animals and plants in the food containing the specific animals and plants using the primer set in the present invention. (A) It is the photograph after the electrophoresis of the detection result of specific plant origin DNA in each animal and plant containing foodstuff in PCR using sequence number 1 and sequence number 2. (B) It is the photograph after the electrophoresis of the detection result of specific plant origin DNA in each animal and plant containing foodstuff in PCR using sequence number 3 and sequence number 4. (C) It is the photograph after the electrophoresis of the detection result of the DNA derived from the specific animal in each animal and plant containing food in PCR using sequence number 5 and sequence number 6. (D) It is the photograph after the electrophoresis of the detection result of the DNA derived from the specific animal in each animal and plant containing food in PCR using sequence number 7 and sequence number 8. (E) Photograph after electrophoresis of detection results of DNA derived from a specific animal in each animal and plant-containing food in PCR using SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11. (F) It is the photograph after electrophoresis of the detection result of the DNA derived from the specific animal in each animal and plant containing food in PCR using sequence number 12 and sequence number 13. (G) It is the photograph after the electrophoresis of the detection result of the DNA derived from the specific animal in each animal and plant containing food in PCR using sequence number 14 and sequence number 15. (H) It is the photograph after the electrophoresis of the detection result of the DNA derived from the specific animal in each animal and plant containing food in PCR using sequence number 16, sequence number 17, sequence number 18, and sequence number 19.

Hereinafter, the present invention will be described in detail.
PCR primer sets for detection of specific animals and plants The present inventors have developed the following 8 types of PCR primer sets for detection of specific animals and plants according to the above-mentioned purpose. The PCR primer set for detecting specific animals and plants of the present invention includes those having a base sequence characteristic of sesame, those having a base sequence characteristic of melon, those having a base sequence characteristic of tuna, characteristic of yellowtail That have a unique base sequence, those that have a unique base sequence, those that have a unique base sequence, those that have a characteristic base sequence in octopus, and those that have a characteristic base sequence There is something to have.

  In developing a PCR primer set for detecting sesame and a PCR primer set for detecting melon, first, about 550 plants including sesame-related plants and melon-related plants, chloroplast rbcL (large subunit gene for ribulose-1, 5-bisphosphate carboxylase / oxygenase) gene sequence obtained from a known DNA database (GenBank nucleotide sequence database), or obtained by analyzing the gene sequence of some plants independently, and multiplex of these vast nucleotide sequences A parallel sequence map was created, and the properties such as the similarity and specificity of the base sequence were compared in detail, but the base sequence of the gene is that of sesame is a related species of Lamiaceae, and melon is It was difficult to select a specific gene sequence region having high homology with cucumber plants such as closely related cucumbers. Therefore, we obtained chloroplast matk (maturase-encoding gene) gene sequences from a known DNA database (GenBank nucleotide sequence database) for some 250 plants including sesame-related plants and melon-related plants, or some plants. Obtained by independently analyzing the gene sequence, creating a multiple parallel sequence diagram of those enormous base sequences, and reexamining properties such as similarity and specificity of the base sequences in detail The gene sequence region specific to each can be selected, and a PCR primer set was newly designed from these regions. At the time of design, the target species for detection is set to white and black sesame for sesame, and melon and melon variant fumelon for melon. The region was designed and designed so as to hybridize under stringent conditions, but not to hybridize with a non-detection species.

When developing a PCR primer set for tuna detection, first, about 250 including 7 tuna species
Obtain mitochondrial cytochrome b gene sequences from various known organisms from a known DNA database or by analyzing the gene sequences of some organisms independently, and create multiple parallel sequence diagrams of their vast base sequences Created. In this gene region, it is difficult to select a specific gene sequence region because it is highly homologous to the close-up bonito of the closely related species, but it was difficult to design a PCR primer set. By comparing and comparing the created multiple parallel arrangement diagrams in detail, common to common bluefin tuna, yellowfin tuna, bigeye tuna, bluefin tuna, southern bluefin tuna, cocinaga and Atlantic bluefin tuna for detection purposes. A gene region different from the species other than the detection purpose, such as bonito belonging to the genus Bonito and Marsouda belonging to the genus Soda, was selected, and a PCR primer set was newly designed from that region. At the time of design, the gene sequence region of the species of interest to be detected hybridizes under stringent conditions, but the design is devised so that it does not hybridize to the species not targeted for detection. did.

  In developing a PCR primer set for detecting yellowtail, first obtain mitochondrial cytochrome b gene sequences from about 250 species of various organisms including yellowtail related species, or obtain the relevant gene sequences of some organisms. Obtained by independent analysis, we created a multiple parallel sequence diagram of those enormous base sequences. The gene region is highly homologous to the closely related species of the genus Hyacinthidae, Hiramasa and amberjack, and it was difficult to select a specific gene sequence region, and it was difficult to design a PCR primer set. By comparing the multiple parallel sequence diagrams in detail, the region for the sense primer was selected from the region having high homology with Hiramasa and Campati, and the region for the antisense primer was low with Hiramasa and Campati, but with sardine Selects regions with high homology, sense primer showing crossing property to species other than yellowtail (Hiramasa, amberjack) for detection purpose, and crossing property to another species (sardine) By combining antisense primers with each other, it hybridizes with the gene sequence region of the target yellowtail under stringent conditions. However, a PCR primer set that does not hybridize with non-detection species was devised and designed.

When developing a PCR primer set for detection of horse mackerel, we first detected the fish belonging to the commercially important genus subfamily and known about mitochondrial cytochrome b gene sequences for about 250 different organisms including about 60 species From the DNA database or by analyzing the gene sequences of some organisms independently, and created a multiple parallel sequence diagram of these enormous base sequences. In this gene region, it is common to the fishes of the family Clinicaceae for detection purposes,
Although it was difficult to select a specific gene sequence region with a low homology with related species, such as the yellowtail of the family Asteraceae, it was difficult to design a PCR primer set. The gene sequence of the fish belonging to the subfamily of the subfamily that is the target of detection by comparing and studying in detail, and conceiving that two kinds of sense primer and antisense primer are designed in a specific region and used as a mix primer. The region was newly designed by ingeniously creating a PCR primer set that hybridizes under stringent conditions but does not hybridize with a species not intended for detection.

  When developing a PCR primer set for detection, first, obtain mitochondrial 16S rRNA genes from about 200 different organisms, including codaceae, from known DNA databases, or independently analyze the gene sequences of some organisms And created a multiple parallel sequence diagram of these enormous base sequences. By comparing and comparing the details of the created multiple parallel arrangement diagrams, it is possible to obtain commercially important items such as the cod of the cod family, the cod of the cod family, the cod of the cod family, the walleye cod of the cod family, and the cod of the cod family. A gene region that is common to cod fish and is different from the species other than the detection target was selected, and a PCR primer set was newly designed from that region. At the time of design, the gene sequence region of the species to be detected is hybridized under stringent conditions, but has been devised so that it does not hybridize to the species not to be detected. Designed.

In developing a PCR primer set for detecting octopus, we first acquired 16S rRNA genes of mitochondrion from a known DNA database for about 700 different organisms, including about 550 molluscs such as octopus, squid and shellfish. The gene sequences of some organisms were obtained by analyzing them independently, and a multiple parallel sequence diagram of their enormous base sequences was created. In this gene region, select the specific gene sequence region that is common to the octopus species (A. octopus, Apiaceae) and has low homology with the related squid species (Decapoda). Although it was difficult to design a PCR primer set, it was difficult to design a PCR primer set, and we compared multiple parallel sequence diagrams in detail, and designed two types of sense primers and antisense primers in a specific region. The PCR primer set that hybridizes under stringent conditions with the relevant gene sequence region of fish belonging to the octopus species targeted for detection but does not hybridize with species not targeted for detection. Innovatively designed.

When developing a PCR primer set for detecting scallops, first obtain mitochondrial 16S rRNA gene from a known DNA database for about 700 various organisms including about 550 molluscs such as octopus, squid, shellfish, or The gene sequences of some organisms were obtained by independently analyzing them, and a multiple parallel sequence diagram of their enormous base sequences was created. In this gene region, the base sequence of the scallop Patinopecten genus scallop inhabiting the sea near Japan, which is the detection purpose, and the James scallop, New Zealand scallop, European scallop, etc. Since the homology is extremely low, select a specific gene sequence region that is common to these scallops and has low homology with the related species Aequipecten genus Itaya DNA, Chlyms genus DNA Although it was difficult to design a PCR primer set, it was difficult to design a primer set for detecting the scallop Patinopecten scallops and for detecting scallops inhabiting the open sea such as Pecten scallops, New Zealand scallops, European scallops, etc. Design and mix primer sets in specific areas By conceive be used as primers, the gene sequence region scallops such as the detection object and is a PCR primer sets that do not hybridize under stringent conditions with ingenuity, newly designed.

  In the PCR analysis using the PCR primer set for detecting a specific plant according to the present invention, the target sample may be a processed product. When analyzing a processed product, since the DNA may be degraded or fragmented, a PCR primer that forms a PCR amplification product having a short length of about 70 to 250 bp is preferable for high sensitivity analysis. Therefore, when designing the PCR primers, the PCR amplification product was designed so that the length of the PCR amplification product was 250 bp or less. Moreover, making the PCR reaction conditions of these PCR primer sets the same contributes to a reduction in the number of PCR reactions in actual analysis. Therefore, in the PCR reaction, specifically, sesame, melon, and octopus at 64 ° C for 10 seconds, tuna, yellowtail, scallop, so that the annealing temperature and annealing time of the PCR primer that most affects the reaction conditions are the same. The PCR primer was designed by devising an annealing condition at 66 ° C. for 10 seconds.

Therefore, sesame, melon, tuna, yellowtail, horse mackerel, tuna, octopus, or scallops contained in various foods using nucleic acid analysis techniques such as PCR using the PCR primer set for detecting specific animals and plants of the present invention. The derived DNA can be detected with high sensitivity and specificity.
Here, nucleic acid analysis refers to the presence or absence of a characteristic base sequence by analyzing the presence or absence of a characteristic base sequence depending on individual species, genus, or group in biological classification. It is an effective means for grasping the species, genus, or group of the organism, and is a method usefully used for detecting a specific microorganism or identifying a species.

The base sequences of the primers provided by the present invention are as follows.
Base number 123456789012345678901234567
Sequence number 1 (sesame S) CGATTCTATCTCAACGAGTATTGTAAG
Sequence number 2 (sesame AS) CCGTAGAAAGACGAAAATGGC
Sequence number 3 (melon S) TTTCAAAAGATACGCCACTTCTT
Sequence number 4 (melon AS) CCATACCACTGAAGTATTTAATCGA
Sequence number 5 (Tuna S) CTTCTTTTCCTTCACGAAACAGGT
Sequence number 6 (Tuna AS) CGAGTGCCACTAGCAGGATCA
Sequence number 7 (Buri S) GCTGGGCTTTGCTACCCTGCTG
Sequence number 8 (Buri AS) GTTACTAGGGGGTTTGCGGGGAC
Sequence number 9 (Aji S) AACTCTAATGGCAAAnCTCCGT
(In SEQ ID NO: 9, n represents C or T.)
However, those of SEQ ID NO: 9 C and T are used as mix primers. The same applies hereinafter.
Sequence number 10 (Aji AS1) GAGCAGGGAGGTCAATTAGTGA
Sequence number 11 (Aji AS2) GAGCAGGGAGGTCGATTAATGA
Sequence number 12 (Tara S) CTTAGTGATATTTACTGAAG
Sequence number 13 (Tara AS) GTTATACCGGATCAGAAA
Sequence number 14 (octopus S) GGCTAGAATGAATGGTTTGACGAnA
(In SEQ ID NO: 14, n represents G or A.)
However, G of SEQ ID NO: 14 and A are used as mix primers. Less than,
All are the same.
Sequence number 15 (octopus AS) TTATTCCTTGATCACCCCAAnC
(In SEQ ID NO: 15, n represents C or T.)
However, C and SEQ ID NO: 15 are used as mix primers. Less than,
All are the same.
Sequence number 16 (scallop S1) TGTGTCAGCGTTAAAGAGCAGATA
Sequence number 17 (scallop S2) CCGAATCGTTGAGGAGCACTA
Sequence number 18 (scallop AS1) TCAAGATTTTCATGTTTTGTGGG
Sequence number 19 (scallop AS2) TAATCACACCTTAATGTTTGTGGG
Moreover, as a primer which consists of DNA of 30 bases which this invention provides, the thing of the following base sequences can be raised, for example.
Sequence number 20 (sesame S) attCGATTCTATCTCAACGAGTATTGTAAG
Sequence number 21 (sesame AS) agattggttCCGTAGAAAGACGAAAATGGC
Sequence number 22 (melon S) attctggTTTCAAAAGATACGCCACTTCTT
Sequence number 23 (melon AS) tgagtCCATACCACTGAAGTATTTAATCGA
Sequence number 24 (tuna S) cttcacCTTCTTTTCCTTCACGAAACAGGT
Sequence number 25 (tuna AS) ctagagaggCGAGTGCCACTAGCAGGATCA
Sequence number 26 (Buri S) aaggacctGCTGGGCTTTGCTACCCTGCTG
Sequence number 27 (Buri AS) aggcgggGTTACTAGGGGGTTTGCGGGGAC
Sequence number 28 (Aji S) actacaagAACTCTAATGGCAAAnCTCCGT
(In SEQ ID NO: 28, n represents C or T.)
However, those of C in SEQ ID NO: 28 and those of T are used as mix primers. Less than,
All are the same.
SEQ ID NO: 29 (Aji AS1) gttcgaggGAGCAGGGAGGTCAATTAGTGA
Sequence number 30 (Aji AS2) gttcgaggGAGCAGGGAGGTCGATTAATGA
Sequence number 31 (Tara S) acagtaaaaaCTTAGTGATATTTACTGAAG
Sequence number 32 (Tara AS) gttcgttgatcgGTTATACCGGATCAGAAA
Sequence number 33 (octopus S) attagGGCTAGAATGAATGGTTTGACGAnA
(In SEQ ID NO: 33, n represents G or A.)
However, G of SEQ ID NO: 33 and A are used as mix primers. Less than,
All are the same.
Sequence number 34 (octopus AS) ttatatttTTATTCCTTGATCACCCCAAnC
(In SEQ ID NO: 34, n represents C or T.)
However, those of C in SEQ ID NO: 34 and those of T are used as mix primers. Less than,
All are the same.
Sequence number 35 (scallop S1) attgacTGTGTCAGCGTTAAAGAGCAGATA
Sequence number 36 (scallop S2) tatttgtggCCGAATCGTTGAGGAGCACTA
SEQ ID NO: 37 (scallop AS1) ctgttaaTCAAGATTTTCATGTTTTGTGGG
SEQ ID NO: 38 (scallop AS2) ttctgaTAATCACACCTTAATGTTTGTGGG

The present invention provides, as a first primer set, base numbers 13 to 27 in SEQ ID NO: 1 in the sequence listing.
PCR primer consisting of DNA with a maximum of 30 bases at the shortest 15 including the nucleotide sequence of 3 'end side as a sense primer, and a minimum of 15 including the base sequence of base numbers 7 to 21 in SEQ ID NO: 2 in the sequence listing on the 3' end side We propose a primer set that uses PCR primers consisting of DNA of up to 30 bases as antisense primers. This primer set can be suitably used for sesame detection. This primer set, when donated to PCR, specifically binds to the matK gene of sesame chloroplasts, but does not detectably amplify the matK gene of chloroplasts from other organisms. It can be used as a primer set for PCR for detection. In addition, the DNA can be detected with high sensitivity.

Further, the present invention provides the second primer set as a base number in SEQ ID NO: 3 in the sequence listing.
A PCR primer consisting of DNA with a maximum of 15 and 30 bases including the base sequence of 9 to 23 on the 3 'end side is sensed, and the base sequence of base numbers 11 to 25 in SEQ ID NO: 4 in the sequence listing is on the 3' end side We propose a primer set that uses as a antisense primer a PCR primer consisting of DNA consisting of a minimum of 15 and a maximum of 30 bases. This primer set can be suitably used for melon detection. This primer set both binds specifically to the melon chloroplast matK gene when donated to PCR, but does not detectably amplify the chloroplast matK gene from other organisms. It can be used as a primer set for PCR for detection. In addition, the DNA can be detected with high sensitivity.

The present invention also provides a base number in SEQ ID NO: 5 in the sequence listing as the third primer set.
A PCR primer consisting of a DNA of a minimum of 15 and a maximum of 30 bases containing a 10-24 base sequence on the 3 ′ end side is used as a sense primer, and the base sequence of base numbers 7-21 in SEQ ID NO: 6 in the sequence listing is on the 3 ′ end side We propose a primer set that uses as a antisense primer a PCR primer consisting of DNA consisting of a minimum of 15 and a maximum of 30 bases. Both of these primer sets specifically bind to the tuna mitochondrial cytochrome b gene when subjected to PCR, but do not detectably amplify the mitochondrial cytochrome b gene from other organisms. It can be used as a primer set for PCR for detection. In addition, the DNA can be detected with high sensitivity.

In addition, the present invention provides a base number in SEQ ID NO: 7 in the sequence listing as the fourth primer set.
A PCR primer consisting of a DNA of 8 to 22 nucleotides at the shortest and a maximum of 30 nucleotides containing the nucleotide sequence of 8 to 22 on the 3 ′ end side is used as a sense primer, and the nucleotide sequence of nucleotide numbers 9 to 23 in SEQ ID NO: 8 in the sequence listing is on the 3 ′ end side. We propose a primer set that uses as a antisense primer a PCR primer consisting of DNA consisting of a minimum of 15 and a maximum of 30 bases. When this primer set is subjected to PCR, both specifically bind to the cytochrome b gene of the mitochondrial mitochondrion, but do not detectably amplify the cytochrome b gene of other mitochondrial mitochondria. It can be used as a PCR primer for detection. In addition, the DNA can be detected with high sensitivity.

In addition, the present invention provides a base number in SEQ ID NO: 9 of the sequence listing as the fifth primer set.
A PCR primer consisting of DNA with a maximum of 15 bases and a maximum of 15 bases containing the base sequence of 8-22 on the 3 'end side is used as the sense primer, and the base sequence of base numbers 8-22 in SEQ ID NO: 10 of the sequence listing is on the 3' end side PCR primer consisting of DNA with a minimum of 15 and 30 bases, and PCR primer consisting of DNA with a minimum of 15 and a maximum of 30 bases including the base sequence of nucleotide numbers 8 to 22 in SEQ ID NO: 11 in the sequence list on the 3 ′ end side. A primer set is proposed. Both of these primer sets specifically bind to the mitochondrial cytochrome b gene of the same mitochondrion when subjected to PCR, but do not detectably amplify the mitochondrial cytochrome b gene of other organisms. It can be used as a PCR primer for detection. In addition, the DNA can be detected with high sensitivity.

Further, the present invention uses, as a sixth primer set, a PCR primer consisting of a DNA having a shortest of 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 12 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 13 in the sequence list on the 3 ′ end side is used as an antisense primer. This primer set, when subjected to PCR, specifically binds to both and the resulting mitochondrial 16S rRNA gene, but does not detectably amplify mitochondrial 16S rRNA gene from other organisms, so DNA It can be used as a PCR primer for detection. In addition, the DNA can be detected with high sensitivity.

In addition, the present invention uses, as a seventh primer set, a PCR primer consisting of a DNA having a shortest of 15 and a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 14 in the sequence listing on the 3 ′ end side as a sense primer. As the 15th primer, the base number in SEQ ID NO: 15 of the sequence listing
We propose a primer set using as a antisense primer a PCR primer consisting of DNA consisting of 15 to 30 bases at the shortest, containing 8-22 base sequences on the 3 'end side. This primer set, when subjected to PCR, specifically binds to the mitochondrial 16S rRNA gene, but does not detectably amplify mitochondrial 16S rRNA gene from other organisms. It can be used as a PCR primer for detection. In addition, the DNA can be detected with high sensitivity.

In addition, the present invention provides, as an eighth primer set, a PCR primer consisting of a DNA having a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 16 of the sequence list on the 3 ′ end side, and The shortest 15 maximum 30 including the base sequence of base numbers 10-24 in SEQ ID NO: 17 on the 3 ′ end side
A PCR primer consisting of a DNA of a base is a sense primer, and a PCR primer consisting of a DNA of a maximum of 15 bases and a maximum of 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 18 in the sequence list on the 3 ′ end side and the sequence list A primer set is proposed in which a PCR primer consisting of a DNA consisting of DNA of a maximum of 15 and a maximum of 30 bases containing the base sequence of base numbers 10 to 24 at number 19 on the 3 ′ end side is used as an antisense primer. This primer set, when subjected to PCR, specifically binds to mitochondrial 16S rRNA genes, but does not detectably amplify mitochondrial 16S rRNA genes from other organisms. It can be used as a primer for PCR for detecting DNA. In addition, the DNA can be detected with high sensitivity.

In each primer, the length of the base sequence is 15 to 30 because the appropriate length of the base sequence as a primer for PCR is about 15 to 30, and 15 bases on the 3 ′ end side. It is important to specify the sequence about 15 at the 3 'end in the PCR-specific amplification reaction. The base sequence at the 5' end is slightly different or the sequence length is slightly different. Even so, the adverse effect on the PCR reaction itself is usually small.

In the present invention, furthermore, as a preferred embodiment of the first primer set, a PCR primer (1 ′) (most preferably) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (2 ') (most preferred) consisting of DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side as a primer, and a primer composed of DNA of the base sequence of SEQ ID NO: 1 Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 2. This primer set can be suitably used for sesame detection, and it is most preferable to use the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 as a set. A specific example of (1 ′) is the primer of SEQ ID NO: 20, and a specific example of (2 ′) is the primer of SEQ ID NO: 21.

As a preferred embodiment of the second primer set, the base sequence of SEQ ID NO: 3 in the sequence listing is used.
A PCR primer (3 ') (most preferably a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 3) consisting of DNA of a maximum of 30 bases contained on the 3' end side is used as a sense primer, and SEQ ID NO: 4 in the sequence listing.
We propose a primer set that uses as a antisense primer a PCR primer (4 ') (most preferably a primer consisting of DNA of SEQ ID NO: 4) consisting of up to 30 bases of DNA containing the base sequence of 3' at the 3 'end. . This primer set can be suitably used for melon detection, and it is most preferable to use the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 as a set. A specific example of (3 ′) is the primer of SEQ ID NO: 22, and a specific example of (4 ′) is the primer of SEQ ID NO: 23.

Further, as a preferred embodiment of the third primer set, the base sequence of SEQ ID NO: 5 in the sequence listing is
A PCR primer (5 ') (most preferably a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 5) consisting of DNA of up to 30 bases included at the 3' end side is used as the sense primer, and the nucleotide sequence of SEQ ID NO: 4 in the sequence listing is A primer set is proposed in which a PCR primer (6 ') (most preferably a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 6) consisting of DNA of 30 nucleotides at the 3' end is used as an antisense primer. This primer set can be suitably used for tuna detection, and it is most preferable to use the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 as a set. A specific example of (5 ′) is the primer of SEQ ID NO: 24, and a specific example of (6 ′) is the primer of SEQ ID NO: 25.

As a preferred embodiment of the fourth primer set, the base sequence of SEQ ID NO: 7 in the sequence listing is
The PCR primer (7 ') (most preferably a primer consisting of DNA of SEQ ID NO: 7) consisting of DNA of up to 30 bases contained at the 3' end is used as a sense primer, and the base sequence of SEQ ID NO: 8 in the sequence listing is A primer set is proposed in which a PCR primer (8 ') (most preferably a primer consisting of DNA with a nucleotide sequence of SEQ ID NO: 8) consisting of DNA consisting of a maximum of 30 bases at the 3' end is used as an antisense primer. This primer set can be suitably used for detection of buri, and it is most preferable to use the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 as a set. A specific example of (7 ′) is the primer of SEQ ID NO: 26, and a specific example of (8 ′) is the primer of SEQ ID NO: 28.

Further, as a preferred embodiment of the fifth primer set, the base sequence of SEQ ID NO: 9 in the sequence listing is
The PCR primer (9 ') consisting of DNA of up to 30 bases included at the 3' end side (most preferably a primer consisting of DNA of the nucleotide sequence of SEQ ID NO: 9) is used as a sense primer, and the nucleotide sequence of SEQ ID NO: 10 in the sequence listing is PCR primer (10 ') (most preferably a primer consisting of DNA of SEQ ID NO: 10) consisting of DNA of a maximum of 30 bases contained on the 3' end side and the nucleotide sequence of SEQ ID NO: 11 in the sequence listing on the 3 'end side A primer set is proposed in which a PCR primer (11 ′) consisting of a maximum of 30 bases of DNA (most preferably a primer consisting of DNA of the base sequence of SEQ ID NO: 11) is used as an antisense primer. This primer set can be suitably used for horseradish detection, and it is most preferable to use the primer of SEQ ID NO: 9, the primer of SEQ ID NO: 10, and the primer of SEQ ID NO: 11 as a set. Specific examples of (9 ′) include the primer of SEQ ID NO: 28, specific examples of (10 ′) include the primer of SEQ ID NO: 29, and specific examples of (11 ′) include the primer of SEQ ID NO: 30.

Further, as a preferred embodiment of the sixth primer, a PCR primer (12 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 12 PCR primer (13 ′) (most preferably SEQ ID NO: 8) consisting of up to 30 bases of DNA comprising the nucleotide sequence of SEQ ID NO: 13 on the 3 ′ end side as a sense primer We propose a primer set that uses antisense primers as primers. This primer set is preferably used for detection, and most preferably the primer of SEQ ID NO: 12 and the primer of SEQ ID NO: 13 are used as a set. A specific example of (12 ′) is the primer of SEQ ID NO: 31, and a specific example of (13 ′) is the primer of SEQ ID NO: 32.

In addition, as a preferred embodiment of the seventh primer, a PCR primer (14 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 14 in the sequence listing on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 14 PCR primer (15 ′) (most preferably SEQ ID NO: 15) consisting of DNA of up to 30 bases containing the nucleotide sequence of SEQ ID NO: 15 on the 3 ′ end side as a sense primer We propose a primer set using a primer composed of DNA of This primer set can be suitably used for detecting octopus, and it is most preferable to use the primer of SEQ ID NO: 14 and the primer of SEQ ID NO: 15 as a set. A specific example of (14 ′) is the primer of SEQ ID NO: 33, and a specific example of (15 ′) is the primer of SEQ ID NO: 34.

Further, as a preferred embodiment of the eighth primer set, a PCR primer (16 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 16 on the 3 ′ end side of the sequence listing (most preferably the base of SEQ ID NO: 16 PCR primer (17 ') (most preferably DNA of the nucleotide sequence of SEQ ID NO: 17) consisting of DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 17 on the 3' end side of the sequence listing) PCR primer (18 ') (most preferably DNA having the nucleotide sequence of SEQ ID NO: 18) consisting of DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 18 on the 3' end side as a sense primer. PCR primer (19 ') (most preferably a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 19) consisting of DNA of a maximum of 30 nucleotides containing the nucleotide sequence of SEQ ID NO: 19 on the 3' end side of the sequence listing Antisen To propose a primer set to primer. This primer set can be suitably used for scallop detection, and it is most preferable to use the primer of SEQ ID NO: 16, the primer of SEQ ID NO: 17, the primer of SEQ ID NO: 18, and the primer of SEQ ID NO: 19 as a set. A specific example of (16 ′) is a primer of SEQ ID NO: 35, a specific example of (17 ′) is a primer of SEQ ID NO: 36, a specific example of (18 ′) is a primer of SEQ ID NO: 37, (19 ′ ) Can be exemplified by the primer of SEQ ID NO: 38.

In addition, each primer was designed so as not to cause hybridization between the sense primer and the antisense primer or hybridization by each primer itself, that is, to avoid so-called primer dimer formation as much as possible. . For example, in order to avoid the formation of primer dimers, base substitution is performed on the primers so as not to reduce the detection specificity and detection sensitivity of the primers. The base of base number 8 in SEQ ID NO: 1 which is a sense primer of the sesame detection primer is originally T, but in order to avoid the formation of primer dimers by the sense primer and the antisense primer, the detection specificity of the primer and As a base substitution that does not lead to a decrease in detection sensitivity, A is adopted instead of T. Similarly, the base of base number 13 in SEQ ID NO: 7 is substituted from A to T, and the base of base number 4 in SEQ ID NO: 17 is substituted from C to A.

Although the base sequence of the primer provided by the present invention has been comprehensively described, a primer that does not have the intended performance (detection sensitivity, etc.) is designed even if the primer is theoretically designed successfully. There is a case. For example, in the research stage of the present invention, detection is low in PCR using a PCR primer set for detecting sesame consisting of SEQ ID NO: 39 and SEQ ID NO: 40, and a PCR primer set for detecting melon consisting of SEQ ID NO: 41 and SEQ ID NO: 42 Sensitivity (100 pg DNA) was shown. In this way, simply designing a primer logically does not necessarily obtain the intended performance (detection sensitivity, etc.), and may not have the required performance. In addition to logical design, further innovation and performance evaluation tests are important. The primer provided by the present invention is designed by further devising the logical design, and finally the performance evaluation test is cleared.

Sequence number 39 sesame S AATTCTCATGTATGTGAATATGAAG
Sequence number 40 Sesame AS GTTCGCCTGAAAATCCTTAAC
SEQ ID NO: 41 Melon S GACAAAAAATCCAGTTTACTAATG
SEQ ID NO: 42 Melon AS GGATGTTTGTTATAATAATTAGACGAC
(S represents a sense primer and AS represents an antisense primer.)

Specific animal and plant detection method The specific plant detection method of the present invention comprises a step of extracting DNA from a sample, a step of performing PCR using the primer set of the present invention using this DNA as a template, and detecting the amplified DNA. And detecting whether sesame, melon, tuna, yellowtail, horse mackerel, octopus, or scallop is present in the sample.

  That is, by using the PCR primer set for detecting a specific plant of the present invention to analyze nucleic acid of DNA in a sample by PCR or the like, it is possible to specifically detect a specific plant in the sample. At this time, when detecting sesame, the PCR primer set for detecting sesame is used, and when detecting melon, tuna, yellowtail, horse mackerel, octopus, and scallop, PCR primers for detecting melon are also used. A PCR primer set for tuna detection, a PCR primer set for yellowtail detection, a PCR primer set for horsetail detection, a PCR primer set for detection, a PCR primer set for octopus detection, and a PCR primer set for scallop detection may be used.

The type of detection method (nucleic acid analysis) is not particularly limited, and a known method can be used as appropriate. For example, a method of PCR amplification using PCR primers, a method of detecting a PCR amplification product with a probe, and the like can be exemplified.

  As a method of PCR amplification using PCR primers, the target nucleotide sequence in DNA in a sample is selectively amplified using the above-mentioned primer set for detecting specific animals and plants of the present invention selected according to the detection purpose, and PCR amplification The method of measuring the presence or absence of a product is mentioned. Confirmation of the presence or absence of a PCR amplification product can usually be performed by separating the PCR amplification product by agarose gel electrophoresis and staining with nucleic acid such as ethidium bromide or cyber green I. When PCR is performed using a real-time PCR apparatus, the presence or absence of a PCR amplification product can be automatically confirmed by the detection system of the apparatus. For example, when Cyber Green I is added to the PCR reaction solution, the amount of PCR amplification product depending on the amount of fluorescence emitted when Cyber Green I binds to double-stranded DNA can be monitored for each cycle. Furthermore, it is possible to confirm whether or not the PCR amplification product is the target amplification product by performing a melting curve analysis of the PCR amplification product after the PCR and deriving a melting temperature (Tm) value of the PCR amplification product from the analysis. Depending on the situation, it may be difficult to make a determination based on the Tm value. In such a case, the presence and size of the amplification product may be confirmed by the agarose gel electrophoresis described above.

Specifically, the Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 1 and the primer set forth in SEQ ID NO: 2 is about 77.3 ° C., and the size of the PCR amplification product is about 150 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected in agarose electrophoresis, it indicates that sesame was present in the test sample.

The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 3 and the primer set forth in SEQ ID NO: 4 is about 79.5 ° C., and the size of the PCR amplification product is about 179 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that melon was present in the test sample.

The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 5 and the primer set forth in SEQ ID NO: 6 is about 80.5 ° C, and the size of the PCR amplification product is about 130 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that tuna was present in the test sample.

The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 7 and the primer set forth in SEQ ID NO: 8 is about 84.7 ° C., and the size of the PCR amplification product is about 105 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that yellowtail was present in the test sample.

The Tm value of the PCR amplification product using the primer shown in SEQ ID NO: 9, the primer shown in SEQ ID NO: 10 and SEQ ID NO: 11 is about 79.5 ° C., and the size of the PCR amplification product is about 77 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that a horse mackerel was present in the test sample.

The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 12 and the primer set forth in SEQ ID NO: 13 is about 83.4 ° C., and the size of the PCR amplification product is about 144 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected by agarose electrophoresis, it suggests that potatoes were present in the test sample.

The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 14 and the primer set forth in SEQ ID NO: 15 is about 76.4 ° C., and the size of the PCR amplification product is about 204 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that octopus was present in the test sample.

In addition, the Tm value of the PCR amplification product using the primer shown in SEQ ID NO: 16, the primer shown in SEQ ID NO: 17, the primer shown in SEQ ID NO: 18 and the primer shown in SEQ ID NO: 19 is about 83.8 ° C., and the size of the PCR amplification product Is about 145 or about 180 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that scallop was present in the test sample.

  As a method for detecting a PCR amplification product with a probe, as represented by the Taq Man method, a fluorescent substance-labeled probe that hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe is used for PCR. There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is decomposed after hybridization with an amplification product with a real-time PCR apparatus. Examples of other methods for detecting a PCR amplification product with a probe include a Molecular Beacon method, a Cycleave PCR method, and a method using a hybrid probe. The PCR primer used in these methods may be any of the PCR primer sets for detecting specific animals and plants of the present invention, and the target organism from the internal base sequence of the PCR amplification product amplified by each PCR primer set. A base sequence region common to the species may be separately selected, and a probe based on that region may be used.

In the method for detecting a specific animal or plant of the present invention, the type of the test sample to be targeted is not particularly limited. For example, examples of the test sample include food raw materials and processed foods. Examples of the food raw material include food raw materials that do not intentionally include a specific animal or plant produced separately in a food raw material production plant that handles the specific animal or plant. Examples of processed foods include confectionery, noodles, powdered soup, liquid soup, hot-air dried or freeze-dried ingredients, and various cooked foods containing these processed foods. Moreover, in the food manufacturing factory which handles specific animals and plants, the processed food which does not contain the specific animals and plants produced separately is mentioned. In addition, after manufacturing a processed food containing a specific animal or plant, when manufacturing a processed food that does not include the specific animal or plant, a careful cleaning operation of the food production facility with the removal of the specific animal or plant residue in mind is essential. From the viewpoint of confirming the effectiveness of this cleaning method and the presence or absence of a specific animal or plant residue in the food production facility, a wiped sample of the production facility is also included as a test sample.

In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (Notice of the Director of Food Health Department, Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, for the inspection method of foods containing allergens, November 6, 2002, 1106001) and various DNA extraction kits [for example, Nucleon PhytoPure, plant and f
ungal DNA extraction kits (Amersham Biosciences Corp., USA), DNA Extraction Iso
plantII kit (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen GmbH,
Hilden, Germany), etc.] can be applied to the above detection method as long as the DNA can be recovered. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from a sample by the above-described DNA extraction method.

The kit for detecting a specific animal or plant The present invention also relates to a kit for detecting a specific animal or plant. The configuration of the kit is not particularly limited as long as it comprises at least one PCR primer set for detecting specific animals and plants of the present invention.
Specifically, a primer composed of a DNA having a maximum of 30 bases including the base sequence of base numbers 13 to 27 in SEQ ID NO: 1 on the 3 ′ end side, and the base sequence of base numbers 7 to 21 in SEQ ID NO: 2 to the 3 ′ end Set with primers consisting of DNA of up to 30 bases on the side;
Primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 9-23 in SEQ ID NO: 3 on the 3 ′ end side and a maximum of 30 containing the base sequence of base numbers 11-25 in SEQ ID NO: 4 on the 3 ′ end side Set with primers consisting of base DNA;
Primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 5 on the 3 'end side, and a maximum of 30 containing the base sequence of base numbers 7-21 in SEQ ID NO: 6 on the 3' end side
Set with primers consisting of base DNA;
Primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 8-22 in SEQ ID NO: 7 on the 3 ′ end side, and a maximum of 30 containing the base sequence of base numbers 9-23 in SEQ ID NO: 8 on the 3 ′ end side Set with primers consisting of base DNA;
Primer consisting of DNA of up to 30 bases containing the base sequence of nucleotide numbers 8-22 in SEQ ID NO: 9 on the 3 ′ end side, maximum 30 bases containing base sequence of base numbers 8-22 in SEQ ID NO: 10 on the 3 ′ end side A set consisting of a primer consisting of the DNA of and a primer consisting of a DNA consisting of a maximum of 30 bases comprising the base sequence of nucleotide numbers 8 to 22 in SEQ ID NO: 11 on the 3 ′ end side;
A primer composed of a DNA having a maximum of 30 bases including the base sequence of base numbers 6-20 in SEQ ID NO: 12 on the 3 ′ end side and a maximum of 30 including the base sequence of base numbers 4-18 in SEQ ID NO: 13 on the 3 ′ end side
Set with primers consisting of base DNA;
Primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 11-25 in SEQ ID NO: 14 on the 3 ′ end side, and a maximum of 30 containing the base sequence of base numbers 8-22 in SEQ ID NO: 15 on the 3 ′ end side
A primer set consisting of a base DNA; and a primer consisting of a maximum of 30 base DNAs containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 16 on the 3 ′ end side; bases of base numbers 10 to 24 in SEQ ID NO: 17 Up to 30 sequences at the 3´ end
A primer composed of a base DNA, a primer composed of a maximum of 30 bases DNA containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 18 on the 3 ′ end side, and a base sequence of base numbers 9 to 23 in SEQ ID NO: 19 Specific animal and plant detection kits containing one or more sets of primers consisting of a DNA consisting of a maximum of 30 bases contained on the 'terminal side are mentioned.

And, as a preferable one, a DN of up to 30 bases including the base sequence of SEQ ID NO: 1 on the 3 ′ end side
A set of a primer consisting of A and a primer consisting of a DNA consisting of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side;
A set of a primer composed of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side and a primer composed of a DNA of a maximum of 30 bases including the base sequence of SEQ ID NO: 4 on the 3 ′ end side;
A set of a primer composed of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side and a primer consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side;
A set of a primer composed of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 on the 3 ′ end side and a primer composed of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 on the 3 ′ end side;
Primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 9 on the 3 ′ end side, primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID NO: 10 on the 3 ′ end side, and bases of SEQ ID NO: 11 Set with a primer consisting of DNA of up to 30 bases containing the sequence at the 3 ′ end;
A set of a primer consisting of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 12 on the 3 ′ end side and a primer consisting of a DNA base of up to 30 bases containing the base sequence of SEQ ID NO: 13 on the 3 ′ end side;
A set of a primer composed of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 14 on the 3 ′ end side and a primer composed of a DNA base of up to 30 bases containing the base sequence of SEQ ID NO: 15 on the 3 ′ end side; and a sequence Primer consisting of up to 30 bases of DNA containing the base sequence of No. 16 on the 3 ′ end side, primer consisting of up to 30 bases of DNA containing the base sequence of SEQ ID No. 17 on the 3 ′ end side, base sequence of SEQ ID No. 18 A specific animal and plant detection kit comprising one or more sets of a primer composed of a DNA comprising a maximum of 30 bases on the 3 ′ end side and a primer comprising a DNA sequence comprising a base sequence of SEQ ID NO: 19 on the 3 ′ end side and a DNA comprising a maximum of 30 bases Can be mentioned.

Among them, as a particularly preferred one, a primer consisting of the base sequence of SEQ ID NO: 1,
Set with a primer consisting of the base sequence of SEQ ID NO: 2;
A set of a primer consisting of the base sequence of SEQ ID NO: 3 and a primer consisting of the base sequence of SEQ ID NO: 4;
A set of a primer consisting of the base sequence of SEQ ID NO: 5 and a primer consisting of the base sequence of SEQ ID NO: 6;
A set of a primer consisting of the base sequence of SEQ ID NO: 7 and a primer consisting of the base sequence of SEQ ID NO: 8;
A primer consisting of the base sequence of SEQ ID NO: 9, a primer consisting of the base sequence of SEQ ID NO: 10,
And a set consisting of a primer consisting of the nucleotide sequence of SEQ ID NO: 11;
A set of a primer consisting of the base sequence of SEQ ID NO: 12 and a primer consisting of the base sequence of SEQ ID NO: 13;
A set of a primer consisting of the base sequence of SEQ ID NO: 14 and a primer consisting of the base sequence of SEQ ID NO: 15;
A primer consisting of the base sequence of SEQ ID NO: 16, a primer consisting of the base sequence of SEQ ID NO: 17,
A specific animal and plant detection kit comprising one or more sets of a primer consisting of the base sequence of SEQ ID NO: 18 and a primer consisting of the base sequence of SEQ ID NO: 19 can be mentioned.
In addition, specific animal and plant detection kits including the above-described primer sets and probes for detecting PCR amplification products amplified by the respective primer sets are also included.

The kit can contain appropriate reagents and various containers according to the purpose of use. Specifically, polymerization reagents for synthesizing PCR primer extension products, such as heat-resistant DNA polymerase, deoxyribonucleotides, magnesium, and buffers for PCR reactions, and storage that can maintain their quality appropriately Containers and the like can be included.

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not construed as being limited to these examples. Also, without departing from the spirit of the present invention.
It can be changed as appropriate.

Example 1
Confirmation of detection specificity of PCR primer set for specific plants against various animal, plant, fungus, and bacteria-derived DNA In order to confirm the effectiveness of PCR analysis method using PCR primer set for specific plants of the present invention, An experiment to examine the detection specificity of PCR for the derived DNA was performed as follows. Purified DNA from humans, cows, pigs, chickens, Xenopus, and sturgeon was purchased from CeMines, LLC, USA.
Bluefin tuna, yellowfin tuna, bigeye tuna, bincho tuna, bonito, sesame mackerel, chub mackerel, Atlantic mackerel, yellowtail, kingfish, amberjack, maji, New Zealand mahji,
Japanese horse mackerel, striped sea bream, maraji, maanago, sardine, madara, salmon (white salmon), coho salmon, steelhead (rainbow trout), octopus, octopus, octopus, willow octopus, squid, squid, sea squid, firefly squid, scallop Purified DNA of tiger swordfish, mussel, clams, tiger abalone, tocobushi, red crab, king crab, and black tiger shrimp, after freezing the (muscle) meat portion of each sample purchased from a store, multi-beads shocker (Yasui Kikai, Osaka) Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Biosci
ences Corp., USA), DNA Extraction IsoplantII kit (Nippon Gene Co. Ltd., Japan)
Or prepared using DNeasy Blood & Tissue kit (Qiagen GmbH, Germany).

The purified black cockroach DNA was prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits from a sample that had been washed with 70% ethanol and then ground with a multi-bead shocker after washing with TBS buffer. It was used.
Sesame (white, black), perilla, egoma, thyme, spearmint, basil, oregano,
Rosemary, eggplant, potato, tomato, capsicum, wolfberry, sweet potato, kiwi fruit, carrot, burdock, melon (Amus melon, Earl melon, red melon, honeydew melon), fuyu melon (Hamiuri), cucumber, shirouri, cucumber, watermelon, Tougan, pumpkin, pickaxe, bitter gourd, soybean (yellow line), azuki, chestnut, walnut,
Apple (Fuji), strawberry, pear (Yoshimizu), cabbage, Satsuma mandarin, leek, asparagus were purchased from a store, while peach (white birch), strawberry, and rice were obtained from domestically grown farmers. For these purified DNAs, a portion of each sample (seed, pericarp, leaf, tuber) was washed with 70% ethanol, and then quickly washed with TE buffer, followed by a multi-bead shocker (Yasui Kikai, Osaka). Nucleon PhytoPure, plant and fungal DNA extraction kits, DNeasy plant Mini kits (Qiagen GmbH, Germany) or DNA Extraction Isoplant II kit
What was prepared using was used.

The purified buckwheat DNA used was a buckwheat flour purchased from a store using a multi-bead shocker, and a pulverized sample prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits.

  Purified wheat and corn DNA was purchased from BioChain Institute, Inc., USA.

Aspergillus niger IFO 9642, Saccharomyces cerevisiae IFO 0282, Escherichia coli JCM 1649T
The purified DNA of Bacillus cereus DSM 4312 is obtained by culturing each strain in an appropriate medium, and then purifying the pure gene yeast and gram-positive DNA isolation from the culture solution.
What was prepared using kit (Gentra Systems Inc., USA) was used.

Purified DNA of matsutake, shiitake, enoki mushrooms, nameko, and eringgi is obtained by freezing small pieces of samples purchased from a store and then crushing them with a multi-bead shocker. Nucleon PhytoPur
What was prepared using e, plant and fungal DNA extraction kits was used.
All purified DNAs have been subjected to RNA removal by RNase.

SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19
Each PCR primer described in is described in Operon Biotechnolog.
ies GmbH, Germany) was used in the following PCR.

After measuring the amount of various animal, plant, fungal, and bacterial DNA prepared as described above, using sterile water, the concentration of animal, plant, and fungal DNA is 1 ng / μL, and the concentration of bacterial DNA is 50 pg. / μL. A 20 μL reaction solution containing the prepared 1 μL DNA sample solution was prepared using SYBR Premix Ex Taq (Takara Bio Inc., Japan) manufactured by Takara Bio Inc. This reagent contains TaKaRa Ex Taq HS (hot start type), dNTP Mixture, Mg2 + and SYBR Green I in the solution. The reaction solution was prepared as a composition containing 250 nM sense primer and 250 nM antisense primer based on SYBR Premix Ex Taq. PCR reaction is performed with LightCycler (Roche Diagnostics GmbH, Germany), and amplification reaction conditions are as follows.

After one cycle of 95 ° C for 1 minute, heat up to 95 ° C at a rate of 20 ° C / second, hold at that temperature for 5 seconds, then drop to T ° C at a rate of 20 ° C / second, Incubate at the same temperature for 2 seconds, further increase the temperature to 72 ° C at a rate of 10 ° C / second, and then perform an amplification cycle consisting of 3 steps of keeping at the same temperature for 20 seconds. In the case of PCR primers for detection of melon, tuna, horse mackerel, tara, octopus, and scallop, 35 times were performed. T is 64 for PCR primers for detecting sesame, melon, and octopus, 66 for PCR primers for detecting tuna, yellowtail, and scallop, 62 for PCR primers for horse mackerel detection, In the case of the PCR primer for detection, it was set to 53. The PCR amplification product was recorded as the SYBR Green I-dependent fluorescence amount at the final step of each cycle. At the end of the amplification cycle, the melting curve was raised to 95 ° C at a rate of 20 ° C / s, then dropped to 60 ° C at a rate of 20 ° C / s, kept at the same temperature for 10 seconds, and then 0.2 ° C It was obtained by recording the fluorescence intensity every 0.2 seconds during a slow temperature increase to 97 ° C. at a rate of / sec. The Tm value of the PCR amplification product obtained from the melting curve by the PCR device software was used to estimate the presence or absence of a specific amplification product by PCR. Furthermore, by separating the PCR amplification product (2 μL of the reaction solution) by 1.8% (wt / vol) agarose gel electrophoresis, staining the separated gel with ethidium bromide, and then visualizing the amplification product under UV irradiation The presence or absence of the amplification product was confirmed. ΦX174 HaeIII digest DNA (Takara) was used as a molecular weight marker. The results of these PCRs are listed in Table 1. + (Plus) in the table indicates that an amplification product of the target size was detected by electrophoresis, and-(minus) indicates that the amplification product was not detected.

  When PCR primers for sesame detection (PCR primer set consisting of SEQ ID NOS: 1 and 2) are used, amplification products of around 150 bp are confirmed only when using sesame (white strain, black strain) DNA of the sesame family Sesameaceae (Table 1), the Tm value of these amplification products was about 77.7 ° C. Peripheral species Lamiaceae perilla genus, Sesame DNA, Lamiaceae Lactobacillus thyme DNA, Lamiaceae mint genus spearmint DNA, Lamiaceae Lactobacillus basil DNA, No amplification products were found when using Oregano DNA belonging to the genus Lamiaceae, Rosemary DNA belonging to the genus Rosmarinus, or other species DNA including other plants (Table 1).

  In addition, from the relationship between multiple parallel sequence diagrams of the chloroplast matK gene sequences of various known organisms and independently analyzed and PCR primer sequences, PCR using the PCR primers is sesame (white strain, black strain) DNA. Although it can be detected, it is strongly suggested not to detect other species DNA including other plants not tested in Example 1.

  The PCR primer set for melon detection (PCR primer set consisting of SEQ ID NOs: 3 and 4) uses cucumber melon (Ams melon, Earl melon, red meat melon, honeydew melon) DNA and fuyumelon (Hamiuri) DNA. Only when this was done, amplification products of around 179 bp were confirmed (Table 1), and the Tm value of these amplification products was about 79.5 ° C. Related species of the same genus Macwauli DNA, Shirouri DNA, Hamiuri DNA, Cucumber DNA, Family Watermelon Watermelon DNA, Family Carcinus Toucan DNA, Family Pumpkin genus Pumpkin DNA, No amplification products were found when using bitter gourd DNA or DNA of other species including plants (Table 1).

  In addition, from the relationship between the multiple parallel sequence diagrams related to the chloroplast matK gene sequences of various organisms known and uniquely analyzed and the PCR primer sequences, PCR using the PCR primers is a melon of the Cucurbitaceae genus (Amus melon, Although it is possible to detect Earl's melon, red meat melon, honeydew melon) DNA, fuyumelon (Hamiuri) DNA, it is strongly suggested not to detect other species DNA including other plants not tested in Example 1. .

In addition, when using PCR primers for tuna detection (PCR primer set consisting of SEQ ID NOs: 5 and 6), amplification of around 130 bp is only possible when using bluefin tuna DNA, yellowfin tuna DNA, bigeye tuna DNA, and bluefin tuna DNA. Products were identified (Table 2) and the Tm value of these amplification products was approximately 80.5 ° C. The amplification products are not seen when using other species species including bonito DNA of the related family bonito, mackerel DNA, sesame DNA, Atlantic mackerel DNA and other fish. (Table 2).

From the relationship between the multiplex parallel sequence diagram of mitochondrial cytochrome b gene sequences of known and uniquely analyzed mitochondrial cytochrome b gene sequences and PCR primer sequences, PCR using the PCR primers was carried out in Example 1. In addition to bluefin tuna DNA, yellowfin tuna DNA, bigeye tuna DNA, bluefin tuna DNA in addition to the same family of bluefin tuna DNA, cochinaga DNA, and Atlantic bluefin tuna DNA. It has been strongly suggested that it does not detect Spodoptera litura, Marsoda of the genus Solanum (Tockrigato), and DNA of other species, including Scomberomorus tritor DNA and other fish.

  In addition, when the yellowtail detection PCR primer (PCR primer set consisting of SEQ ID NOs: 7 and 8) was used, an amplification product of around 105 bp was confirmed only when yellowtail DNA of the genus Glyceridae was added (Table 1). 2) The Tm value of these amplification products was about 84.7 ° C. When using closely related species, such as Chrysanthemum DNA, Amberjack DNA, Maajia DNA, and other species of DNA, including other fish, It was not seen (Table 2).

From the relationship between the multiplex parallel sequence diagrams of the mitochondrial cytochrome b gene sequences of various organisms known and uniquely analyzed, and the PCR primer sequences, PCR using the PCR primers is a genus of the genus Glyceraceae. Although it can detect DNA, it is strongly suggested that it does not detect related species such as Aiburi DNA of the same family, the same subfamily Aiburi, Alumni of the same family, and other species including other fish. Yes.

  In addition, when PCR primers for the horse mackerel detection (PCR primer set consisting of SEQ ID NOs: 9, 10 and 11) are used, the genus Ajiaceae Maazi genus Maazi DNA, the Physicaceae genus Maazi New Zealand maji DNA, Amplification products of around 77 bp were confirmed only when subfamily mejia maji DNA, maize family ajiidae shimajima aji DNA, and ajiidae subfamily Muroazima marazi DNA were used (Table 2). Tm of these amplification products The value was about 79.5 ° C. No amplification products were found when using other species of DNA, including related species such as yellowtail DNA, kingfish DNA, amberjack DNA, and other fishes of the related family, the family of the subfamily Bristolidae (Table 2). . Aji is a general term for fishes classified in the family Hlidaceae, and specifically refers to fishes classified in the subfamily Hydrangea. For this reason, the PCR primers are intentionally designed to detect fish classified in the subfamily, and detect fish DNA classified in the subfamily as described above. It was confirmed that fish DNA to which it belongs was not detected (Table 2).

In addition, PCR using the PCR primer was carried out in Example 1 based on the relationship between the multiplex parallel sequence diagram relating to the mitochondrial cytochrome b gene sequence of various known organisms and independently analyzed and the PCR primer sequence. In addition to the azimuthae maji genus maji DNA, the genus genus majiae new zealand maji DNA, the genus genus subfamily majiae genus maji DNA, the genus genus subfamily genus genus subfamily genus majia Aji DNA belonging to the family Hydrangea (e.g., Kusayamaro DNA of the genus Hydrangea, Muroazi DNA, Hosohiraaji DNA of the genus Hydrangea, Mateji DNA of the genus Hydrangea, Gingameji, Can be detected, but can be detected. Seriola Aiburi DNA of pilot fish subfamilies rainbow runner genus rainbow runner DNA of, pompano subfamilies pompano genus pompano DNA of Marukoban DNA and, it has been strongly suggested that does not detect other species DNA containing other fish.

  In addition, when PCR primers for detection (PCR primer set consisting of SEQ ID NOs: 12 and 13) were used, an amplification product of about 144 bp was confirmed only when using the cod family Madara DNA (Table 2), The Tm value of these amplification products was about 83.4 ° C. When using other species DNA including other fish, amplification products were not found (Table 2).

From the relationship between the multiplex parallel sequence diagrams of the 16S rRNA gene sequences of mitochondrion of known and uniquely analyzed mitochondrial and PCR primer sequences, PCR using the PCR primers was performed in Example 1 In addition to genus cod DNA, it can detect commercially important cod fish such as cod gene of codaceae, cod DNA of cod genus, and cod DNA of cod genus It is strongly suggested not to detect DNA of other species including some fish.

  In addition, when PCR primers for detecting octopus (PCR primer set consisting of SEQ ID NOs: 14 and 15) were used, amplification products of around 204 bp were confirmed only when octopus DNA, mizudako DNA, iidako DNA, and willow octopus DNA were used. (Table 2) The Tm value of these amplification products was about 76.4 ° C. When DNA from other species including squid and shellfish was used, amplification products were not observed (Table 2).

  From the relationship between the multiplex parallel sequence diagrams of 16S rRNA gene sequences of mitochondrial mitochondrial of known and uniquely analyzed organisms and PCR primer sequences, PCR using the PCR primers was the octopus family tested in Example 1. In addition to octopus DNA, octopus DNA, octopus DNA, and willow octopus DNA, octopus DNA to which the octopus species (eight-armed) belongs (eg, octopus genus octopus, sunadaco, sea lion octopus, genus octopus, canten octopus) , But can not detect DNA of other species including squids (Decapoda) and other mollusks. It is strongly suggested.

  In addition, when using scallop detection PCR primers (PCR primer set consisting of SEQ ID NOs: 16, 17, 18, and 19), an amplification product of about 180 bp was confirmed only when scallop DNA belonging to the genus Patinopecten was used. (Table 2), the Tm value of these amplification products was about 83.8 ° C. Amplification products were not seen when using the relative species Argopecten squirrel oyster oyster DNA, American cypress DNA, other shellfish, and other species of DNA including mollusks (Table 2). ).

From the relationship between the multiplex parallel sequence diagrams of the 16S rRNA gene sequences of mitochondrion of known and uniquely analyzed organisms and the PCR primer sequences, PCR using the PCR primers is the oyster family tested in Example 1. In addition to Patinopecten scallop DNA, it can detect James scallop DNA, New Zealand scallop DNA, and European scallop DNA belonging to the same family, but closely related species Aequipecten genus Itaya DNA, Chlyms scallop DNA, Azumanishiki It has been strongly suggested not to detect other species DNA including Guy DNA, French Nishiki DNA and other shellfish. The PCR primers of SEQ ID NOs: 16 and 18 are suitable for detection of scallop DNA collected in the sea near Japan, and the PCR primers of SEQ ID NOs: 17 and 19 are James scallop DNA, New Zealand scallop DNA, and European scallop DNA collected overseas. Suitable for detection.

Example 2
Confirmation of PCR detection sensitivity using the PCR primer set for specific animals and plants In order to examine the detection sensitivity of PCR using the PCR primer set for specific animals and plants used in Example 1, the following experiment was performed.
Sesame (white strain), melon (earl melon), bluefin tuna, yellowtail, prepared in Example 1
Dilute the horse mackerel, madara, octopus, and scallop DNA with sterile water to obtain 1 pg / μl, 10 pg /
Dilution series of DNA solutions of μl, 100 pg / μl, and 1000 pg / μl were prepared, and 1 μL of these diluted test DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 1, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis.

As shown in FIG. 1, the detection sensitivity when using PCR primers for detecting sesame (PCR primer set consisting of SEQ ID NOs: 1 and 2) is 1 pg DNA / analysis, and PCR primers for detecting melon (SEQ ID NO: 3 The detection sensitivity when using the PCR primer set consisting of 4 and 4) is 10 pg DNA / analysis, and the detection sensitivity when using the tuna detection PCR primer (PCR primer set consisting of SEQ ID NOs: 5 and 6) is , 1 pg DNA / analysis, and the detection sensitivity when using the PCR primer for detecting yellowtail (PCR primer set consisting of SEQ ID NOs: 7 and 8) is 1 pg DNA / analysis, The detection sensitivity when using PCR primer sets (numbers 9 and 10) is 1 pg DNA / analysis, and the detection sensitivity when using PCR primers for detection (PCR primer sets consisting of SEQ ID NOs: 11 and 12) Is The detection sensitivity is 1 pg DNA / analysis, and the PCR sensitivity for detection of octopus (PCR primer set consisting of SEQ ID NOs: 11 and 12) is 10 pg DNA / analysis. The detection sensitivity in the case of using the PCR primer set consisting of Nos. 11 and 12 was 10 pg DNA / analysis.

Example 3
Detection of DNA derived from specific plants in foods containing specific animals and foods by PCR using PCR primer sets for specific animals and plants The present invention for commercial foods containing sesame, melon, tuna, horse mackerel, horse mackerel, octopus, or scallops as raw materials PCR analysis using the PCR primer set for specific animals was performed as follows to examine the practicality of the present invention.

Commercially available foods (Table 2) that clearly contain sesame, melon, tuna, horse mackerel, tuna, octopus, or scallop as raw materials were prepared, and 1 to 10 g was pulverized with a multi-bead shocker. Each DNA was extracted from 0.1-1 g of the mixed crushed material using Dneasy Plant mini kit. At the time of extraction, RNA was also removed by RNase. After measuring the amount of the extracted food sample DNA, the concentration of the food sample DNA was adjusted to 10 ng / μL using sterilized water. In addition, because it was difficult to obtain commercial foods containing yellowtail as a raw material, as a substitute sample for yellowtail-containing food, 50 pg / µL of burr DNA was added to tuna thin shaving (Hayashi Hisemon Shoten) (10 ng / µL) The one added at the concentration was used. 1 μL of these prepared DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1 using the PCR primer set for specific animals and plants used in Example 1. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 1, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis. The results of these PCRs are listed in Table 2. + (Plus) in the table indicates that the amplification product of the target size was detected by electrophoresis,-(minus) indicates that the amplification product was not detected, and ND indicates that the test was not performed. Indicates. Moreover, the result regarding agarose electrophoresis of these PCR was shown in FIG. 2 (A, B, C, D, E, F, G, and H). Furthermore, PCR amplification products amplified from food sample DNA were directly sequenced in both directions using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), then Applied Biosystems 310 Genetic Analyzer (Applied Biosystems)
The base sequence was analyzed by GenBank nucleotide sequence
Database (BLAST search) or compared with a DNA database owned by the inventors, and based on the similarity of the base sequence, the species of the DNA derived from the PCR amplification product was assigned and identified.

  As a result, when using PCR primers for detection of sesame (PCR primer set consisting of SEQ ID NOs: 1 and 2), DNA derived from sesame-containing foods, such as food delivery chopsticks (Nissin foods) and gold dish (Mitsukan) The amplification product of around 150 bp was confirmed only in [Table 3, FIG. 2 (A)], and the Tm value of this amplification product was about 77.1 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (A)]. As a result of the nucleotide sequence analysis of the PCR amplification product, the nucleotide sequence of the PCR amplification product amplified from the DNA derived from Ichimae-cho sesame tonkotsu (Nisshin Foods) and Kimo-dokoro (Mitsukan) is the matK gene of sesame chloroplasts. Matched the sequence. That is, PCR using the PCR primer does not detect sesame-derived DNA or other DNA from sesame-free food samples in a plurality of commercially available foods, but can specifically detect sesame-derived DNA from sesame-containing food samples. confirmed.

  In addition, when PCR primers for melon detection (PCR primer set consisting of SEQ ID NOs: 3 and 4) are used, only in melon-containing foods, DNA derived from Yubari Melon Caramel (Sapporo Gourmet Foods) and Yubari Melon Pure Jelly (Hori) An amplified product of around 179 bp was confirmed [Table 3, FIG. 2 (B)], and the Tm value of this amplified product was about 79.2 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (B)]. As a result of the nucleotide sequence analysis of the PCR amplification product, the nucleotide sequence of the PCR amplification product amplified from the DNA derived from Ichizen-cho sesame tonkotsu (Nisshin Foods) and gold rice dish (Mitsukan) is the matK gene of melon chloroplast Matched the sequence. That is, PCR using the PCR primer does not detect melon-derived DNA or other DNA from melon-free food samples in multiple commercial foods, but can specifically detect melon-derived DNA from melon-containing food samples. confirmed.

  In addition, when using PCR primers for tuna detection (PCR primer set consisting of SEQ ID NOs: 5 and 6), the tuna-containing foods, including Cezar Ginbei Beef Tuna (Master Foods) and Tuna Thinning (Hisao Hayashi Co., Ltd.) An amplification product of around 130 bp was confirmed only in DNA derived from Emon Shoten (Table 3, FIG. 2 (C)), and the Tm value of this amplification product was about 80.6 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (C)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Cezar Ginza Beef Tuna (Master Foods) and Tuna Shave (Hayashi Hisemon Co., Ltd.) It matched the mitochondrial cytochrome b gene sequence of the genus (yellowfin tuna etc.). That is, PCR using the PCR primer does not detect tuna-derived DNA or other DNA from tuna-free food samples in multiple commercial foods, but can specifically detect tuna-derived DNA from tuna-containing food samples. confirmed.

  In addition, when using the PCR primer for detecting yellowtail (PCR primer set consisting of SEQ ID NOs: 7 and 8), an alternative sample of food containing yellowtail [Tuna shaving with 50pg yellowtail DNA added (Hayashi Hisemon Co., Ltd.) Only in the derived DNA, an amplification product of around 105 bp was confirmed [Table 3, FIG. 2 (D)], and the Tm value of this amplification product was about 84.3 ° C. When DNA from other food samples was used, amplification products were not found [Table 2, Figure 2 (D)]. As a result of the analysis of the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the substitute sample of the food containing the yellowtail was, of course, the same as the cytochrome b gene sequence derived from the yellowtail mitochondria. That is, PCR using the PCR primer does not detect yellowtail-derived DNA or other DNA from yellowtail-free food samples in multiple commercial foods, but a small amount of yellowtail-derived DNA added to yellowtail-free food samples. It was confirmed that it could be detected specifically.

  In addition, when using a primer for detecting horse mackerel (PCR primer set consisting of SEQ ID NOs: 9, 10 and 11), it is derived from horse mackerel containing foods, Kakiage (Nagasaki / Inoue Kobo) and Topvalu Yakiji (Ion) An amplification product of around 77 bp was confirmed only in DNA [Table 3, FIG. 2 (E)], and the Tm value of this amplification product was about 79.0 ° C. When DNA from other food samples was used, amplification products were not found [Table 3, Figure 2 (E)]. As a result of the base sequence analysis of the PCR amplification products, the base sequences of the PCR amplification products amplified from the DNA derived from Toyo (Nagasaki / Inoue Kobo) and Topvalu Yakiji (Ion) are all belonging to the genus Maaji. It showed the highest similarity to the mitochondrial cytochrome b gene sequence (Maji, etc.). In other words, PCR using the PCR primer does not detect horse mackerel-derived DNA or other DNA from horse mackerel-free food samples, but can detect horse mackerel-derived DNA specifically from horse mackerel-containing food samples. confirmed.

In addition, when PCR detection primers (PCR primer set consisting of SEQ ID NOs: 12 and 13) are used, the foods that are included in the kite are Toyo (Nagasaki / Inoue Kobo), Cheese Kamaboko (Yakinen Co., Ltd.) and Mayo Only in DNA derived from (Ichiei Foods Co., Ltd.), amplification products of around 144 bp were confirmed [Table 3, FIG. 2 (F)], and the Tm value of these amplification products was about 82.9 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (F)]. As a result of the base sequence analysis of the PCR amplification products, the bases of the PCR amplification products amplified from DNA derived from Toyo (Nagasaki / Inoue Kobo), Cheese Kamaboko (Yakinen Co., Ltd.) and Mayo Tara (Ichiei Foods Co., Ltd.) The sequence was consistent with the mitochondrial 16S rRNA gene sequence of the cod species classified into the genus Genus and Walleye genus. In other words, PCR using the PCR primers does not detect any DNA or other DNA from a non-containing food sample in a plurality of commercially available foods, but can specifically detect the DNA derived from a cochlear food sample. confirmed.

  In addition, when using the PCR primer for detecting octopus (PCR primer set consisting of SEQ ID NOs: 14 and 15), the food containing octopus, frozen Nissin's Takoyaki (Nisshin Food Frozen) and just trowel taco rice crackers (stock) Amplification products of around 204 bp were confirmed only in DNA derived from Company Kawasawa [Table 3, FIG. 2 (G)], and the Tm value of these amplification products was about 77.1 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (G)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from frozen Nissin's Takoyaki (Nisshin Foods Frozen) and Otegoro Takosenbei (Kawasa Co., Ltd.) It also matched the mitochondrial 16S rRNA gene sequence of the octopus classified into the genus Octopus (Mako, etc.). That is, PCR using the PCR primer does not detect octopus-derived DNA or other DNA from octopus-free food samples in multiple commercial foods, but can detect octopus-derived DNA specifically from octopus-containing food samples. confirmed.

Furthermore, when using a scallop detection PCR primer (PCR primer set consisting of SEQ ID NOs: 16, 17, 18, and 19), it is a scallop-containing food, just trowel rice cracker (Kawasa Co., Ltd.), Scallop Dashi (Ajinomoto), Piat Scallops (Sb food) DNA
The amplification product of about 180 bp was confirmed only in Table 3 (Table 3, FIG. 2 (H)), and the Tm value of these amplification products was about 83.6 ° C. When DNA from other food samples was used, amplification products were not observed [Table 3, Fig. 2 (H)]. As a result of the base sequence analysis of the PCR amplification products, the bases of the PCR amplification products amplified from DNA derived from Otegoro Takosenbe (Kawasa Co., Ltd.), Scallop Dashi (Ajinomoto), and Piatt Scallop Chosen (Sb Food) All the sequences were identical to the 16S rRNA gene sequence derived from scallop mitochondria. That is, PCR using the PCR primer does not detect scallop-derived DNA or other DNA from scallop-free food samples in multiple commercially available foods, but specifically detects scallop-derived DNA from scallop-containing food samples. It was confirmed that it could be detected.

Claims (9)

A PCR primer consisting of a DNA with a maximum of 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 12 on the 3 ′ end side in the sequence listing and 3 base sequences of base numbers 4-18 in SEQ ID NO: 13 in the sequence listing A primer set consisting of a PCR primer consisting of up to 30 bases of DNA included at the end A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing SEQ ID NO: 14 on the 3 ′ end side, and the base sequence of base numbers 8 to 22 in SEQ ID NO: 15 of the sequence listing 3 A primer set consisting of a PCR primer consisting of up to 30 bases of DNA included at the end A PCR primer consisting of a DNA with a maximum of 30 bases including the base sequence of base numbers 7 to 21 in the sequence table in SEQ ID NO: 16 on the 3 ′ end side, and 3 base sequences of base numbers 10 to 24 in SEQ ID NO: 17 in the sequence list A PCR primer composed of DNA of up to 30 bases contained on the ′ end side, and a PCR primer composed of DNA of up to 30 bases containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 18 in the sequence listing on the 3 ′ end side, Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 9 to 23 in the sequence number 19 of the sequence table on the 3 ′ end side PCR primer consisting of DNA with a maximum of 30 bases including the base sequence of SEQ ID NO: 12 on the 3 ′ end side of the sequence listing, and DNA of maximum 30 bases including the base sequence of SEQ ID NO: 13 of the sequence listing on the 3 ′ end side Primer set consisting of PCR primers. PCR primer consisting of up to 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 14 on the 3 ′ end side of the sequence listing and DNA of up to 30 bases containing the base sequence of SEQ ID NO: 15 of the sequence listing on the 3 ′ end side Primer set consisting of PCR primers. It consists of a PCR primer consisting of a DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 16 on the 3 ′ end side and a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 of the sequence listing on the 3 ′ end side. PCR primer consisting of a PCR primer, a DNA primer having a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 18 in the sequence listing on the 3 ′ end side, and a maximum of 30 bases including the base sequence of SEQ ID NO: 19 in the sequence listing on the 3 ′ end side Primer set consisting of PCR primers consisting of DNA. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 1 or 4 using this DNA as a template, and presence of tart in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising the step of detecting whether or not there is. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 2 or 5 using this DNA as a template, and detecting otco in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising the step of detecting whether or not there is. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to claim 3 or 6 using this DNA as a template, and scallops are present in the sample by detecting the amplified DNA. A method for detecting a specific animal, comprising the step of detecting whether or not the animal is present.