JP4436438B2 - Primer and specific animal detection method - Google Patents

Description

The present invention is intended to detect mackerel, salmon, abalone, squid, crab, shrimp in a specific animal that may cause allergies, and the amount of the specific animal is contained in a food material or product. The present invention relates to a method for detecting a specific animal that can be detected with high sensitivity even in a trace amount, and a PCR primer, primer set, and kit used in the method.

From the viewpoint of preventing the occurrence of health hazards for people with a specific allergic constitution, among foods that have been found to cause food allergies, it is necessary to display them, especially considering the number of cases and severity. For processed foods that contain high wheat, buckwheat, egg, milk, and peanuts (hereinafter referred to as “specified raw materials”), it shall be stated in the product that the specified raw materials are included (Ministry of Health, Labor and Welfare, Pharmacy Foods On the enforcement of the Ministerial Ordinance to revise a part of the Ministerial Ordinance concerning the notification of the Director of Health, the Food Sanitation Law Enforcement Regulations, and the ingredient standards of milk and dairy products, March 15, 2001, Eisei No. 79). In addition, abalone, squid, shrimp, crab, salmon, mackerel, chicken, pork, how much, beef, gelatin, orange, kiwifruit, walnut, soybean, matsutake, peach, yam, apple and banana According to research on the elucidation of food allergies and allergens, serious health hazards have been seen at certain frequencies in the past in research on the elucidation of food allergies and allergens. Therefore, for processed foods that contain these as raw materials, it is recommended that efforts be made to indicate as much as possible that the foods are included as raw materials (Ministry of Health, Labor and Welfare) As for the enforcement of ministerial ordinances to revise a part of the ministerial ordinances on milk and dairy product ingredient standards, etc., March 15, 2001, Shokuhin No. 79) ( Regarding the enforcement of the Ordinance for Enforcement of the Ordinance for Enforcement of the Goods Sanitation Law and the Ministerial Ordinance on Milk and Dairy Product Component Standards, etc., on March 15, 2001, Shokuhin No. 79, Revised December 24, 2004 No. 1224002 from Shokuyasu).
Food ingredients that may cause allergies, especially allergen-causing animals and plants, can be mixed in unintended traces in the production, distribution, and processing stages. It is important to perform quality control of whether or not
Methods for detecting wheat, buckwheat, egg, milk, and peanuts, which are “specific raw materials”, have been established using ELISA, Western blot, or PCR, and such detection methods are commercially available as test kits. (The Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, Department of Food and Drug Administration, General Manager of Food Health, Notice of foods containing allergens, November 6, 2002, No. 1106001) On the other hand, detection methods for “similar to specified raw materials” have been reported for chicken, pork and beef (Japanese Patent Laid-Open No. 2003-230383 “Primer for detection of beef, pork and chicken”) (Meyer R., C. Hofelein, J. Luthy, and U. Candrian; Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food; Journal of AOAC International, 78: 1542-1551, 1995) (Takamitsu Matsunaga, Kiyohiro Shibata, Junichi Yamada, Yu Shinmura, Meat Speciation of Meat and Meat Products by Multiplex PCR, Journal of Japanese Society of Food Science and Technology, Volume 46, p. 187-194, 1999), Abalone, Squid, Shrimp, Crab, Salmon, Mackerel No matter how much gelatin, orange, kiwi fruit, walnut, soy, matsutake, peach, yam, apples and bananas, there is no clear report. It is currently difficult to conduct quality control with scientific verification regarding the presence or absence of contamination of specific animals and plants that are equivalent to “specific materials” that are unclear for these detection methods.

When detecting target organisms from food ingredients and products that have undergone various processing steps, a method that detects proteins characteristic of the target organisms (ELISA), as established by the “specific raw material” testing method Method and Western blot method) and methods that detect DNA base sequences that are characteristic of the organism to be detected (PCR method) are promising methods. , November 06, 2002, Food Departure No. 1106001). In general, proteins are less stable to various processings in the food production process than DNA, and therefore, the method for detecting proteins is likely not applicable to highly processed test foods. Therefore, the detection method targeting DNA base sequences, which are considered to be relatively stronger in processing than protein, is a method for examining the presence of target organisms in food ingredients and products that have undergone various processing steps. As a promising method. In addition, DNA sequences of animals and plants have base sequences with a large copy number such as rRNA gene clusters. If such a multi-copy base sequence can be used as a target sequence, the sensitivity of the detection method can be increased. It becomes possible. Further, when the base sequence of chloroplast-derived DNA or mitochondrial-derived DNA existing in a plurality of cells is used as a target sequence, it contributes to improvement of the sensitivity of the detection method.

When a genetically modified crop or the like is detected by PCR, the DNA base sequence to be detected is limited to the recombined DNA base sequence. On the other hand, in the case of animals and plants that exist in nature, it is clear which base sequence is selected as a detection target from countless DNA base sequences, and further, whether various base sequences are selected as detection targets for various animals and plants. There are no findings. Proteins specific to the animals and plants to be detected are selected and targeted to detect the DNA base sequence that encodes the proteins, but in this case, they are specific to each animal and plant. Specific proteins need to be selected. Even if such a specific protein can be selected, the required detection sensitivity may not be obtained if the number of copies of the DNA base sequence is small. It becomes inconvenient.

As a method for identifying or estimating the species of salmon as a test sample, a DNA base sequence amplified by a PCR primer targeting a mitochondrial cytochrome b gene sequence or a mitochondrial control region sequence (D-loop) is used as a known base. A method for comparison with a sequence has been reported (Non-patent Document 1). Although the PCR primer used in this method can amplify DNA extracted from a sample whose main component is salmon, the PCR primer cross-reactivity with other biological DNA, that is, There is no description of detection specificity, and there is no description that salmon DNA can be specifically detected in a sample containing a plurality of animals and plants such as food. Therefore, this method is not a well-validated method for specifically detecting salmon DNA in foods containing a plurality of animals and plants.
The base sequence of the above-mentioned cytochrome b gene detection PCR primer is as follows.
CytB5 (F): AAAATCGCTAATGACGCACTAGTCGA (SEQ ID NO: 11)
CytB6 (R): GCAGACAGAGGAAAAAGCTGTTGA (SEQ ID NO: 12)
This is in addition to the Salmonidae, Salmona, Salmona (other than Salmona, Salmoa are not included in the “same as the specified raw materials” of the Ministry of Health, Labor and Welfare), Salmonaceae Ivana, Salmoni Grayling It is also expected to detect eelfish, eel family eel genus (eel), and scorpion family black eel genus (maanago).
The base sequence of the above-mentioned control region sequence (D-loop) detection PCR primer is as follows.
Smc1 (F): AATGTAGTAAGAACCGACCAA (SEQ ID NO: 13)
Smc2 (R): TAGGAACCAAATGCCAGGAAT (SEQ ID NO: 14)
In addition to the salmonids, salmonids and salmoes, it is also expected to detect salmonids, sardines (salmonia), scallops, scallops (companies of scallops), and scabies (spotted mackerel). In addition to salmonids, salmones, salmones, it is expected to detect salmonids.

Furthermore, another base sequence of the above-mentioned control region sequence (D-loop) detection PCR primer is as follows. Smc3 (F): ACTTGGATATCAAGTGCATAAGGT (SEQ ID NO: 15)
Smc4 (R): CCTGGTTTAGGGGTTTAACAGG (SEQ ID NO: 16)
This is expected to detect salmonids, char, in addition to salmonids, salmoes.
Furthermore, another base sequence of the above-mentioned control region sequence (D-loop) detection PCR primer is as follows.
Smc7 (F): AACCCCTAAACCAGGAAGTCTCAA (SEQ ID NO: 17)
Smc8 (R): CGTCTTAACAGCTTCAGTGTTATGCT (SEQ ID NO: 18)
This is expected to detect salmonids, char, in addition to salmonids, salmoes.
In addition, as a method to identify or estimate species of cephalopods (squid and octopus friends), DNA base sequences amplified by PCR primers targeting the mitochondrial cytochrome oxidase III gene sequence and also the cytochrome oxidase II gene sequence were used. A method for comparison with a known base sequence has also been reported (Non-patent Document 2). The PCR primer used in this method can amplify DNA extracted from cephalopods as the main component, but the PCR primer's cross-reactivity to other organisms, ie detection. There is no description of specificity, and further, there is no description that cephalopod DNA in a sample containing a plurality of animals and plants such as food can be specifically detected. Therefore, it is not a well-validated method for specifically detecting cephalopod DNA in foods containing a plurality of animals and plants.
The base sequence of the above-mentioned cytochrome oxidase III gene detection PCR primer is as follows.
COIII1 primer: AGCCCATGACCTTTAACAGG (SEQ ID NO: 19)
COIII2 primer: GACTACATCAACAAAATGTCAGTATCA (SEQ ID NO: 20)
In addition to squid and octopus, this is also expected to detect humans, flies, Atlantic mackerel, shrimps and the like.
The base sequence of the above-mentioned cytochrome oxidase II gene detection PCR primer is as follows.
COII1: ATTGCTCTGCCTTCACTACG (SEQ ID NO: 21)
COII2: CAAATTTCTGAGCATTGACC (SEQ ID NO: 22)
In addition to squid and octopus, this is also expected to detect humans, flies, Atlantic mackerel, shrimps and the like.

In addition, as a method to enable identification of Japanese mackerel species in individual fry and immature fish, it was amplified by PCR primers targeting the intervening sequence between the 18S rRNA gene and the 5.8S rRNA gene on the chromosome. A method for examining the difference in length of amplification products has also been reported. (Patent Document 1). The PCR primers used in this method can amplify mackerel-derived DNA, and because of the difference in the length of the amplification products, it is possible to distinguish Japanese mackerel and mackerel mackerel. is there. However, there is no description of the cross-reactivity of the PCR primer with respect to other organisms, that is, detection specificity, and further description that mackerel DNA can be specifically detected in a sample containing a plurality of animals and plants such as food and Also, there is no description that mackerel mackerel (massaba and sesame mackerel) can be specifically detected. In addition, there are few databases regarding the base sequence of the intervening sequence between the 18S rRNA gene and the 5.8S rRNA gene, and verification of whether or not organisms other than mackerel are detected is insufficient. Therefore, the method for specifically detecting mackerel (massaba and sesame mackerel) DNA in foods containing a plurality of animals and plants is not a well-validated method.
The base sequences of the above-described PCR primers for detecting the genus Macada are as follows.
SABA-S: CCGGGTACCCAACTCTCC (SEQ ID NO: 23)
SABA-AS: CACCGCTAAGAGTTGTCACAGT (SEQ ID NO: 24)
This is expected to detect Siniperca chuatsi as well as mackerel (genus).

The presence or absence of contamination in a food material or product of a specific target animal can be examined by examining whether a gene sequence specific for the animal is detected in the food material or product. However, although the test method can detect DNA derived from the target animal, it is strongly desired that the test method does not detect a plurality of non-target animals and plants-derived DNA constituting food ingredients and products.

  As described above, abalone, squid, shrimp, crab, salmon, mackerel, how much, gelatin, orange, kiwifruit, walnut, soybean, matsutake, peach, yam, apple, and banana No clear detection method has been reported, and a method capable of scientifically verifying whether or not these specific animals and plants are mixed in food ingredients and products is awaited as a quality control method for food.

Japanese Patent Application Laid-Open No. 2002-345498

Yang D. Y., A. Cannon, and S. R. Saunders; DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America; Journal of Archaeological Science, 31: 619-631, 2004 Bonnaud L., R. Boucher-Rodoni, and M. Monnerot; Phylogeny ofcephalopods inferred from mitochondrial DNA sequences; Molecular Phylogenetics and Evolution, 7: 44-54, 1997)

The present invention relates to a method capable of specifically detecting mackerel, salmon, abalone, squid, crab or / and shrimp among specific animals that may cause allergies, and a PCR used in this method. The main purpose is to provide primers, primer sets and kits.

In order to achieve the above-mentioned problems, the present inventors focused on the commonality and specificity in the gene sequences of animals and other organisms to be detected from the viewpoint of molecular biology. From among the "similar things", we studied earnestly a method that can detect mackerel, salmon, abalone, squid, or shrimp or / or crab (in the present invention, these are called "specific animals") with high sensitivity. . As a result, we found a base sequence characteristic of each of mackerel, salmon, abalone or squid, and a base sequence characteristic of a group consisting of shrimp and crab (hereinafter referred to as “shrimp / crab group”). By conducting nucleic acid analysis such as PCR using a base sequence, it was found that mackerel, salmon, abalone or squid, and shrimp / crab group could be easily detected, and further earnest study was repeated. It came to complete.
That is, the present invention relates to the following PCR primer set for detecting a specific animal, a method for detecting a specific animal, and a kit for detecting a specific animal.
Item 1. The PCR primer according to any one of (1) to (20) below.
(1) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 1 in the sequence listing
(2) PCR primer consisting of DNA of a maximum of 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 2 on the 3 ′ end side in the sequence listing
(3) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 7 to 21 in the sequence listing in the sequence listing on the 3 ′ end side
(4) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 12 to 26 in SEQ ID NO: 4 in the sequence listing on the 3 ′ end side
(5) PCR primer comprising a maximum of 30 bases of DNA comprising the base sequence of base numbers 11 to 25 in the sequence listing 5 in the sequence list on the 3 ′ end side. The base sequence of base numbers 12 to 26 in the sequence number 6 of the sequence listing. PCR primer consisting of DNA with a maximum of 30 bases
(7) PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 7 in the sequence listing
(8) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 at the 3 ′ end in SEQ ID NO: 8 in the sequence listing
(9) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in the sequence listing, SEQ ID NO: 9 on the 3 ′ end side
(10) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 10 of the sequence listing
(11) PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing
(12) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side of the sequence listing
(13) PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side of the sequence listing
(14) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3 ′ end side
(15) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side of the sequence listing
(16) PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side in the sequence listing
(17) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side
(18) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 ′ end side
(19) PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side
(20) A PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of nucleotide numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 1 in the sequence listing.
Item 3. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 2 in the sequence listing on the 3 ′ end side.
Item 4. A PCR primer comprising DNA of a maximum of 30 bases comprising the base sequence of base numbers 7 to 21 in the sequence listing in the sequence listing on the 3 ′ end side.
Item 5. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 12 to 26 in SEQ ID NO: 4 in the sequence listing on the 3 ′ end side.
Item 6. A PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 5 on the 3 ′ end side in the sequence listing.
Item 7. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 12 to 26 in SEQ ID NO: 6 in the sequence listing on the 3 ′ end side.
Item 8. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 7 on the 3 ′ end side in the sequence listing.
Item 9. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in the sequence listing in SEQ ID NO: 8 on the 3 ′ end side.
Item 10. A PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 9 in the sequence listing on the 3 ′ end side.
Item 11. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 10 in the sequence listing on the 3 ′ end side.

Item 12. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side of the sequence listing.
Item 13. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side of the sequence listing.
Item 14. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side.
Item 15. A PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side of the sequence listing.
Item 16. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side.
Item 17. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side of the sequence listing.
Item 18. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side.
Item 19. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.
Item 20. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side.
Item 21. A PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side.
Item 22. The primer set according to any of (21) to (30) below.
(21) A primer set comprising the primer according to item 2 and the primer according to item 3
(22) A primer set comprising the primer according to item 4 and the primer according to item 5
(23) A primer set comprising the primer according to item 6 and the primer according to item 7
(24) Primer set comprising the primer according to item 8 and the primer according to item 9
(25) A primer set comprising the primer according to item 10 and the primer according to item 11
(26) A primer set comprising the primer according to item 12 and the primer according to item 13
(27) A primer set comprising the primer according to item 14 and the primer according to item 15
(28) A primer set comprising the primer according to item 16 and the primer according to item 17
(29) A primer set comprising the primer according to item 18 and the primer according to item 19
(30) A primer set comprising the primer according to item 20 and the primer according to item 21. A primer set comprising the primer according to Item 2 and the primer according to Item 3.
Item 24. A primer set comprising the primer according to Item 4 and the primer according to Item 5.
Item 25. A primer set comprising the primer according to Item 6 and the primer according to Item 7.
Item 26. A primer set comprising the primer according to Item 8 and the primer according to Item 9.
Item 27. A primer set comprising the primer according to Item 10 and the primer according to Item 11.
Item 28. A primer set comprising the primer according to Item 12 and the primer according to Item 13.
Item 29. A primer set comprising the primer according to Item 14 and the primer according to Item 15.
Item 30. A primer set comprising the primer according to Item 16 and the primer according to Item 17.
Item 31. A primer set comprising the primer according to Item 18 and the primer according to Item 19.
Item 32. A primer set comprising the primer according to Item 20 and the primer according to Item 21.
Item 33. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to any one of Items 23 to 32 using the DNA as a template, and a specific animal in the sample by detecting the amplified DNA And a step of detecting whether or not a specific animal is present.
Item 34. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 23 or 28 using this DNA as a template, and whether or not mackerel is present in the sample by detecting the amplified DNA And a method for detecting a specific animal.
Item 35. A step of extracting DNA from the sample, a step of performing PCR using the primer set according to Item 24 or 29 using this DNA as a template, and whether or not salmon is present in the sample by detecting the amplified DNA And a method for detecting a specific animal.
Item 36. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 25 or 30 using this DNA as a template, and whether abalone is present in the sample by detecting the amplified DNA And a method for detecting a specific animal.
Item 37. A step of extracting DNA from the sample, a step of performing PCR using the primer set of Item 26 or 31 using the DNA as a template, and whether squid is present in the sample by detecting the amplified DNA And a method for detecting a specific animal.
Item 38. The step of extracting DNA from the sample, the step of performing PCR using the primer set of Item 27 or 32 using this DNA as a template, and the presence of shrimp or / and crabs in the sample by detecting the amplified DNA A method for detecting a specific animal, comprising: detecting whether or not

According to the present invention, DNA of a specific animal (mackerel, salmon, abalone, squid, shrimp, crab) having high accuracy and detection sensitivity can be detected by nucleic acid analysis using PCR or the like. There is an effect that it is possible to perform a quality control inspection such as whether or not the specific animal is mixed in the test food or whether it is used.
In the present invention, when a positive reaction occurs in the test method using a PCR primer for detecting shrimp and crab group, it indicates the presence of shrimp or crab, or both. At this time, the base sequence of the PCR amplification product By analyzing the above, it is possible to qualitatively predict the existence ratio of both.

It is a figure which shows the detection sensitivity of DNA in PCR using the primer of this invention. It is a figure which shows the result of having detected the specific animal in foodstuffs using the primer of this invention.

PCR primer set for detection of specific animals The PCR primer set for detection of specific animals of the present invention has a base sequence characteristic of mackerel, a base sequence characteristic of salmon, or a characteristic of abalone Some have a unique base sequence, some have a base sequence characteristic of squid, and some have a base sequence characteristic for a group consisting of shrimp and crab.
The PCR primer set for detecting mackerel and the PCR primer set for detecting salmon obtain mitochondrial cytochrome b gene sequences of various organisms from a known DNA database (GenBank nucleotide sequence database) By analyzing and preparing a multiple parallel sequence diagram of those enormous base sequences, by selecting and comparing in detail, the gene sequence region specific to each of mackerel and salmon is selected, and from that region Newly designed. At the time of design, the gene sequence region of the species of interest to be detected hybridizes under stringent conditions, but the design is devised so that it does not hybridize to the species not targeted for detection. did.
Abalone detection PCR primer set, squid detection PCR primer set and shrimp and crab group detection PCR primer set can be obtained from known DNA database of mitochondrial 16S rRNA gene of various organisms, or the relevant genes of some organisms The gene sequence specific to each of abalone, squid, shrimp and crab is obtained by independently analyzing the sequence, creating a multiple parallel sequence diagram of those enormous base sequences, and comparing in detail An area was selected and newly designed from that area. At the time of design, the gene sequence region of the species of interest to be detected hybridizes under stringent conditions, but the design is devised so that it does not hybridize to the species not targeted for detection. did.
In the PCR analysis using the PCR primer set for detecting a specific animal according to the present invention, the target sample may be a processed product. When analyzing a processed product, since the DNA may be degraded or fragmented, a PCR primer that forms a PCR amplification product having a short length of about 100 to 500 bp is preferable for high-sensitivity analysis. Therefore, when designing the PCR primer, the PCR amplification product was designed with an ingenuity so that the length of the PCR amplification product was 500 bp or less. Moreover, making the PCR primer set reaction solution under the same conditions can reduce the complexity of operation in actual analysis. Therefore, the PCR primer was designed by creatively designing the PCR reaction solution composition so that the magnesium concentration that has the greatest influence on the PCR reactivity was the same, specifically 2.5 mM Mg ²⁺ . Furthermore, when designing each PCR primer set, avoid the formation of so-called primer dimers as much as possible so as not to cause hybridization between the sense primer and the antisense primer or hybridization by the individual primers themselves. Invented.
Therefore, DNA derived from mackerel, salmon, abalone, squid, and shrimp and crab groups contained in various foods using a nucleic acid analysis technique such as PCR using the PCR primer set for detecting a specific animal of the present invention Can be detected with high sensitivity and specificity.
Here, nucleic acid analysis refers to the presence or absence of a characteristic base sequence by analyzing the presence of a characteristic base sequence for each species, genus, or group in the biological classification, It is an effective means for grasping the species, genus, or group of the organism, and is a method usefully used for detecting a specific microorganism or identifying a species.
The base sequences of the first to tenth primers provided by the present invention are as follows.
Sequence number 1 (mackerel S): CTGATGTTGAGTCAGCATTCGA (22 mer)
Sequence number 2 (mackerel AS): GAATAGCAGGTGAAGAATTGTTGC (24 mer)
Sequence number 3 (salmon S): AACAGCTTTTTCCTCTGTnTG (21 mer)
(In SEQ ID NO: 3, n represents C or T.)
However, C and T of SEQ ID NO: 3 are used as mixed primers. The same applies hereinafter.
SEQ ID NO: 4 (salmon AS): AGCCTACGAATGCAGTTATTATAGTG (26 mer)
Sequence number 5 (Abalone S): CTTCTAAGTGAAAAGGCTTAGATTT (25 mer)
Sequence number 6 (Abalone AS): CACTTGTTAGTAAACCAAAATTCTAC (26 mer)
Sequence number 7 (squid S): GAATGAATGGTTTGACGAAGG (21 mer)
Sequence number 8 (squid AS): GCTTCTGCACCCTAAGGTTAC (21 mer)
Sequence number 9 (shrimp crab S): GGACGATAAGACCCTATAA (19 mer)
Sequence number 10 (shrimp crab AS): ATAACGCTGTTATCCCTAAA (20 mer)
Moreover, as a primer which consists of DNA of 30 bases of this invention, the following primers can be mentioned, for example.
Sequence number 25 (mackerel S): ctacacccCTGATGTTGAGTCAGCATTCGA
Sequence number 26 (mackerel AS): atgtagGAATAGCAGGTGAAGAATTGTTGC
Sequence number 27 (salmon S): cgacatttcAACAGCTTTTTCCTCTGTnTG
(In SEQ ID NO: 27, n represents C or T.)
However, in SEQ ID NO: 27, C and T are used as mix primers. The same applies hereinafter.
Sequence number 28 (salmon AS): acgtAGCCTACGAATGCAGTTATTATAGTG
Sequence number 29 (Abalone S): attaaCTTCTAAGTGAAAAGGCTTAGATTT
Sequence number 30 (Abalone AS)
: ggatCACTTGTTAGTAAACCAAAATTCTAC
SEQ ID NO: 31 (squid S):
ttgaggctaGAATGAATGGTTTGACGAAGG
Sequence number 32 (squid AS): nnnnntaaaGCTTCTGCACCCTAAGGTTAC
(In SEQ ID NO: 32, n represents any nucleotide.)
In SEQ ID NO: 32, the following SEQ ID NO: 33 can be exemplified as a specific example. This is designed based on the base sequence of squid.
SEQ ID NO: 33 (Squirrel AS)
cctattaaaGCTTCTGCACCCTAAGGTTAC
SEQ ID NO: 34 (Shrimp Crab S):
nnnnnnnnnnnGGACGATAAGACCCTATAA
(In SEQ ID NO: 34, n represents an arbitrary nucleotide.)
In SEQ ID NO: 34, the following SEQ ID NO: 36 can be exemplified as a specific example. This is designed based on the base sequence of black tiger shrimp.

SEQ ID NO: 35 (shrimp crab AS):
nnnnnnnnnnATAACGCTGTTATCCCTAAA
(In SEQ ID NO: 35, n represents any nucleotide.)
In SEQ ID NO: 35, the following SEQ ID NO: 37 can be exemplified as a specific example. This is designed based on the base sequence of black tiger shrimp.
SEQ ID NO: 36 (Black Tiger Shrimp S):
atactttaaggGGACGATAAGACCCTATAA
SEQ ID NO: 37 (Black Tiger Shrimp AS):
ctcaaagaagATAACGCTGTTATCCCTAAA
The present invention proposes, as a first primer, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 8 to 22 in SEQ ID NO: 1 in the sequence listing on the 3 ′ end side. . Next, as a second primer, a PCR primer for detecting mackerel consisting of a DNA of a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 2 in the sequence list on the 3 ′ end side is used as an antisense primer. suggest. The first and second primers can be suitably used for detecting mackerel.
These first and second primer sets are both subjected to PCR to specifically bind to mackerel mitochondrial cytochrome b gene, but detect mitochondrial cytochrome b gene from other organisms. Since it does not amplify as much as possible, it can be used as a primer set for PCR to detect mackerel DNA. Moreover, the DNA can be detected with high sensitivity by using the first primer and the second primer as a set.

In addition, the present invention proposes, as a sense primer, a primer composed of DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side as the third primer. . Furthermore, as a fourth primer, a primer composed of DNA with a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 12 to 26 in SEQ ID NO: 4 in the sequence listing on the 3 ′ end side is proposed as an antisense primer. The third and fourth primers can be suitably used for salmon detection.
These third primer and fourth primer sets are both subjected to PCR to specifically bind to the salmon mitochondrial cytochrome b gene. Since it does not detectably amplify, it can be used as a primer for PCR to detect salmon DNA. Moreover, the DNA can be detected with high sensitivity by setting the third primer and the fourth primer as a set.
The third primer includes both those in which base number 19 of SEQ ID NO: 3 is C and T. In detecting salmon, salmon (genus Salmon, Salmo) can be specifically detected by using both of them as a mix primer as a sense primer.
In addition, the 30-primer primer that is a preferred embodiment of the third primer includes both those in which base number 28 of SEQ ID NO: 27 is C and T. In detecting salmon, salmon (genus Salmon, Salmo) can be specifically detected by using both of them as a mix primer as a sense primer.

In addition, the present invention proposes, as a sense primer, as a fifth primer, a primer comprising a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 11 to 25 in SEQ ID NO: 5 in the sequence listing on the 3 ′ end side. . Furthermore, as a sixth primer, a primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 12 to 26 in SEQ ID NO: 6 in the sequence listing on the 3 ′ end side is proposed as an antisense primer. The fifth and sixth primers can be suitably used for abalone detection.
These 5th primer set and 6th primer set are both subjected to PCR to specifically bind to the abalone mitochondrial 16S rRNA gene, but detect other mitochondrial 16S rRNA genes. Since it does not amplify as much as possible, it can be used as a primer for PCR to detect abalone DNA. In addition, by setting the fifth primer and the sixth primer as a set, the DNA can be detected with high sensitivity.

In addition, the present invention proposes, as a seventh primer, a primer composed of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side. . Furthermore, as an eighth primer, a primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side is proposed as an antisense primer. The seventh and eighth primers can be suitably used for squid detection.
These 7th and 8th primer sets are both subjected to PCR to specifically bind to the squid mitochondrial 16S rRNA gene, but detect other mitochondrial 16S rRNA genes. Since it does not amplify as much as possible, it can be used as a primer for PCR to detect squid DNA. In addition, by using the seventh primer and the eighth primer as a set, the DNA can be detected with high sensitivity.

Further, the present invention uses, as a sense primer, a detection primer consisting of a DNA having a minimum of 15 and a maximum of 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 9 in the sequence listing on the 3 ′ end side as the ninth primer. suggest. Furthermore, as a tenth primer, a detection primer consisting of a DNA with a minimum of 15 and a maximum of 30 bases including the base sequence of base numbers 6 to 20 in SEQ ID NO: 10 in the sequence listing on the 3 ′ end side is proposed as an antisense primer. The ninth and tenth primers can be suitably used for shrimp and crab group detection.
These 9th and 10th primer sets, when subjected to PCR, both bind specifically to the shrimp crab group mitochondrial 16S rRNA gene, but from other organism-derived mitochondrial 16S rRNA genes Since the gene is not detectably amplified, it can be used as a primer for PCR to detect shrimp and crab groups. In addition, by setting the ninth primer and the tenth primer as a set, the DNA can be detected with higher sensitivity.

  In each primer, the length of the base sequence is 15 to 30 because the appropriate length of the base sequence as a primer for PCR is about 15 to 30, and 15 bases on the 3 ′ end side. In order to specify the sequence, about 15 3'-ends are important for PCR-specific amplification reactions, and the 5'-end base sequence is slightly different or the sequence length is slightly different. Even so, the adverse effect on the PCR reaction itself is usually small.

In the present invention, furthermore, as a preferred embodiment of the first primer, a PCR primer (1 ′) (most preferably a sequence comprising a DNA of a maximum of 30 bases containing the nucleotide sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side) As a preferred embodiment of the second primer, a PCR primer (2 ') comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side as a preferred embodiment of the second primer (Most preferably, a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 2) is proposed. These primers can be suitably used for mackerel detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 are used as a set.
In addition, as a preferred embodiment of the third primer, a primer (3 ′) consisting of a DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 3) As a preferred embodiment of the fourth primer, which is a primer composed of DNA, a primer (4 ′) composed of DNA having a maximum of 30 bases containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side (most preferably SEQ ID NO: 4). A primer composed of DNA having the nucleotide sequence of These primers can be suitably used for salmon detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 are used as a set.
Further, as a preferred embodiment of the fifth primer, a primer (5 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 5) Primer consisting of DNA), as a preferred embodiment of the sixth primer, primer (6 ′) consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side of the sequence listing (most preferably SEQ ID NO: 6 A primer composed of DNA having the nucleotide sequence of These primers can be suitably used for abalone detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 are used as a set.
Further, as a preferred embodiment of the seventh primer, a primer (7 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 7) As a preferred embodiment of the eighth primer, a primer (8 ') consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 8 on the 3' end side (most preferably SEQ ID NO: 8). A primer composed of DNA having the nucleotide sequence of These primers can be suitably used for squid detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 are used as a set.
Further, as a preferred embodiment of the ninth primer, a primer (9 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side (most preferably the base sequence of SEQ ID NO: 9 Primer consisting of DNA), as a preferred embodiment of the tenth primer, primer (10 ′) consisting of DNA of up to 30 bases comprising the base sequence of SEQ ID NO: 10 on the 3 ′ end side of the sequence listing (most preferably SEQ ID NO: 10 A primer composed of DNA having the nucleotide sequence of These primers can be suitably used for shrimp and crab group detection. Each of the primers is also preferably used as a primer set, and most preferably the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 are used as a set.
Specific animal detection method The specific animal detection method of the present invention comprises a step of extracting DNA from a sample, a step of performing PCR using the primer set of the present invention using this DNA as a template, and amplified DNA. Detecting whether or not mackerel, salmon, abalone, squid, or shrimp or / and crabs (shrimp and crab group) are present in the sample.
That is, by using the PCR primer set for detecting a specific animal according to the present invention, the DNA in the sample is subjected to nucleic acid analysis by PCR or the like, so that the specific animal in the sample can be specifically detected. At this time, when detecting mackerel, use the PCR primer set for detecting mackerel. Similarly, when detecting salmon, abalone, squid, shrimp and crab groups, PCR primer set for detecting salmon and abalone detection, respectively. PCR primer set, squid detection PCR primer set, shrimp and crab group detection PCR primer set may be used. In addition, when a positive reaction occurs in the test using the PCR primer set for detecting shrimp and crab group of the present invention, it indicates the presence of shrimp or crab, or both. By analyzing the sequence, it is also possible to predict the abundance ratio of both qualitatively.

The type of detection method (nucleic acid analysis) is not particularly limited, and a known method can be used as appropriate. For example, a method of PCR amplification using PCR primers, a method of detecting a PCR amplification product with a probe, and the like can be exemplified.
As a method of PCR amplification using PCR primers, the target nucleotide sequence in DNA in a sample is selectively amplified using the above-mentioned primer set for detecting a specific animal according to the present invention selected according to the detection purpose, and PCR amplification is performed. The method of measuring the presence or absence of a product is mentioned. Confirmation of the presence or absence of a PCR amplification product can usually be performed by separating the PCR amplification product by agarose gel electrophoresis and staining with nucleic acid such as ethidium bromide or cyber green I. When PCR is performed using a real-time PCR apparatus, the presence or absence of a PCR amplification product can be automatically confirmed by the detection system of the apparatus. For example, when Cyber Green I is added to the PCR reaction solution, the amount of PCR amplification product depending on the amount of fluorescence emitted when Cyber Green I binds to double-stranded DNA can be monitored for each cycle. Furthermore, it is possible to confirm whether or not the PCR amplification product is the target amplification product by performing a melting curve analysis of the PCR amplification product after the PCR and deriving a melting temperature (Tm) value of the PCR amplification product from the analysis. Depending on the situation, it may be difficult to make a determination based on the Tm value. In such a case, the presence and size of the amplification product may be confirmed by the agarose gel electrophoresis described above.
Specifically, the Tm value of the PCR amplification product using the primer shown in SEQ ID NO: 1 and the primer shown in SEQ ID NO: 2 is about 89.6 ° C., and the size of the PCR amplification product is about 428 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that mackerel was present in the test sample.
The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 3 and the primer set forth in SEQ ID NO: 4 is about 86.7 ° C, and the size of the PCR amplification product is about 212 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that salmon was present in the test sample.
The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 5 and the primer set forth in SEQ ID NO: 6 is about 83.9 ° C., and the size of the PCR amplification product is about 189 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that abalone was present in the test sample.
The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 7 and the primer set forth in SEQ ID NO: 8 is about 81.8 ° C., and the size of the PCR amplification product is about 359 bp. When the Tm value is obtained in the melting curve analysis, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that squid was present in the test sample.
The Tm value of the PCR amplification product using the primer set forth in SEQ ID NO: 9 and the primer set forth in SEQ ID NO: 10 is about 77 to 79 ° C., and the size of the PCR amplification product is about 211 bp. In the melting curve analysis, when the Tm value is obtained, or when an amplification product of the size is detected by agarose electrophoresis, it indicates that shrimp or crab was present in the test sample.

  As a method for detecting a PCR amplification product with a probe, as represented by the Taq Man method, a fluorescent substance-labeled probe that hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe is used for PCR. There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is decomposed after hybridization with an amplification product with a real-time PCR apparatus. Examples of other methods for detecting a PCR amplification product with a probe include a Molecular Beacon method, a Cycleave PCR method, and a method using a hybrid probe. The PCR primer used in these methods may be any of the PCR primer sets for detecting specific animals, and is common to the target species from the internal base sequence of the PCR amplification product amplified by each PCR primer set. A simple base sequence region may be separately selected and a probe based on that region may be used.

In the method for detecting a specific animal of the present invention, the type of the test sample as a target is not particularly limited.
For example, examples of the test sample include food raw materials and foods. Specifically, the food raw material includes a food raw material that does not intentionally contain a specific animal that is separately produced in a food raw material production plant that handles the specific animal. Examples of the food include sprinkles, powder soup, liquid soup, hot air dried or freeze dried meat ingredients, fish ingredients, confectionery, and various cooked foods containing these processed products. Moreover, the foodstuff factory which handles the specific animal WHEREIN: The foodstuff which does not contain the specific animal produced separately is mentioned. In addition, after manufacturing a processed product containing a specific animal, when manufacturing a processed product that does not include the specific animal, it is essential to carefully clean the processing and manufacturing equipment with the removal of the specific animal residue in mind. In order to confirm the effectiveness of this cleaning method and the presence or absence of specific animal residues in the production facility, a wipe sample from the production facility is also included as a test sample.

In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (Notice of the Director of Food Health Department, Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, for the inspection method of foods containing allergens, November 6, 2002, 1106001) and various commercially available DNA extraction kits [eg Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Biosciences Corp., USA), DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany, etc.)] can be applied to the above detection method as long as the sample can recover DNA. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from a sample by the above-described DNA extraction method.
Specific animal detection kit The present invention also relates to a specific animal detection kit. The configuration of the kit is not particularly limited as long as it comprises at least one PCR primer set for detecting a specific animal of the present invention.
Specifically, a primer composed of a DNA having a maximum of 30 bases including the base sequence of base numbers 8 to 22 in SEQ ID NO: 1 on the 3 ′ end side and the base sequence of base numbers 10 to 24 in SEQ ID NO: 2 to the 3 ′ end Set with a primer composed of DNA of up to 30 bases included on the side; Primer composed of DNA of maximum 30 bases including the base sequence of base numbers 7 to 21 in SEQ ID NO: 3 on the 3 ′ end side and the base sequence of SEQ ID NO: 4 A primer consisting of a maximum of 30 bases of DNA containing 3 'end side; a primer consisting of a maximum of 30 bases of DNA containing base sequences 11-25 in SEQ ID NO: 5 on the 3' end side, and SEQ ID NO: Set with a primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 12 to 26 on the 3 ′ end side in 6; Up to 30 containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 7 on the 3 ′ end side A primer composed of a base DNA and the base in SEQ ID NO: 8 Set with a primer consisting of DNA of up to 30 bases containing the nucleotide sequence of No. 7-21 on the 3 ′ end side; and from DNA of up to 30 bases containing the 5-19 base sequence in SEQ ID NO: 9 on the 3 ′ end side And a specific animal detection kit comprising at least one set of a primer consisting of DNA consisting of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 10 on the 3 ′ end side.
And, as a preferable one, a primer consisting of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 ′ end side and a primer consisting of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side A primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 3 on the 3 ′ end side and a primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side A set comprising a primer consisting of a maximum of 30 bases DNA containing the base sequence of SEQ ID NO: 5 on the 3 ′ end side and a primer consisting of a DNA consisting of a maximum of 30 bases including the base sequence of SEQ ID NO: 6 on the 3 ′ end side; A set of a primer comprising a maximum of 30 bases DNA comprising the nucleotide sequence of SEQ ID NO: 7 on the 3 ′ end side and a primer comprising a DNA comprising a maximum of 30 bases comprising the base sequence of SEQ ID NO: 8 on the 3 ′ end side; and a sequence DNA with a maximum of 30 bases containing the base sequence of number 9 on the 3 'end side And Ranaru primers include specific animal detection kit comprising a set one or more sets of the primers of up to 30 bases of a DNA comprising the nucleotide sequence of SEQ ID NO: 10 in the 3 'end.
Among these, as a particularly preferred one, a set of a primer consisting of the base sequence of SEQ ID NO: 1 and a primer consisting of the base sequence of SEQ ID NO: 2; a primer consisting of the base sequence of SEQ ID NO: 3 and a primer consisting of the base sequence of SEQ ID NO: 4 Set; a set of a primer consisting of the base sequence of SEQ ID NO: 5 and a primer consisting of the base sequence of SEQ ID NO: 6; a set of a primer consisting of the base sequence of SEQ ID NO: 7 and a primer consisting of the base sequence of SEQ ID NO: 8; Specific animal detection kits containing at least one set of a primer consisting of the base sequence of No. 9 and a primer consisting of the base sequence of SEQ ID NO: 10 can be mentioned.
Moreover, the specific animal detection kit etc. which contain each said primer set and the probe for detecting the PCR amplification product amplified with each said primer set, etc. are mentioned.
The kit can contain appropriate reagents and various containers according to the purpose of use. Specifically, polymerization reagents for synthesizing PCR primer extension products, such as heat-resistant DNA polymerase, deoxyribonucleotides, magnesium, and buffers for PCR reactions, and storage that can maintain their quality appropriately Containers and the like can be included.
Examples Hereinafter, the present invention will be described in more detail with reference to Examples or Test Examples, but the present invention should not be construed as being limited to these Examples. The present invention can be changed as appropriate without departing from the gist of the present invention.
Example 1
Confirmation of detection specificity of PCR primer set for specific animals against various animal, plant, fungus and bacteria-derived DNA In order to confirm the effectiveness of PCR analysis method using PCR primer set for specific animals of the present invention, An experiment to examine the detection specificity of PCR for the derived DNA was performed as follows.

Purified DNA of humans, cows, pigs, chickens, Xenopus laevis, Atlantic cod and sturgeon were purchased from CeMines, LLC, USA.
Purified DNA from wheat, corn, and soybean was purchased from BioChain Institute, Inc., USA.
Chub mackerel, sesame mackerel, Atlantic mackerel, yellowfin tuna, skipjack, yellowtail, sockeye salmon (salmon salmon), coho salmon, calaft trout, steelhead (rainbow trout), squid, mongo squid, squid, scallop, scallop, sazae, ezo abalone, maize Shrimp, red crab, black tiger shrimp, shrimp shrimp, shrimp shrimp (white shrimp) and white shrimp purified DNA were frozen by freezing the (muscle) meat portion of each sample purchased from the store, and then using a multi-bead shocker (Yasui Kikai, Osaka) What was prepared from the crushed sample using Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Biosciences Corp., USA) or DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan) was used.
Purified DNA of krill (unidentified species) is obtained from Nucleon PhytoPure from samples that were purchased from a commercial store and washed with TBS buffer (150 mM NaCl, 10 mM Tris-HCl [pH 7.5]) and then crushed with a multi-bead shocker. , plant and fungal DNA extraction kits were used.
Purified black cockroach DNA is prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits) from a sample that has been washed with 70% ethanol and then crushed with a multi-bead shocker after washing with TBS buffer. We used what we did.
Rice (leaves) was obtained from growers and leek was purchased from a store. These purified DNAs were prepared using Nucleon PhytoPure, plant and fungal DNA extraction kits from samples washed with 70% ethanol, washed with TBS buffer, and crushed with a multi-bead shocker. did.
The buckwheat purified DNA used was prepared from Nucleon PhytoPure, plant and fungal DNA extraction kits from a sample obtained by grinding buckwheat flour purchased from a store with a multi-bead shocker.
Aspergillus oryzae IFO 4206, Saccharomyces cerevisiae IFO 0282, Escherichia coli JCM 1649 ^T
In addition, purified DNA of Bacillus cereus ATCC 14579 ^T is obtained by culturing each strain in an appropriate medium, and then purifying the Puregene Yeast and Gram-Positive DNA Isolation kit (Gentra Systems Inc., USA) What was prepared using was used.
Purified DNA of Tricholoma magnivelare, Shiitake, Hatake Shimeji, Enokitake, Maitake, Nameko, Eringi, and Abalonetake is obtained by freezing small pieces of samples purchased from a store and then crushed with a multi-bead shocker from a sample of Nucleon PhytoPure. , plantand fungal DNA extraction kits were used.
All purified DNAs have been subjected to RNA removal by RNase.

The PCR primers described in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 were synthesized by Operon Biotechnologies GmbH, Germany, as follows. Used in PCR.
After measuring the amount of various animal, plant, fungus and bacterial DNA prepared as described above, using sterile water, the concentration of animal, plant and fungal DNA was 1 ng / μL, and the concentration of bacterial DNA was 50 pg / pg. Prepared to μL. A 20 μL reaction solution containing the prepared 1 μL DNA sample solution was prepared using an R-PCR version of Takara Bio's Ex Taq kit (Takara Bio Inc., Japan). This kit contains 10 R-PCR buffer (Mg ²⁺ free), 250 mM MgCl ₂ solution, 10 mM dNTP mixture, and 5 unit / μL Taq DNA polymerase (hot start type). The reaction solution was based on R-PCR buffer, 2.5 mM MgCl ₂ , 0.005% SYBR Green I (FMC Bioproducts, Rockland, Maine, USA), 250 nM sense primer, 250 nM antisense primer, 200 μM dNTP mixture (each 200 μM dATP, dTTP, dCTP, and dGTP) and 0.05 unit / μL Taq DNA polymerase. The PCR reaction was performed with LightCycler (Roche Diagnostics GmbH, Mannheim, Germany), and the amplification reaction conditions were as follows.
After one cycle of 95 ° C for 1 minute, heat up to 95 ° C at a rate of 20 ° C / second, hold at that temperature for 5 seconds, then drop to T ° C at a rate of 20 ° C / second, The temperature was maintained at the same temperature for 2 seconds, further increased to 72 ° C. at a rate of 10 ° C./second, and then subjected to 35 amplification cycles consisting of 3 steps of maintaining at the same temperature for 20 seconds. T was 64 for the mackerel detection PCR primer, 60 for the crab / shrimp group detection PCR primer, and 62 for the salmon, abalone and squid detection PCR primers. The PCR amplification product was recorded as the SYBR Green I-dependent fluorescence amount at the final step of each cycle. At the end of the amplification cycle, the melting curve was raised to 95 ° C at a rate of 20 ° C / s, then dropped to 60 ° C at a rate of 20 ° C / s, kept at the same temperature for 10 seconds, and then 0.2 ° C It was obtained by recording the fluorescence intensity every 0.2 seconds during a slow temperature increase to 97 ° C. at a rate of / sec. The Tm value of the PCR amplification product obtained from the melting curve by the PCR device software was used to estimate the presence or absence of a specific amplification product by PCR. In addition, the PCR amplification product (2 μL of the reaction solution) is separated by 1.8% (wt / vol) agarose gel electrophoresis, the separated gel is stained with ethidium bromide, and the amplification product is visualized under UV irradiation. Thus, the presence or absence of the amplification product was confirmed. ΦX174 HaeIII digest DNA (Takara) was used as a molecular weight marker. The results of these PCRs are listed in Table 1. + (Plus) in the table indicates that an amplification product of the target size was detected by electrophoresis, and-(minus) indicates that the amplification product was not detected.

When using mackerel detection PCR primers (PCR primer set consisting of SEQ ID NOS: 1 and 2), amplification products of around 428 bp were confirmed only when using mackerel DNA and sesame DNA (Table 1). The Tm value of was about 89.6 ° C. When other species including other fish were used, amplification products were not observed (Table 1). In addition, Atlantic mackerel is “same as specified raw materials” (enforcement of ministerial ordinances, etc. that amend some of the ministerial ordinances regarding the notification of food health department manager, Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, the Food Sanitation Law Enforcement Regulations, and the component standards of milk and dairy products) The PCR primers that were not included in the mackerel specified in March 79, 2001, Eiseki No. 79), and were designed intentionally not to detect Atlantic mackerel DNA, It was confirmed that DNA was not detected (Table 1).
It should be noted that PCR using the PCR primer is based on the relationship between multiple parallel sequence diagrams of mitochondrial cytochrome b gene sequences of known and uniquely analyzed organisms and PCR primer sequences. Can detect DNA, but is a related species of the common mackerel genus Atlantic mackerel DNA, the same family tuna genus tuna (bluefin tuna) DNA, yellowfin tuna DNA, bigeye tuna DNA, bonito bonito bonito DNA, the same family It does not detect Sagaberorus tritor DNA and other species of DNA including other fish species. It is strongly suggested.

The salmon detection PCR primers (PCR primer set consisting of SEQ ID NOs: 3 and 4) are 212 bp only when using sockeye salmon DNA, salmon (salmon salmon) DNA, coho salmon DNA, calaf trout DNA, and steelhead (rainbow trout) DNA. Before and after amplification products were confirmed (Table 1), and the Tm value of these amplification products was about 86.7 ° C. No amplification products were seen when using other species DNA including other fish (Table 1). In addition, PCR using the PCR primer is based on the relationship between multiple parallel sequence diagrams of mitochondrial cytochrome b gene sequences of various known organisms and independently analyzed, and PCR primer sequences. Can detect (salmon salmon) DNA, coho salmon DNA, calaft trout DNA, steelhead (rainbow trout) DNA, trout salmon DNA, cherry salmon (yamame) DNA, salmon trout (amago) DNA, salmonid salmo brown trout DNA and Atlantic salmon DNA However, it is strongly suggested not to detect charcoal DNA of the salmonaceae Ivana, Ito DNA of Salmonaceae, and other species DNA including other fish, which are closely related species. Note that “salmon” included in “same as specified raw materials” as notified by the Ministry of Health, Labor and Welfare is a fish of the genus Salmon and Salmo, and does not include the genus Ivana or Ito.
In addition, when the abalone detection PCR primer (PCR primer set consisting of SEQ ID NOs: 5 and 6) was used, an amplification product of about 189 bp was confirmed only when using the abalone DNA (Table 1). The Tm value was about 83.9 ° C. When other species including other molluscs were used, no amplification products were observed (Table 1). In addition, Tokobushi is "applicable to specified raw materials" (Regarding the enforcement of ministerial ordinances, etc. that amend some of the ministerial ordinances regarding the notification of the Food Health Department Director of the Ministry of Health, Labor and Welfare, Ministry of Health, Labor and Welfare, the Food Sanitation Law Enforcement Regulations, and the ingredient standards of milk and dairy products. The PCR primer that was not included in the abalone specified in March 15, 2001, Shokuhin No. 79) and was intentionally designed not to detect Tocobushi DNA should not detect Tocobushi DNA. confirmed.
From the relationship between the multiplex parallel sequence diagrams of 16S rRNA gene sequences of mitochondrial mitochondrial of known and uniquely analyzed organisms and the PCR primer sequences, PCR using the PCR primers is the Ezo abalone DNA of the genus Horiotis, Madaka abalone Can detect DNA, Mega-Abalone DNA, Akane Abalone DNA, White Avalon Mimigai DNA, Ganoderma Abalone DNA, Susumu Abalone DNA, It is strongly suggested not to detect other species DNA including it.

In addition, when squid detection PCR primers (PCR primer set consisting of SEQ ID NOs: 7 and 8) were used, amplification products of around 359 bp were confirmed only when squid DNA, mongo squid DNA, and squid DNA were used (Table 1). 1) The Tm value of these amplification products was about 81.8 ° C. When DNA from other species including octopuses and shellfish was used, amplification products were not observed (Table 1).
In addition, PCR using the PCR primer is based on the relationship between multiple parallel sequence diagrams of 16S rRNA gene sequences of mitochondria of known and uniquely analyzed mitochondrial and PCR primer sequences. Squid DNA belonging to the family (e.g., cuttlefish of the cuckoo family, crimson cuttlefish, mongo cuttlefish, european pearl cuttlefish, spider cuttlefish, fritaceae honhi squid, staghorn squid, cuttlefish, spider squid, spear squid Can detect squid, squid, squid, squid, squid, Argentine irex, squid, etc. but not other species DNA including octopus (Eight arm) and other mollusks Is strongly suggested.
In addition, when using PCR primers for detection of shrimp and crab group (PCR primer set consisting of SEQ ID NOs: 9 and 10), red crab DNA, king crab DNA, black tiger shrimp DNA, shrimp shrimp DNA, white shrimp DNA, white shrimp DNA Only when krill (unidentified species) DNA was used, amplification products of around 211 bp were confirmed (Table 1), and the Tm values of these amplification products were about 77-80 ° C. When DNA from other species including insects was used, amplification products were not observed (Table 1).
From the relationship between the multiplex parallel sequence diagrams of mitochondrial 16S rRNA gene sequences of known and uniquely analyzed mitochondrial 16S rRNA sequences and PCR primer sequences, PCR using the PCR primers is a shrimp (decapod) DNA ( Shrimps, crabs, hermit crabs), krill eyes DNA (krill), lobsters (amphipods) DNA (spot lobsters), snails (isopods) DNA (funamushi, damselfly), ) Can be detected, but closely related to Daphnia subclasses (daphnia, horseshoe shrimp, spinach shrimp), Agora subclasses (sea fireflies, barnacles) and insects, mosses, and other species Has been suggested.
Example 2
Confirmation of PCR detection sensitivity using the PCR primer set for specific animals In order to examine the detection sensitivity of PCR using the PCR primer set for specific animals used in Example 1, the following experiment was performed.
Each DNA of chub mackerel, sockeye salmon, Ezo abalone, black tiger shrimp and black tiger crab prepared in Example 1 was diluted with sterilized water, and 1 pg / μl, 10 pg / μl, 100 pg / μl, 1000 pg / μl A dilution series of DNA solutions was prepared, and 1 μL of these diluted test DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 1, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis.
As shown in FIG. 1, the detection sensitivity when using the PCR primer for detecting mackerel (PCR primer set consisting of SEQ ID NOs: 1 and 2) is 1 pg DNA / analysis, and the PCR primer for detecting salmon (SEQ ID NO: 3 The detection sensitivity is 1 pg DNA / analysis using the PCR primer set consisting of 4 and 4, and the detection sensitivity when using the PCR primer for abalone detection (the PCR primer set consisting of SEQ ID NOS: 5 and 6) is , 10 pg DNA / analysis, and detection sensitivity when PCR primer for squid detection (PCR primer set consisting of SEQ ID NO: 7 and 8) is 1 pg DNA / analysis, PCR for shrimp crab group detection The detection sensitivity when using primers (PCR primer sets of SEQ ID NOs: 9 and 10) was 10 pg DNA / analysis.
Example 3
Detection of DNA derived from a specific animal in food containing a specific animal by PCR using a PCR primer set for a specific animal PCR primer for a specific animal according to the present invention for a commercially available food containing mackerel, salmon, squid, shrimp or crab as a raw material PCR analysis using the set was performed as follows to examine the practicality of the present invention.

Commercial foods (Table 2) clearly containing mackerel, salmon, squid, shrimp or crab as raw materials were prepared, and 1 to 10 g was pulverized with a multi-bead shocker. Each DNA was extracted from 0.1-1 g of the mixed crushed material using Nucleon PhytoPure, plant and fungal DNA extraction kits. At the time of extraction, RNA was also removed by RNase. After measuring the amount of the extracted food sample DNA, the concentration of the food sample DNA was adjusted to 10 ng / μL using sterilized water.
In addition, since it was difficult to obtain commercial foods containing abalone as a raw material, as a substitute sample for abalone-containing foods, the concentration of Ezo-abalone DNA was 50 pg / μL in a slightly lighter crab (Higashimaru) (10 ng / μL). The one added in step 1 was used. 1 μL of these prepared DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1 using the PCR primer set for specific animals used in Example 1. After the PCR reaction, the Tm value of the PCR amplification product was determined as described in Example 2, and the presence or absence of the amplification product was further confirmed by agarose gel electrophoresis. The results of these PCRs are listed in Table 2. + (Plus) in the table indicates that the amplification product of the target size was detected by electrophoresis,-(minus) indicates that the amplification product was not detected, and ND indicates that the test was not performed. Indicates.

Moreover, the result regarding agarose electrophoresis of these PCR was shown in FIG. 2 (A, B, C, D, and E). Furthermore, the PCR amplification product amplified from the food sample DNA was directly sequenced from both directions using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), and the base sequence was then applied using the Applied Biosystems 310 Genetic Analyzer (Applied Biosystems). Was analyzed. Analyze the analyzed base sequence data with GenBank nucleotide sequence database (BLAST search) or the DNA database owned by the inventors, and assign the species of DNA derived from PCR amplification products based on the similarity of the base sequence. Identified.

  As a result, when using the PCR primer for detecting mackerel (PCR primer set consisting of SEQ ID NOS: 1 and 2), mackerel-containing foods such as shavings and bonito (Kang general's rice cake), scouring powder (Yamaki), sprinkle 30 ( Amplification products of around 428 bp were confirmed only in DNA derived from Niconico Nori) and small fish sprinkle (Omoriya) [Table 2, Fig. 2 (A)], and the Tm value of these amplification products was about 89.6 ° C. It was. When DNA from other food samples was used, amplification products were not observed [Table 2, Fig. 2 (A)]. In addition, as a result of nucleotide sequence analysis of PCR amplification products, PCR amplification amplified from chopped and chopped porridge (Osho no maki), scouring powder (Yamaki), sprinkle 30 (Nikonikonori), and small fish sprinkle (Omoriya) The base sequence of the product was consistent with the mitochondrial mitochondrial cytochrome b gene sequence. That is, PCR using the PCR primers does not detect mackerel-derived DNA or other DNA from mackerel-free food samples in multiple commercially available foods, but can specifically detect mackerel-derived DNA from mackerel-containing food samples. confirmed.

  In addition, when using salmon detection PCR primers (PCR primer set consisting of SEQ ID NOs: 3 and 4), only in salmon-containing food, small fish sprinkle (Omoriya) and salmon tea (Nagatani) DNA, An amplification product of about 212 bp was confirmed [Table 2, FIG. 2 (B)]), and the Tm value of these amplification products was about 86.3 ° C. When DNA from other food samples was used, amplification products were not observed [Table 2, Fig. 2 (B)]. As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from small fish sprinkle (Omoriya) and salmon tea (Nagatanien) are both mitochondria-derived cytochromes from salmon (white salmon). b matched the gene sequence. That is, PCR using the PCR primer does not detect salmon-derived DNA or other DNA from salmon-free food samples in multiple commercially available foods, but can specifically detect mackerel-derived DNA from salmon-containing food samples. confirmed.

  In addition, when abalone detection PCR primers (PCR primer set consisting of SEQ ID NOs: 5 and 6) are used, DNA derived from an alternative sample of abalone-containing food [50 pg Ezo Abalone DNA added] The amplification product of about 189 bp was confirmed only in Table 2 (Table 2, FIG. 2 (C)), and the Tm value of this amplification product was about 84.2 ° C. When DNA from other food samples was used, amplification products were not found [Table 2, Figure 2 (C)]. As a result of analysis of the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of the abalone-containing food was, of course, the same as the 16S rRNA gene sequence derived from mitochondria of Ezo abalone. That is, PCR using the PCR primer does not detect abalone-derived DNA or other DNA from abalone-free food samples in a plurality of commercially available foods, but does not detect a small amount of abalone-derived DNA added to abalone-free foods. It was confirmed that it could be detected specifically.

  In addition, when PCR primers for detecting squid (PCR primer set consisting of SEQ ID NOs: 7 and 8) were used, only 359 bp of DNA derived from cup noodles and seafood noodles (Nissin foods), which is a food containing squid An amplification product was confirmed [Table 2, Fig. 2 (D)], and the Tm value of this amplification product was about 82.9 ° C. No amplification product was seen when DNA from other food samples was used [Table 2, Figure 2 (D)]. In addition, as a result of nucleotide sequence analysis of PCR amplification products, the nucleotide sequence of PCR amplification products amplified from DNA derived from cup noodles and seafood noodles (Nisshin Foods) is the 16S rRNA gene derived from mitochondria from Todamodes sp. It showed the highest similarity with the sequence. That is, PCR using the PCR primer does not detect squid-derived DNA or other DNA from squid-free food samples in multiple commercial foods, but can specifically detect squid-derived DNA from squid-containing food samples. confirmed.

  Furthermore, when using PCR primers for detecting shrimp and crab groups (PCR primer set consisting of SEQ ID NOs: 9 and 10), food containing shrimp or crab, sprinkle 30 (niconico paste), small fish sprinkle ( Omoriya), a little about 211 bp amplification products were confirmed only in DNA derived from Kazue Usui (Higashimaru) and Kappa Ebisen (Calbee) [Table 2, Fig. 2 (E)], and the Tm values of these amplification products were , About 79-81 ° C. When DNA from other food samples was used, amplification products were not observed [Table 2, Figure 2 (E)].

  As a result of analysis of the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from sprinkle 30 (Nikoniko Nori) showed the highest similarity to the 16S rRNA gene sequence derived from mitochondria mitochondria. In the case of DNA derived from fish sprinkle (Omoriya), it shows the highest similarity to the sequence of 16S rRNA gene derived from mitochondria of the krill family. Matching with the gene sequence, Kappa Ebino (Calbee) -derived DNA showed the highest similarity to the 16S rRNA gene sequence derived from mitochondria from the shrimp family. That is, PCR using the PCR primer does not detect shrimp, crab-derived DNA or other DNA from shrimp and crab-free food samples in a plurality of commercially available foods, but shrimp or crab-containing food samples contain shrimp or crab. It was confirmed that the derived DNA could be specifically detected. Furthermore, it was also confirmed that by analyzing the base sequence of the detected PCR amplification product, it was possible to determine whether the amplification product was derived from shrimp or crab.

Claims (5)

(A) PCR primer consisting of DNA of up to 30 bases including the base sequence of SEQ ID NO: 7 on the 3 ′ end side in the sequence listing, and (B) maximum including the base sequence of SEQ ID NO: 8 of the sequence listing on the 3 ′ end side Primer set consisting of PCR primers consisting of 30 base DNA. (C) a PCR primer composed of a DNA having a maximum of 30 bases including the nucleotide sequence of SEQ ID NO: 9 on the 3 ′ end side in the sequence listing; and (D) a maximum including the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side. Primer set consisting of PCR primers consisting of 30 base DNA. Extracting DNA from a sample excluding humans ;
Using the DNA as a template and performing PCR using the primer set according to claim 1 or 2;
A method for detecting a specific animal, comprising detecting whether or not the specific animal is present in the sample by detecting the amplified DNA. A step of extracting DNA from a sample excluding humans, a step of performing PCR using the primer set according to claim 1 using this DNA as a template, and squid is present in the sample by detecting the amplified DNA. A method for detecting a specific animal, comprising the step of detecting whether or not there is. A step of extracting DNA from a sample excluding human, a step of performing PCR using the primer set according to claim 2 using this DNA as a template, and detecting shrimp and / or crab in the sample by detecting the amplified DNA And a step of detecting whether or not a specific animal is present.