JP2019122406A - Primer and method of detecting nut - Google Patents

Abstract

To provide a method whereby: when a nut (ginkgo) with a risk of causing allergy is contained in food ingredients and products or the like, its presence can be detected with high sensitivity even if its amount is very small.SOLUTION: The present invention provides a PCR primer that has a nut (ginkgo) with a risk of causing allergy as a detection object, and has specificity to each object, and allows inspection under the same conditions, and a method for detecting the nuts using the primer.SELECTED DRAWING: Figure 1

Description

  The present invention is a nut that may cause allergy (almonds, beach nuts, brazil nuts, butternuts, cashews, chestnuts, chincapine, coconut, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, Pilnuts, pistachios, shea nuts, walnuts) are targeted for detection, and when such nuts are contained in food materials, products, etc., detection of nuts that enable detection with high sensitivity even if the amount is very small The present invention relates to a method, and PCR primers, primer sets, and kits used in the method.

  Among the foods that may cause food allergies, in particular, milk, eggs, fish, crustaceans, wheat, soybeans, peanuts, and tree nuts, which have many patients, are also referred to as "The Big-8" in the United States, In many countries and regions in the world, such as Canada, Singapore, EU, etc., labeling on contained foods is obligatory in common.

Foodstuffs that may cause allergies may cause small amounts of unintended contamination during the production, distribution, and processing stages, so as a food material or product provider, perform quality control of whether they are mixed or not. Is important.

For milk and eggs, methods for detecting characteristic proteins (ELISA, Western blot, and immunochromatography), and for fish, methods for detecting characteristic DNA base sequences (PCR) However, for crustaceans, wheat, soybeans, and peanuts, both detection methods have been established, respectively, and are commercially available and available as test kits. On the other hand, since a tree nut is a generic term and it contains a very wide range of biological species, a method of collectively detecting a tree nut has not been established.

In countries that have a duty to display nuts, the target nuts are, for example, in the EU and Singapore, eight kinds of almonds, walnuts, pecan nuts, hazelnuts, macadamia nuts, brazil nuts, cashew nuts, pistachios, and further pines in Canada. There are nine species added with fruit. In addition to the above-mentioned nine species, there are a total of 19 species in the United States, including beach nuts, butternuts, chestnuts, chinkapins, coconuts, ginkgo, hickory nuts, lychees, pyri nuts and shea nuts.

Japan is different from foreign countries, it is not recommended to display the nuts in a batch as a whole, and it is recommended to display walnuts and cashew nuts separately as "similar to specified raw materials". September 20, 25 (food and drink list 257). In recent years, along with the westernization of the Japanese diet, the intake of tree nuts has increased, and in the future the number of patients with food allergies to nuts other than walnuts and cashew nuts has increased, and to those according to the specified raw materials. It is thought that there is also much addition.

  In order to test the presence or absence of contamination of fruit, it is necessary to combine multiple detection methods for individual fruit, but performing ELISA and Western blot several times is time-consuming and expensive. On the other hand, in the case of the PCR method, if the PCR conditions are the same, a plurality of sets of reagents can be prepared and tested simultaneously, which is considered to be useful as a real tree detection method. Also, in general, proteins are less stable to various processing in food manufacturing processes than DNA, so methods for detecting proteins may not be applicable to highly processed test foods. high. Therefore, the PCR method that targets the base sequence of DNA, which is considered to be relatively stronger in processing than in protein, is considered to be suitable for detection from food materials and products that have undergone various processing steps.

  At present, individual detection methods using PCR method have been established for eight kinds of almond, walnut, pecan nut, hazelnut, macadamia nut, brazil nut, cashew nut and pistachio, and are obtained commercially as a test kit and used It is possible. Although this kit secures detection specificity by adopting a real-time PCR method using TaqMan probe, it requires a device for real-time PCR and reagents, so it is more expensive than a normal PCR method without using a probe. It takes Also, as mentioned above, there are at least 19 species of nuts that may cause food allergy, and there are many nuts that can not be detected with this kit.

As detection methods for individual trees, other detection methods by PCR method have been reported for almond, hazelnut, cashew nut, and walnut (patent documents 1, 2, 3, 4), but all of them are single-type tree fruits. It is a method of detection, and it is not possible to detect multiple types of tree fruits.

  In addition, for the purpose of variety analysis of chestnuts, methods using SSR markers have been reported (Non-patent Document 1), but it is premised that they are used when the test sample is a plant of a single species, In the case of a sample in which plant species are mixed, the PCR primers used are very likely to react with other plant DNAs, which makes it difficult to specifically detect chestnuts. Therefore, it can not be used to specifically detect chestnut DNA in foods containing multiple plants.

  In addition, as a detection method of coconut, a detection method using an immunochromatography method using coconut specific protein target has been established, and it is commercially available as an inspection kit and is available. However, a DNA base sequence is targeted There is no report on the detection method.

  There have been no reports on detection methods for beach nuts, butternuts, chinkapins, silver salmon, hickory nuts, lychees, pyri nuts, pine nuts and shea nuts.

  As mentioned above, nuts that may cause food allergies (almonds, beach nuts, brazil nuts, butternuts, cashews, chestnuts, chincapine, coconut, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts) There has been no report on a method to easily detect fruits, pyri nuts, pistachios, shea nuts, walnuts under the same conditions, and there is a method that can scientifically verify whether these tree fruits are mixed in food materials or products. It is highly anticipated as a food quality control method.

CN 101643786A CN 101643787A CN 101792815A JP, 2009-279000, primer, and detection method of specific plant

Inoue Eiichi, Yamamoto Shunsuke, Yuuki An, Matsuki Hiromi, Anzai Hiroyuki, Hara Hiromichi, Analysis of seven varieties of chestnuts derived from the Korean peninsula with Nihon Guri SSR markers; Sogakuken, 7 (4): 475-480, 2008

  The present invention is a nut that may cause allergy (almonds, beach nuts, brazil nuts, butternuts, cashews, chestnuts, chincapine, coconut, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, The main object of the present invention is to provide a method capable of specifically detecting all at once in food materials and products, as well as PCR primers, primer sets and kits used in this method, for pyri nut, pistachio, shea nut and walnut.

  From the viewpoint of molecular biology, the present inventors focused on the commonality and specificity in the gene sequences of the target tree and other organisms to be detected, and achieved the above-mentioned conception of a tree that is a food allergy causing food. (Highly sensitive to almonds, beech nuts, brazil nuts, butternuts, cashews, chestnuts, chincapine, coconut, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, pyri nuts, pistachios, shea nuts, walnuts) We studied earnestly the methods that can be detected. As a result, almonds, beach nuts, brazil nuts, butternuts, cashews, chestnuts, chincapines, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, pyri nuts, pistachios, shea nuts or walnuts Almonds, beach nuts, brazil nuts, butternuts, cashew nuts, chestnuts, chincapine, coconuts, ginkgo, by finding a unique base sequence for each and performing nucleic acid analysis such as PCR method using these base sequences. We found that hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, pine nuts, pyri nuts, pistachios, shea nuts, or walnuts can be easily detected, respectively, and further studies were repeated to identify them It devised so that can be detected by the original, which resulted in the completion of the present invention. That is, the present invention relates to the following set of PCR primers for detection of tree fruits, a method of detection of tree fruits, and a kit for detection of tree fruits.

Item 1. The PCR primer set of any one of (1) to (34) below.
(1) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 9 to 23 in SEQ ID NO: 1 of the sequence listing;
A PCR primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 5 to 19 in SEQ ID NO: 2 of the sequence listing.
(2) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 7 to 21 in SEQ ID NO: 3 of the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 6 to 20 in SEQ ID NO: 4 of the sequence listing.
(3) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 9 to 23 in SEQ ID NO: 5 in the sequence listing,
A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 6 in the sequence listing on the 3 'end side.
(4) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 6 to 20 in SEQ ID NO: 7 in the sequence listing;
A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 8 in the sequence listing on the 3 'end side.
(5) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 6 to 20 in SEQ ID NO: 9 in the sequence listing,
A primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 10 in the sequence listing on the 3 'end side
(6) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 4 to 18 in SEQ ID NO: 11 of the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 4 to 18 in SEQ ID NO: 12 in the sequence listing.
(7) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 7 to 21 in SEQ ID NO: 13 of the sequence listing,
A primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing at its 3 'end the base sequence of base numbers 13 to 27 in SEQ ID NO: 14 of the sequence listing
(8) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base Nos. 7 to 21 in SEQ ID NO: 15 in the sequence listing,
A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 11 to 25 in SEQ ID NO: 16 of the sequence listing
(9) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 6 to 20 in SEQ ID NO: 17 in the sequence listing;
A PCR primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base numbers 9 to 23 in SEQ ID NO: 18 in the sequence listing on the 3 'end side.
(10) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base Nos. 7 to 21 in SEQ ID NO: 19 of the sequence listing,
The primer set which consists of a PCR primer which consists of DNA of a maximum of 30 bases which contains the base sequence of the base numbers 6-20 in sequence listing to SEQ ID NO: 20 at the 3 'end.
(11) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base Nos. 6 to 20 in SEQ ID NO: 21 in the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 8 to 22 in SEQ ID NO: 22 in the sequence listing.
(12) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 4 to 18 in SEQ ID NO: 23 of the sequence listing,
The primer set which consists of a PCR primer which consists of DNA of a maximum of 30 bases which contains the base sequence of the base numbers 6-20 in sequence listing to sequence | arrangement list | sequence of 3 'of sequence end.
(13) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 5 to 19 in SEQ ID NO: 25 of the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 8 to 22 in SEQ ID NO: 26 in the sequence listing.
(14) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 8 to 22 in SEQ ID NO: 27 of the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 4 to 18 in SEQ ID NO: 28 in the sequence listing.
(15) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 in the sequence listing,
A primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base numbers 15 to 29 in SEQ ID NO: 30 in the sequence listing on the 3 'end side.
(16) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 8 to 22 in SEQ ID NO: 31 of the sequence listing,
A primer set comprising: a PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base numbers 4 to 18 in SEQ ID NO: 32 in the sequence listing.
(17) A PCR primer consisting of a DNA of up to 30 bases including at its 3 'end the base sequence of base Nos. 6 to 20 in SEQ ID NO: 33 of the sequence listing,
The primer set which consists of a PCR primer which consists of DNA of a maximum of 30 bases which contains in the 3 'terminal side the base sequence of base numbers 6-20 in sequence number 34 of sequence listing.
(18) A PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3 'end side
(19) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3 'end side
(20) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 6 in the sequence listing on the 3 'end side
(21) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3 'end side
(22) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 'end side
(23) A PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 'end side
(24) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 14 in the sequence listing on the 3 'end side
(25) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 16 in the sequence listing on the 3 'end side
(26) A PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 18 in the sequence listing on the 3 'end side
(27) A PCR primer consisting of a DNA of up to 30 bases which comprises at its 3 'end the base sequence of SEQ ID NO: 19 in the sequence listing,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 20 in the sequence listing on the 3 'end side
(28) A PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 21 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 22 in the sequence listing on the 3 'end side
(29) A PCR primer consisting of a DNA of up to 30 bases which comprises at its 3 'end the base sequence of SEQ ID NO: 23 in the sequence listing,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 24 in the sequence listing on the 3 'end side
(30) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 25 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 26 in the sequence listing on the 3 'end side
(31) A PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 27 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 28 in the sequence listing on the 3 'end side
(32) A PCR primer consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of SEQ ID NO: 29 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a DNA of up to 30 bases including the base sequence of SEQ ID NO: 30 in the sequence listing on the 3 'end side
(33) A PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 31 in the sequence listing on the 3 'end side,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 32 in the sequence listing on the 3 'end side
(34) A PCR primer consisting of a DNA of up to 30 bases which comprises at its 3 'end the base sequence of SEQ ID NO: 33 in the sequence listing,
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 34 in the sequence listing on the 3 'end side

Item 2. A primer set according to claim 1 (1).

Item 3. The primer set according to claim 1 (2).

Item 4. A primer set according to claim 1 (3).

Item 5. The primer set according to (1) of Claim 1.

Item 6. A primer set according to item 1 (5).

Item 7. A primer set according to (6) of claim 1.

Item 8. A primer set according to (1) of claim 1.

Item 9. A primer set according to (8) of claim 1.

Item 10. The primer set according to (9) of claim 1.

Item 11. A primer set according to (10) of claim 1.

Item 12. The primer set according to (11) of claim 1.

Item 13: The primer set according to (12) of claim 1.

Item 14: The primer set according to (13) of claim 1.

Item 15. The primer set according to (14) of claim 1.

Item 16. A primer set according to (15) of Claim 1.

Item 17: The primer set according to (16) of claim 1.

Item 18: The primer set according to (17) of claim 1.

Item 19. The primer set according to (18) of claim 1.

Item 20. A primer set according to (19) of claim 1.

Item 21. The primer set according to (20) of claim 1.

Item 22. A primer set according to (21) of claim 1.

Item 23. The primer set according to Item 22 (22).

Item 24. A primer set according to (23) of claim 1.

Item 25. The primer set according to (24) of claim 1.

Item 26. A primer set according to (25) of claim 1.

Item 27. A primer set according to (26) of claim 1.

Item 28. The primer set according to (27) of claim 1.

Item 29. The primer set according to (28) of claim 1.

Item 30. The primer set according to Item 29 (29).

Item 31. The primer set according to (30) of claim 1.

Item 32. A primer set according to (31) of claim 1.

Item 33. The primer set according to Item (32).

Item 34. A primer set according to (33) of claim 1.

Item 35. The primer set according to (34) of claim 1.

Item 36. A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template and the primer set according to any one of claims 2 to 35, and detecting the amplified DNA And detecting the presence or absence of a nut in the tree.

Item 37 The step of extracting DNA from a sample, the step of performing PCR using this DNA as a template, and the primer set according to claim 2 and 19, and the presence of almond in the sample by detecting the amplified DNA And detecting the presence or absence of an almond.

Item 38 A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 3 or 20, and detecting beach DNA by detecting amplified DNA. And D. detecting the presence or absence.

Item 39: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 4 or 21, and detecting a DNA amplified by detection of brazil nuts in the sample And detecting the presence or absence.

Item 40 A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 5 or 22, and detection of amplified DNA, the presence of cashew nuts in the sample And detecting the presence or absence of a cashew nut.

Item 41: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template and the primer set according to claim 6 or 23, and detection of amplified DNA, the presence of a chestnut in the sample And detecting the presence or absence of a human being.

Item 42: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 7 and 24. Presence of coconut in the sample by detecting amplified DNA And detecting the presence or absence of the coconut.

Item 43: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 8 and 25. Presence of ginkgo in the sample by detecting amplified DNA And detecting the presence or absence of silver.

Item 44 A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 9 or 26, and presence of hazelnut in the sample by detecting the amplified DNA And detecting the presence or absence of the hazelnut.

Item 45: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 10 or 27, Hickory nuts in a sample by detecting amplified DNA And detecting the presence or absence of the hickory nut.

Item 46: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 11 or 28, and detection of amplified DNA, the presence of litchi in the sample And detecting the presence or absence of a human being.

Item 47 A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 12 or 29, macadamia nut in the sample by detecting the amplified DNA Detecting the presence or absence of the macadamia nut.

Item 48. A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 13 and 30, pecan nut is detected in the sample by detecting the amplified DNA. And detecting the presence or absence of the pecan nut.

Item 49: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 14 or 31, and detection of amplified DNA And D. detecting the presence or absence of a pine nut.

Item 50: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 15 or 32, and presence of pyrinut in a sample by detecting amplified DNA And detecting the presence or absence of the nut.

Item 51: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 16 or 33, and the presence of pistachio in the sample by detecting the amplified DNA And detecting the presence or absence of a pistachio.

Item 52: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set of claim 17 or 34, and the presence of shea nuts in the sample by detecting the amplified DNA And detecting the presence or absence of the toner.

Item 53: A step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 18 or 35, and detection of amplified DNA, the presence of walnut in the sample And detecting the presence or absence of a walnut.

According to the present invention, a nut with high accuracy and detection sensitivity by nucleic acid analysis using PCR etc. (almond, beach nut, brazil nut, butternut, cashew nut, chestnut, chinkapin, coconut, ginkgo, hazelnut, hickory nut, litchi , Macadamia nuts, pecan nuts, pine nuts, pyri nuts, pistachios, shea nuts, walnuts) enables detection of DNA, and whether or not the above-mentioned nuts are mixed in test food materials or test food, or used The effect of enabling the implementation of quality control inspections such as whether or not It also contributes to prevention of allergies and investigation of causative substances when allergic symptoms occur.

It is the photograph after electrophoresis which showed the detection sensitivity of DNA at the time of using the primer set in this invention. (A) A photograph after electrophoresis showing the detection sensitivity of almond DNA in PCR using SEQ ID NO: 1 and SEQ ID NO: 2. (B) A photograph after electrophoresis showing the detection sensitivity of beach nut DNA in PCR using SEQ ID NO: 3 and SEQ ID NO: 4. (C) A photograph after electrophoresis showing the detection sensitivity of Brazil nut DNA in PCR using SEQ ID NO: 5 and SEQ ID NO: 6. (D) A photograph after electrophoresis showing sensitivity of detection of cashew nut DNA in PCR using SEQ ID NO: 7 and SEQ ID NO: 8. (E) A photograph after electrophoresis showing the detection sensitivity of the chestnut DNA in PCR using SEQ ID NO: 9 and SEQ ID NO: 10. (F) A photograph after electrophoresis showing the detection sensitivity of coconut DNA in PCR using SEQ ID NO: 11 and SEQ ID NO: 12. (G) A photograph after electrophoresis showing the detection sensitivity of silverpox DNA in PCR using SEQ ID NO: 13 and SEQ ID NO: 14. (H) A photograph after electrophoresis showing the detection sensitivity of hazelnut DNA in PCR using SEQ ID NO: 15 and SEQ ID NO: 16. (I) A photograph after electrophoresis showing the detection sensitivity of hickory nut DNA in PCR using SEQ ID NO: 17 and SEQ ID NO: 18. (J) A photograph after electrophoresis showing the detection sensitivity of lychee DNA in PCR using SEQ ID NO: 19 and SEQ ID NO: 20. (K) A photograph after electrophoresis showing the detection sensitivity of macadamia nut DNA in PCR using SEQ ID NO: 21 and SEQ ID NO: 22. (L) A photograph after electrophoresis showing sensitivity for detection of pecan nut DNA in PCR using SEQ ID NO: 23 and SEQ ID NO: 24. (M) A photograph after electrophoresis showing the detection sensitivity of pine real DNA in PCR using SEQ ID NO: 25 and SEQ ID NO: 26. (N) A photograph after electrophoresis showing the detection sensitivity of pyrinut DNA in PCR using SEQ ID NO: 27 and SEQ ID NO: 28. (O) A photograph after electrophoresis showing the detection sensitivity of pistachio DNA in PCR using SEQ ID NO: 29 and SEQ ID NO: 30. (P) A photograph after electrophoresis showing sensitivity for detection of shea nut DNA in PCR using SEQ ID NO: 31 and SEQ ID NO: 32. (Q) A photograph after electrophoresis showing the detection sensitivity of walnut DNA in PCR using SEQ ID NO: 33 and SEQ ID NO: 34.

Hereinafter, the present invention will be described in detail.
A set of PCR primers for detection of fruit of tree The present inventors developed the following set of PCR primers for detection of real of 17 trees according to the above-mentioned purpose. The PCR primer set for detecting a fruit of a tree of the present invention is characterized by one having a base sequence characteristic to almonds, one having a base sequence characteristic to beach nuts, one having a base sequence characteristic to brazil nuts, cashew nuts Having a unique base sequence, having a base sequence characteristic of chestnut, having a base sequence characteristic of coconut, having a base sequence characteristic of hazelnut, having a base sequence characteristic of ginkgo Those having a base sequence characteristic of hickory nuts, those having a base sequence characteristic of lychee, those having a base sequence characteristic of macadamia nuts, those having a base sequence characteristic of pecan nuts, pyri nut Having a characteristic nucleotide sequence, those having a characteristic nucleotide sequence for pine nuts, and those characteristic of pistachio Those having a row, having a characteristic nucleotide sequence in shea nut, and those having a characteristic nucleotide sequence walnut.

  Each primer set was designed as follows. The target nucleotide sequence is preferably one with a large copy number per cell from the viewpoint of sensitivity improvement, and the chloroplast rbc (large subunit gene for ribulose-1, 5-bisphosphate carboxylase / oxygenase) gene sequence, matk (matk) The maturase-encoding gene) gene sequence, the internal transcription spacer region 1 (ITS 1) nucleotide sequence of the rRNA gene, and the internal transcription spacer region 2 (ITS 2) nucleotide sequence were selected as candidates. Obtain the sequences of various plants from a known DNA database (GenBank nucleotide sequence database), or obtain some plants by analyzing them uniquely and create multiple parallel sequence diagrams of their vast base sequences did. Among them, the ITS region is suitable as a target sequence of real specific primers for various trees because the ITS region has a high evolution rate and enables identification of more closely related species.

  When developing primer sets for detecting almonds, the species to be detected is set to almonds (Prunus dulcis), and the almonds and their related species peaches (Prunus percica) The nucleotide sequences of the ITS region of prunes (Prunus domestica), plum (Prunus mume), plum (Prunus salicina), apricot (Prunus armeniaca), and cherry (Prunus avium) were compared. Although the base sequence of the ITS region was highly homologous to the closely related species, and it was difficult to select an almond-specific base sequence, the multiple parallel sequence map was compared and examined in detail. A base sequence region can be selected, and a PCR primer set was newly designed from the base sequence region. In designing, the nucleotide sequence region of the species to be detected is designed so that it hybridizes under stringent conditions but does not hybridize to the species not to be detected. did.

  When developing a primer set for detecting beach nuts, the biological species to be detected is set to be a beach nut (Fagus spp.), And it is a beach nut and its related species, a chestnut of the same family. Genus Curea (Castanea spp.), Genus Ivy (Castanopsis spp.), Quercus acorn (Quercus spp.), Homonymaceae Pecan Hickory Nuts (Carya spp.), Pecan Nuts (Carya illinoinensis) The nucleotide sequences of the ITS regions of walnuts of the walnut family Walnut (Juglans spp.) And hazelnuts of the family Birch (Corylus spp.) Were compared. A nucleotide sequence region specific to a beach nut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  When developing a PCR primer set for detection of brazil nuts, the biological species to be detected is set as brazil nuts (Bertholletia excelsa), and the brazil nuts and their related species Of the same order of the family Acacutidae Sheer butternut (Vitellaria paradoxa), acacutaceae Fruclico miracle fruit (Synseparum dulcificum), the Kakinoki family Kakinoki oyster (Diospyros kaki), the Kakinokiaceae camellia tea (Camellia sinensis) The base sequences of the ITS regions of the Kiwifruit (Actinidia deliciosa) of the Matatabiaceae family and the blueberry (Vaccinium spp.) Of the azalea family were compared. A nucleotide sequence region specific to Brazil nuts was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting cashew nuts, the species to be detected is set as cashew nuts (Anacardium occidentale), which is a cashew nut and its related species, kakinoki. The nucleotide sequences of the ITS regions of the genus Pistachio (Pistacia vera), the mango genus Mango (Mangifera indica), and the pink pepper family (Schinus molle) are compared. A base sequence region specific to cashew nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  Moreover, in the case of development of the PCR primer set for chestnut detection, the biological species to be detected was set to chestnut (Beechella spp.). Chinkapin (Castanea pumila) is also a kind of chestnut genus, and therefore, it was detected. Chestnut and related beech Beechnuts (Fagus spp.), Aquilinia (Castanopsis spp.), Quercus acorn (Quercus spp.), Homonychidae Pecan Hickory nuts The nucleotide sequences of the ITS regions of (Carya spp.), Pecan nut (Carya illinoinensis), walnut family walnut family (Jugrans spp.), And hazelnut family Hazelnut family (Corylus spp.) Were compared. Although the nucleotide sequence of the ITS region is highly homologous to closely related species, it was difficult to select a chestnut-specific nucleotide sequence, but the multiple parallel sequence diagram was compared and examined in detail, and the region for the sense primer was hickory nuts Select the region with high homology to pecan nuts, select the region for antisense primer with low homology to hickory nuts and pecan nuts, but select the region with high homology to acorn, and use for detection except for chestnuts A clip intended for detection by combining a sense primer exhibiting cross compatibility with a living species (hickory nut, pecan nut) with an antisense primer exhibiting cross compatibility with another living species (acorn). With the corresponding nucleotide sequence region of the DNA under stringent conditions, but with a species not to be detected. We designed a novel PCR primer set that was not creative.

  In addition, when developing a PCR primer set for detecting coconuts, the biological species to be detected is set to coconut (coconid cococococococcal coconut palm (Cocos nucifera)), and coconut and its close relatives, date palms The nucleotide sequences of the ITS region of the genus date palm (Phoenix dactylifera) and that of the Euterpe acai (Euterpe oleracea) were compared. A nucleotide sequence region specific to coconut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting ginkgo, the biological species to be detected is set to ginkgo (Ginko biloba), and chloroplast matK gene sequences of ginkgo and other gymnosperm plants Compared. A gene sequence region specific for ginkgo was selected, and a PCR primer set was newly designed from the gene sequence region. At that time, the gene sequence region of the species to be detected was designed in a creative manner so as to hybridize under stringent conditions but not to the species not to be detected.

  In addition, when developing a PCR primer set for hazelnut detection, the species to be used for detection is set as hazelnut (Boccidae: Corylus spp.), And hazelnut and homozygous walnut as a related species thereof. Family Pecan hickory nuts (Carya spp.), Pecan nuts (Carya illinoinensis), walnut family walnut family (Jugrans spp.), Chestnut family chestnut family (Castanea spp.), Beech family beech nuts The nucleotide sequences of the ITS regions of (Fagus spp.), Beechaceae spp. (Castanopsis spp.), And Beech family Quercus acorn (Quercus spp.) Were compared. A base sequence region specific to hazelnut was selected, and a PCR primer set was newly designed from the base sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting hickory nuts, the species to be detected is set as hickory nuts (Beech order Walnut family Carya spp.), And it is hickory nuts and their related species. The same order of walnut family walnuts walnut (Juglans spp.), Chestnut family chestnut (Castanea spp.), Beech family beech nut (Fagus spp.), Beech family shii (Castanopsis spp.) The nucleotide sequences of the ITS regions of the acorns of the Beech family Quercus acorn (Quercus spp.) And the hazelnuts of the birchaceae family Hazelnut (Corylus spp.) Were compared. A nucleotide sequence region specific to hickory nuts was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting lychee, the species to be detected is set as lychee (Litchi chinensis), and the same family of lychee and its related species, rambutan. The nucleotide sequences of the ITS region of the genus Rambutan (Nephelium lappaceum) were compared. A base sequence region specific to lychee was selected, and a PCR primer set was newly designed from the base sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting macadamia nuts, the species to be detected is set as macadamia nuts (Macadamia spp.), Which are macadamia nuts and their related species. The nucleotide sequences of the ITS region of lotus root (Nelumbo nucifera) of the same order of the lotus family Hass were compared. A nucleotide sequence region specific to macadamia nut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting pecan nuts, the species to be detected was set to pecan nuts (Bechellanaceae Pecan genus Pecan (Carya illinoinensis)). Although pecan nuts are a kind of hickory nuts (pecan genus) mentioned above, it is considered that it is necessary to distinguish pecan nuts from other hickory nuts because they are the most widely distributed hickory nuts in the market. Pecan nuts and their related relatives, hickory nuts (Carya ovata, Carya laciniosa), homozygous walnut family walnuts (Juglans spp.), Chestnut family chestnuts (Castanea spp.), Beech family Beech beach nuts (Fagus spp.), Beech family snails (Castanopsis spp.), Beech family acorns (Quercus spp.), Hazelnut hazelnuts (Corylus spp.) ITS area The nucleotide sequences were compared. Although the base sequence of the ITS region is highly homologous to the closely related species, it was difficult to select a pecan nut specific base sequence, but a detailed comparison of multiple parallel sequence diagrams showed that it was specific to pecan nut A base sequence region can be selected, and a PCR primer set was newly designed from the base sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting pine nuts, the species to be detected is set to pine nuts (Pinus spp. Pinus spp.), And the pine nuts and other gymnosperms are set. The base sequences of the ITS regions of A nucleotide sequence region specific to pine nuts was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detection of pyrinut, the biological species to be detected is set to pyrinut (Copperonaceae family Prunus pyrinut (Canarium ovatum)), and the pyrinut and its related relatives Cashew nut (Anacardium occidentale), Urushi family Pistachio (Pistacia vera), Urushi family Mango (Mangifera indica), Urushi Family Pink Pink Pepper (Schinus molle), Mukuroji Reishi The nucleotide sequences of the ITS region of lychee (Litchi chinensis), rambutan Rambutan (Nephelium lappaceum), and Citrus orange (Citrus sinensis) were compared. A nucleotide sequence region specific to pyrinut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting pistachio, the species to be detected is set to pistachio (Pistacia vera) and it is related to pistachio and its related species, cashew nut tree plant. The nucleotide sequences of ITS regions of cashew nuts of the genus (Anacardium occidentale), mangoes of the genus Mango (Mangifera indica), and pink peppers of the genus Amaranth (Schinus molle) were compared. A nucleotide sequence region specific to pistachio was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for the detection of shea nuts, the biological species to be detected is set as shea nuts (Vitellaria spp. Sheer butternut (Vitellira paradox)), and is a closely related species, the same family of Frukuriko. Genus miracle fruit (Synseparum dulcificum), Congener of the family Sabaliaceae Brazilian nutwood (Bertholletia excelsa), the family of the family Kakinokiki with oysters (Diospyros kaki), a tea of the family Kakinokiaceae with camellia (Camellia sinensis), the family Matatabi The nucleotide sequences of the ITS regions of kiwifruit (Actinidia deliciosa) and blueberry (Vaccinium spp.) Of the azalea family were compared. A base sequence region specific for shea nuts was selected, and a PCR primer set was newly designed from the base sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  In addition, when developing a PCR primer set for detecting walnut, a biological species to be detected was set to walnut (beech-order Walnutaceae (Juglans spp.)). Since butternut (Juglans cinerea) is also a kind of the genus Walnut, it was detected. Walnut and its related relatives, Pecan Hickory nuts (Carya ovata, Carya laciniosa), Pecan nuts (Carya illinoinensis), Homoclinic chestnuts (Castanea spp.), Beech family Beech Nucleotide sequences of the ITS region of beechnuts (Fagus spp.), Beechaceae snails (Castanopsis spp.), Beechaceae Quercus acorns (Quercus spp.), Birchaceae Hazelnuts (Corylus spp.) Compared. A nucleotide sequence region specific to walnut was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, it was designed ingeniously so that it would hybridize under stringent conditions with the relevant nucleotide sequence region of the species to be detected but not with the species not to be detected.

  Each primer was designed so as not to cause hybridization between the sense primer and the antisense primer or hybridization with the individual primers themselves, that is, to prevent formation of so-called primer dimers as much as possible. . For example, in order to avoid the formation of primer dimers, base substitutions are applied to the primers so as not to cause a decrease in detection specificity and detection sensitivity of the primers. Although the bases of base numbers 3 and 4 in SEQ ID NO: 1 which is the sense primer of the almond detection primer are originally A, detection specificity and detection of the primer to avoid formation of the primer dimer by the sense primer itself T is used in place of A as a base substitution that does not lead to a decrease in sensitivity. Similarly, the base of base No. 8 in SEQ ID NO: 10 is C to A, the base of base No. 6 in SEQ ID NO: 15 is G to A, the base of base No. 3 in SEQ ID NO: 21 is C to A, SEQ ID NO: The base of base No. 4 in No. 24 is substituted from C to A, and the base of base No. 7 is substituted from A to T.

Furthermore, in order to make the PCR reaction conditions by the 17 types of primer sets identical, each PCR primer was designed such that the annealing conditions (annealing temperature, annealing time) which most influence the reaction conditions become identical in the PCR reaction. It was very difficult to make the annealing conditions of multiple types of PCR primers identical, but by carefully examining the number of bases of PCR primers and the base sequences of the primers themselves, each detection specificity is not impaired. The annealing conditions were designed to be the same.

  Although the base sequences of the primers provided by the present invention have been comprehensively described, primers which can not possess intended performance (detection specificity etc.) even if the primers were designed successfully in theory are designed May be For example, in the PCR using the PCR primer set for detecting pecan nuts consisting of SEQ ID NO: 69 and SEQ ID NO: 70 in the research stage of the present invention, pecan nut DNA despite the use of a base sequence unique to pecan nuts. As well as hickory nut (over Tahycholic) DNA was also detected and did not show the intended detection specificity. In this way, simply designing a primer logically can not necessarily obtain the intended performance (detection specificity etc.), and it may occur even when the necessary performance is not possessed. Not only logical design, but further ideas and their performance evaluation tests become important. The primer provided by the present invention was designed by further devising on the logical design, and finally cleared the performance evaluation test.

  Therefore, by using a nucleic acid analysis method such as PCR method using a PCR primer set for detecting a tree seed of the present invention, a tree nut (almond, beach nut, brazil nut, butternut, cashew nut, chestnut, chinkapin contained in various foods) It is possible to detect DNAs derived from coconut, ginkgo, hazelnut, hickory nut, lychee, macadamia nut, pecan nut, pine nut, pyri nut, pistachio, shea nut, or walnut) at high sensitivity and specifically at the same time.

Here, nucleic acid analysis is performed by analyzing the presence or absence of a characteristic base sequence by utilizing the existence of a characteristic base sequence according to individual species, genus or group in biological classification. It is an effective means for grasping the species, genus or group of the organism, and is a method useful for detection of a specific microorganism or identification of a species.

The nucleotide sequences of the primers provided by the present invention are as follows.
Base number 12345678901234567890123456789
Sequence number 1 (almond S) AGTTCTAGTTTCAAAGCGGGGGC
SEQ ID NO: 2 (almond AS) ACGACGGGCAACCGAGGTC
SEQ ID NO: 3 (Beachnut S) GCCTTTCGTCCCCAAACGGTC
SEQ ID NO: 4 (Beachnut AS) TGCCACGGTCGCTTCGAATG
Sequence number 5 (Brazil nut S) GACGAGTGGTGGATCACGACACG
SEQ ID NO: 6 (Brazil nut AS) TCGATGCCTTGCGCGCTTCG
Sequence number 7 (cashew nut S) TGGCGTTCGGAACGAACCCG
Sequence number 8 (cashew nut AS) GCGATGCGGGCGGGCATAG
Sequence number 9 (cris S) GGAACGCGCCAAGGAAATCA
Sequence number 10 (criss AS) TCGCCC CAGCC CCGA ACC
SEQ ID NO: 11 (coconut S) GACGCTCGCCCCCTCTGA
Sequence number 12 (coconut AS) GTGCGGCACGCACCTGGG
SEQ ID NO: 13 (Ginkgo S) GGTGCTC ACTCCCCCAGTCAGG
SEQ ID NO: 14 (Ginko AS) CATCTAGCATTTTGATCCTAACCACGG
SEQ ID NO: 15 (Hazelnut S) ATGCCAGGGGCGAATCTTGTG
SEQ ID NO: 16 (Hazelnut AS) GCTACAGGGTCACAGAGCACAAGAC
Sequence number 17 (hickory nut S) TGGGAGGGCACGATGAAAGC
SEQ ID NO: 18 (Hickory nuts AS) CGACGCAATAGGGTCGAGGAGAG
SEQ ID NO: 19 (Litchi S) GAGGCGTGGGGATGCGTTATC
SEQ ID NO: 20 (Litchi AS) CGAGAGCCTTAGCCG GACCG
SEQ ID NO: 21 (Macadamia nut S) GCACCCCGTGTCTCTGTTCG
SEQ ID NO: 22 (Macadamia nut AS) CGATGTCCCGAACAATGGCAAAG
Sequence number 23 (pecan nut S) ACGGTTGGGAGGGCACGA
SEQ ID NO: 24 (Pecan nut AS) TGTAGTTGCGCTCGTCGCC
Sequence number 25 (pine nut S) CAGGCGATGTTTCGTGGCG
SEQ ID NO: 26 (matsuno AS) CCCTACCCAATGGGAGGACAAG
Sequence number 27 (pyri nuts S) TGGTCGTAACGAACCTCGGTGC
SEQ ID NO: 28 (pyri nut AS) CGTCACGGCGGCGCTTTC
SEQ ID NO: 29 (pistachio S) GGTGTCGGTCGTATGCTTCTGCAT
Sequence number 30 (pistachio AS) GTCGTTATTGATAATGAAAGAAGGCTACC
Sequence number 31 (shea nut S) GCGTTGCCTCGGCTAAAAACTC
SEQ ID NO: 32 (shear nut AS) GCGGTCAAGGCTCGCGAA
Sequence number 33 (walnut S) GGTTGGGAGGGCACGTTGAG
SEQ ID NO: 34 (Walnut AS) CGACGGGTCACGAGGGTTTC
Moreover, as a primer which consists of DNA of 30 bases which this invention provides, the thing of the following base sequences can be raised, for example.
SEQ ID NO: 35 (almond S) cgacccgAGTTCTAGTTTCAAAGCGGGGGC
SEQ ID NO: 36 (almond AS) gacgaacgcac ACGACGGGCAACCGAGGTC
SEQ ID NO: 37 (Beachnut S) ggcttcgcgGCCTTTTCGTCCCCAAACGGTC
SEQ ID NO: 38 (Beachnut AS) cggacgaggt TGCCACGGTCGCTTCGAATG
SEQ ID NO: 39 (Brazil nut S) acggcacGACGAGTGGTGGATCACGACACG
SEQ ID NO: 40 (Brazil nuts AS) tggggtcgcggTCGATGCCTTGCGCGCTTCG
Sequence number 41 (cashew nut S) cgacggtcggTGGCGTTCGGAACGAACCCG
SEQ ID NO: 42 (cashew nut AS) ggggtcgcgacGCGATGCGGGCGGGCATAG
Sequence number 43 (chestnut S) accccggcgcGGAACGCGCCAAGGAAATCA
SEQ ID NO: 44 (criss AS)
SEQ ID NO: 45 (coconut S) atcatgccaagcGACGCTCGCCCCCTCCGA
SEQ ID NO: 46 (coconut AS) ccgatggctgggGTGCGGCACGCACCTGGG
SEQ ID NO: 47 (Ginko S) gctctgaagGGTGCTCACTCCCCAGTCAGG
SEQ ID NO: 48 (Ginko AS) aatCATCTAGCATTTTTCATCCTAACCACGG
SEQ ID NO: 49 (Hazelnut S) acggcgtgc ATGCCAGGGGCGAATCTTGTG
SEQ ID NO: 50 (Hazelnut AS) gcgca GCTACAGGGTCACAGAGCACAAGAC
Sequence number 51 (hickory nuts S) caaaaacggtTGGGAGGGCACGATGAAAGC
SEQ ID NO: 52 (Hickory nuts AS) gcaagaa CGACGCAATAGGGTCGAGGAGAG
SEQ ID NO: 53 (Lychee S) gcctcggacGAGGCGTGGGGATGCGTTATC
SEQ ID NO: 54 (Lychee AS) gcttcagggtCGAGAGCCTTACGCCG G ACCG
SEQ ID NO: 55 (Macadamia nut S) gcgaagatg GCACCCCGTGTCTCTGTTCG
SEQ ID NO: 56 (Macadamia nut AS) cacgcaca CGATGTCCGAACAATGGCAAAG
Sequence number 57 (pecan nut S) cccctcccaaaaACGGTTGGGAGGGCACGA
SEQ ID NO: 58 (Pecan nut AS) cgggaggccaTGTAGTTGCGCTCGTCGCC
SEQ ID NO: 59 (pine nut S) ctgaaatgtggCAGGCGATGTTTCGTGGCG
SEQ ID NO: 60 (A pine pine AS) taaatccg CCCTACCCAATGGGAGGACAAG
Sequence number 61 (pyri nuts S) accttcggTGGTCGTAACGAACCTCGGTGC
SEQ ID NO: 62 (pyri nut AS) gtgcgggcgccg CGTC ACGGCGGCGCTTTC
Sequence number 63 (pistachio S) tcgtcgGGTGTCGGTCGGTATGCTTCTGCAT
SEQ ID NO: 64 (pistachio AS) aGTCGTTATTGATAATGAAAGAAGGCTACC
SEQ ID NO: 65 (shear nut S) cctgaattGCGTTGCCTCGGCTAAAAACTC
SEQ ID NO: 66 (shear nut AS) tgacctggggtc GCGGTCAAGGCTCGCAAA
Sequence number 67 (walnut S) cccaaaaaacGGTTGGGAGGGCACGTTGAG
SEQ ID NO: 68 (Walnut AS) gggcaacaca CGACGGGTCACGAGGGTTTC

The nucleotide sequences of the primers which did not show the intended detection specificity at the research stage of the present invention are as follows.
Sequence number 69 (pecan nut S) CCCC AAAC ACC TCG TATGATGTGTA
SEQ ID NO: 70 (Pecan nut AS) TGTAGTTGCGCTCGTCGCC
(S represents a sense primer and AS represents an antisense primer.)

  The present invention uses, as a first primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 9 to 23 in SEQ ID NO: 1 in the sequence listing on the 3 'end side. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base Nos. 5 to 19 in SEQ ID NO: 2 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for almond detection.

  The present invention uses, as a second primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 7 to 21 in SEQ ID NO: 3 in the sequence listing on its 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base numbers 6 to 20 in SEQ ID NO: 4 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for beach nut detection.

  The present invention uses, as a third primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases containing the base sequence of base Nos. 9 to 23 in SEQ ID NO: 5 on the 3 'end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base numbers 5 to 19 in SEQ ID NO: 6 in the row is on the 3 'end side as an antisense primer. This primer set can be suitably used for Brazil nut detection.

  The present invention uses, as a fourth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 7 in the sequence listing on its 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base Nos. 5 to 19 in SEQ ID NO: 8 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for cashew nut detection.

  In the present invention, as a fifth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 9 in the sequence listing on the 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base Nos. 4 to 18 in SEQ ID NO: 10 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for chestnut detection.

  In the present invention, as a sixth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 11 in the sequence listing on the 3 'end side is used as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base Nos. 4 to 18 in SEQ ID NO: 12 in the column list on the 3 'end side is used as an antisense primer. The primer set can be suitably used for coconut detection.

  In the present invention, as a seventh primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 7 to 21 in SEQ ID NO: 13 in the sequence listing on the 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base numbers 13 to 27 in SEQ ID NO: 14 in the column list on the 3 'end side is used as an antisense primer. The present primer set can be suitably used for detecting silver dust.

  In the present invention, as an eighth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 7 to 21 in SEQ ID NO: 15 in the sequence listing on the 3 'end side is used as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base numbers 11 to 25 in SEQ ID NO: 16 in the row is on the 3 'end side as an antisense primer. This primer set can be suitably used for hazelnut detection.

  In the present invention, as a ninth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 17 in the sequence listing on the 3 'end side is used as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA of the shortest 15 maximum 30 bases including the base sequence of base numbers 9 to 23 in SEQ ID NO: 18 in the row on the 3 'end side is used as an antisense primer. The primer set can be suitably used for detecting hickory nuts.

  The present invention uses, as a tenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 7 to 21 in SEQ ID NO: 19 in the sequence listing on its 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base Nos. 6 to 20 in SEQ ID NO: 20 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for litchi detection.

  The present invention uses, as an eleventh primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 21 in the sequence listing as the sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base numbers 8 to 22 in SEQ ID NO: 22 on the 3 'end side of the array is used as an antisense primer. The primer set can be suitably used for macadamia nut detection.

  The present invention uses, as a twelfth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base numbers 4 to 18 in SEQ ID NO: 23 in the sequence listing as the sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base Nos. 6 to 20 in SEQ ID NO: 24 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for pecan nut detection.

  The present invention uses, as a thirteenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 25 in the sequence listing as the 13th primer set. A primer set is proposed in which a PCR primer consisting of a DNA of the shortest 15 maximum 30 bases including the base sequence of base numbers 8 to 22 in SEQ ID NO: 26 on the 3 'end side of the array is used as an antisense primer. This primer set can be suitably used for pine real detection.

  The present invention uses, as a fourteenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 8 to 22 in SEQ ID NO: 27 in the sequence listing as the 14th primer set. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 28 on the 3 'end side is used as an antisense primer. This primer set can be suitably used for pyri nut detection.

  The present invention uses, as a fifteenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 in the sequence listing as the sense primer. A primer set is proposed in which a PCR primer consisting of a DNA of the shortest 15 up to 30 bases including the base sequence of base numbers 15 to 29 in SEQ ID NO: 30 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for pistachio detection.

  The present invention uses, as a sixteenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 8 to 22 in SEQ ID NO: 31 in the sequence listing on its 3 'end A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base Nos. 4 to 18 in SEQ ID NO: 32 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for shea nut detection.

  The present invention uses, as a seventeenth primer set, a PCR primer consisting of a DNA having a maximum length of 15 bases and a maximum of 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 33 in the sequence listing as the sense primer. A primer set is proposed in which a PCR primer consisting of a DNA having a maximum length of 15 up to 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 34 in the column list on the 3 'end side is used as an antisense primer. This primer set can be suitably used for walnut detection.

  In each of the above primers, the length of the base sequence is set to 15 to 30 because the appropriate length of the base sequence as a PCR primer is about 15 to 30, and 15 bases at the 3 'end side It is important to identify 15 sequences at the 3 'end in the specific amplification reaction of PCR, and the base sequence at the 5' end is slightly different, or the length of the sequence is slightly different. Even so, the adverse effect on the PCR reaction itself is usually small.

  In the present invention, further, as a preferred embodiment of the first primer set, a PCR primer (1 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 1) as a sense primer, and a PCR primer (2 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 2 as an antisense primer. This primer set can be suitably used for detecting almonds, and it is most preferable to use the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 as a set. In addition, the primer of sequence number 35 can be illustrated as a specific example of (1 '), and the primer of sequence number 36 can be illustrated as a specific example of (2').

  In the present invention, further, as a preferred embodiment of the second primer set, a PCR primer (3 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 3) as a sense primer, and a PCR primer (4 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3' end side Proposes a primer set in which a primer consisting of a DNA of the base sequence of SEQ ID NO: 4 is used as an antisense primer. This primer set can be suitably used for beach nut detection, and it is most preferable to use the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 as a set. In addition, the primer of sequence number 37 can be illustrated as a specific example of (3 '), and the primer of sequence number 38 can be illustrated as a specific example of (4').

  In the present invention, further, as a preferred embodiment of the third primer set, a PCR primer (5 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 5) as a sense primer, and a PCR primer (6 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 6 in the sequence listing on the 3' end side Proposes a primer set using as a antisense primer a primer consisting of a DNA of the base sequence of SEQ ID NO: 6). The present primer set can be suitably used for detecting Brazil nuts, and it is most preferable to use the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 as a set. In addition, the primer of sequence number 39 can be illustrated as a specific example of (5 '), and the primer of sequence number 40 can be illustrated as a specific example of (6').

  In the present invention, further, as a preferred embodiment of the fourth primer set, a PCR primer (7 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 7 as a sense primer, and a PCR primer (8 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 8 in the sequence listing on the 3' end side Proposes a primer set in which a primer consisting of a DNA of the base sequence of SEQ ID NO: 8 is used as an antisense primer. This primer set can be suitably used for cashew nut detection, and it is most preferable to use the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 as a set. In addition, the primer of sequence number 41 can be illustrated as a specific example of (7 '), and the primer of sequence number 42 can be illustrated as a specific example of (8').

  In the present invention, further, as a preferred embodiment of the fifth primer set, a PCR primer (9 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 9) as a sense primer, and a PCR primer (10 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 10 as an antisense primer. This primer set can be suitably used for detection of chestnuts, and it is most preferable to use the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 as a set. In addition, the primer of sequence number 43 can be illustrated as a specific example of (9 '), and the primer of sequence number 44 can be illustrated as a specific example of (10').

In the present invention, further, as a preferred embodiment of the sixth primer set, a PCR primer (11 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 11) as a sense primer, and a PCR primer (12 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 12 as an antisense primer. This primer set can be suitably used for coconut detection, and it is most preferable to use the primer of SEQ ID NO: 11 and the primer of SEQ ID NO: 12 as a set. In addition, the primer of sequence number 45 can be illustrated as a specific example of (11 '), and the primer of sequence number 46 can be illustrated as a specific example of (12').

In the present invention, further, as a preferred embodiment of the seventh primer set, a PCR primer (13 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 13) as a sense primer, and a PCR primer (14 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 14 as an antisense primer. This primer set can be suitably used for detecting silver globules, and it is most preferable to use the primer of SEQ ID NO: 13 and the primer of SEQ ID NO: 14 in a set. In addition, the primer of sequence number 47 can be illustrated as a specific example of (13 '), and the primer of sequence number 48 can be illustrated as a specific example of (14').

  In the present invention, further, as a preferred embodiment of the eighth primer set, a PCR primer (15 ') consisting of a DNA of at most 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 15) as a sense primer, and a PCR primer (16 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 16 in the sequence listing on the 3' end side Proposes a primer set in which a primer consisting of DNA of the base sequence of SEQ ID NO: 16 is used as an antisense primer. This primer set can be suitably used for hazelnut detection, and it is most preferable to use the primer of SEQ ID NO: 15 and the primer of SEQ ID NO: 16 as a set. In addition, the primer of sequence number 49 can be illustrated as a specific example of (15 '), and the primer of sequence number 50 can be illustrated as a specific example of (16').

  In the present invention, further, as a preferred embodiment of the ninth primer set, a PCR primer (17 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 17 as a sense primer, and a PCR primer (18 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3' end Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 18 as an antisense primer. This primer set can be suitably used for detecting hickory nuts, and it is most preferable to use the primer of SEQ ID NO: 17 and the primer of SEQ ID NO: 18 in combination. In addition, the primer of sequence number 51 can be illustrated as a specific example of (17 '), and the primer of sequence number 52 can be illustrated as a specific example of (18').

  In the present invention, further, as a preferred embodiment of the tenth primer set, a PCR primer (19 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 19 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 19) as a sense primer, and a PCR primer (20 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 20 in the sequence listing on the 3' end side Proposes a primer set in which a primer consisting of DNA of the base sequence of SEQ ID NO: 20 is used as an antisense primer. This primer set can be suitably used for litchi detection, and it is most preferable to use the primer of SEQ ID NO: 19 and the primer of SEQ ID NO: 20 as a set. In addition, the primer of sequence number 53 can be illustrated as a specific example of (19 '), and the primer of sequence number 54 can be illustrated as a specific example of (20').

  In the present invention, further, as a preferred embodiment of the eleventh primer set, a PCR primer (21 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 21 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 21) as a sense primer, and a PCR primer (22 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 22 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 22 as an antisense primer. This primer set can be suitably used for detecting macadamia nut, and it is most preferable to use the primer of SEQ ID NO: 21 and the primer of SEQ ID NO: 22 in combination. In addition, the primer of sequence number 55 can be illustrated as a specific example of (21 '), and the primer of sequence number 56 can be illustrated as a specific example of (22').

  In the present invention, further, as a preferred embodiment of the twelfth primer set, a PCR primer (23 ') consisting of a DNA of at most 30 bases containing the base sequence of SEQ ID NO: 23 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 23) as a sense primer, and a PCR primer (24 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 24 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 24 as an antisense primer. This primer set can be suitably used for pecan nut detection, and it is most preferable to use the primer of SEQ ID NO: 23 and the primer of SEQ ID NO: 24 as a set. In addition, the primer of sequence number 57 can be illustrated as a specific example of (23 '), and the primer of sequence number 58 can be illustrated as a specific example of (24').

  In the present invention, further, as a preferred embodiment of the thirteenth primer set, a PCR primer (25 ') consisting of a DNA of at most 30 bases containing the base sequence of SEQ ID NO: 25 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 25) as a sense primer, and a PCR primer (26 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 26 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 26 as an antisense primer. This primer set can be suitably used for detection of pine nuts, and it is most preferable to use the primer of SEQ ID NO: 25 and the primer of SEQ ID NO: 26 as a set. In addition, the primer of sequence number 59 can be illustrated as a specific example of (25 '), and the primer of sequence number 60 can be illustrated as a specific example of (26').

In the present invention, further, as a preferred embodiment of the fourteenth primer set, a PCR primer (27 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 27 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the nucleotide sequence of SEQ ID NO: 27) as a sense primer, and a PCR primer (28 ') consisting of a DNA of up to 30 bases containing the nucleotide sequence of SEQ ID NO: 28 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 28 as an antisense primer. This primer set can be suitably used for detection of pyrinut, and it is most preferable to use the primer of SEQ ID NO: 27 and the primer of SEQ ID NO: 28 as a set. In addition, the primer of sequence number 61 can be illustrated as a specific example of (27 '), and the primer of sequence number 62 can be illustrated as a specific example of (28').

  In the present invention, further, as a preferred embodiment of the fifteenth primer set, a PCR primer (29 ') consisting of a DNA of at most 30 bases containing the base sequence of SEQ ID NO: 29 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 29) as a sense primer, and a PCR primer (30 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 30 in the sequence listing on the 3' end side Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 30 as an antisense primer. This primer set can be suitably used for pistachio detection, and it is most preferable to use the primer of SEQ ID NO: 29 and the primer of SEQ ID NO: 30 as a set. In addition, the primer of sequence number 63 can be illustrated as a specific example of (29 '), and the primer of sequence number 64 can be illustrated as a specific example of (30').

  In the present invention, further, as a preferred embodiment of the sixteenth primer set, a PCR primer (31 ') consisting of a DNA of at most 30 bases containing the base sequence of SEQ ID NO: 31 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 31) as a sense primer, and a PCR primer (32 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 32 in the sequence listing on the 3' end side Proposes a primer set using as a antisense primer a primer consisting of DNA of the base sequence of SEQ ID NO: 32). This primer set can be suitably used for shea nut detection, and it is most preferable to use the primer of SEQ ID NO: 31 and the primer of SEQ ID NO: 32 as a set. In addition, the primer of sequence number 65 can be illustrated as a specific example of (31 '), and the primer of sequence number 66 can be illustrated as a specific example of (32').

  In the present invention, further, as a preferred embodiment of the seventeenth primer set, a PCR primer (33 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 33 in the sequence listing on the 3' end side Is a primer consisting of a DNA of the base sequence of SEQ ID NO: 33 as a sense primer, and a PCR primer (34 ') consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 34 in the sequence listing on the 3' end Proposes the primer set which makes an antisense primer the primer which consists of DNA of the base sequence of sequence number 34 as an antisense primer. This primer set can be suitably used for walnut detection, and it is most preferable to use the primer of SEQ ID NO: 33 and the primer of SEQ ID NO: 34 as a set. In addition, the primer of sequence number 67 can be illustrated as a specific example of (33 '), and the primer of sequence number 68 can be illustrated as a specific example of (34').

Tree fruit detection method The tree fruit detection method of the present invention comprises a step of extracting DNA from a sample, a step of performing PCR using this DNA as a template and the primer set of the present invention, and detection of amplified DNA. The sample contains berry fruits (almonds, beech nuts, brazilian nuts, cashews, chestnuts, coconuts, And detecting the presence or absence.

  That is, it is possible to specifically detect the fruit of a tree in a sample by analyzing the nucleic acid of the DNA in the sample by PCR or the like using the PCR primer set for detection of a tree of the present invention. At this time, when detecting almonds, use PCR primer set for detecting almonds as well as beach nuts, brazil nuts, cashew nuts, chestnuts, coconuts, ginkgo, hazelnuts, hickory nuts, lychees, macadamia nuts, pecan nuts, When detecting pine nuts, pyri nuts, pistachios, shea nuts, walnuts, PCR primer set for detecting beach nuts, PCR primer set for detecting Brazil nuts, PCR primer set for detecting cashew nuts, PCR primer set for detecting chestnuts, coconut PCR primer set for detection, PCR primer set for detection of ginkgo, PCR primer set for detection of hazelnut, PCR primer set for detection of hickory nuts, PCR primer set for detection of lychee, PCR for detection of macadamia nut Use primer set, PCR primer set for detecting pecan nuts, PCR primer set for detecting pine nuts, PCR primer set for detecting pyrinut, PCR primer set for detecting pistachio, PCR primer set for detecting shearnut, PCR primer set for detecting walnut Just do it.

  The type of detection method (nucleic acid analysis) is not particularly limited, and any known method can be used as appropriate. For example, the method of PCR amplification using a PCR primer, the method of detecting a PCR amplification product with a probe, etc. can be illustrated.

  As a method of PCR amplification using a PCR primer, a target base sequence in DNA in a sample is selectively amplified using a real detection primer set of the tree of the present invention selected according to the detection purpose, and a PCR amplification product is obtained There is a method of measuring the presence or absence of The confirmation of the presence or absence of the PCR amplification product can usually be carried out by separating the PCR amplification product by agarose gel electrophoresis, and staining the nucleic acid with ethidium bromide, Cybergreen I or the like. When PCR is performed using a real time PCR device, the presence or absence of a PCR amplification product can be automatically confirmed by the detection system of the device. For example, when Cybergreen I is added to a PCR reaction solution, the amount of PCR amplification product dependent on the amount of fluorescence emitted when Cybergreen I binds to double-stranded DNA can be monitored for each cycle. When PCR amplification is observed by the amount of fluorescence, the presence or absence and the size of the amplification product may be confirmed by agarose gel electrophoresis described above.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 is about 515 bp. Detection of an amplification product of that size in agarose electrophoresis indicates that almond is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 is about 75 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that a beach nut is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 is about 91 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that Brazilian nuts are present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 is about 102 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that cashew nuts are present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 is about 293 bp. Detection of an amplification product of the size in agarose electrophoresis indicates that a chestnut is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 11 and the primer of SEQ ID NO: 12 is about 224 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that coconut is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 13 and the primer of SEQ ID NO: 14 is about 186 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that ginkgo is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 15 and the primer of SEQ ID NO: 16 is about 361 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that hazelnut is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 17 and the primer of SEQ ID NO: 18 is about 543 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that hickory nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 19 and the primer of SEQ ID NO: 20 is about 162 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that Lychee is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 21 and the primer of SEQ ID NO: 22 is about 111 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that macadamia nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 23 and the primer of SEQ ID NO: 24 is about 468 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that pecan nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 25 and the primer of SEQ ID NO: 26 is about 139 bp. Detection of an amplification product of that size in agarose electrophoresis indicates that pine nuts were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 27 and the primer of SEQ ID NO: 28 is about 83 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that pyrinut is present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 29 and the primer of SEQ ID NO: 30 is about 163 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that pistachio was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 31 and the primer of SEQ ID NO: 32 is about 518 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that shea nuts are present in the test sample.

  Specifically, the size of the PCR amplification product using the primer of SEQ ID NO: 33 and the primer of SEQ ID NO: 34 is about 501 bp. Detection of an amplification product of that size in agarose gel electrophoresis indicates that a walnut is present in the test sample.

  As a method of detecting a PCR amplification product with a probe, as typified by the Taq Man method, a fluorescent substance labeled probe which hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is degraded after hybridization with the amplification product with a real-time PCR device. In addition, as another method of detecting a PCR amplification product with a probe, Molecular Beacon method, Cycleave PCR method, a method using a hybridization probe, etc. may be mentioned. The PCR primers used in these methods may be any of the real detection PCR primer sets of the tree of the present invention, and the species targeted from the internal base sequence of the PCR amplification product amplified by each PCR primer set A common base sequence region may be separately selected, and a probe based on that region may be used.

  In the method of detecting tree fruits of the present invention, the type of test sample to be targeted is not particularly limited. For example, as a test sample, a food raw material, a processed food, etc. are mentioned. Examples of food ingredients include food ingredients that do not intentionally contain separately produced nuts at food ingredient production plants that handle nuts. Examples of processed food include confectionery, noodles, powdered soup, liquid soup, hot air dried or freeze dried ingredients, and various cooked foods containing these processed food. Another example is a processed food that does not intentionally contain separately produced nuts at food manufacturing plants that handle nuts. In addition, after producing processed foods containing nuts, when producing processed foods without nuts, it is essential to carefully clean food production facilities with the removal of residues of nuts in mind. From the viewpoint of checking the effectiveness of the cleaning method and the presence or absence of the wood residue of the food manufacturing facility, a wiping sample of the manufacturing facility is also mentioned as a test sample.

  In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (notice of the deputy director of the consumer agency, about a test method of a food containing an allergic substance, March 26, 2014, consumption list No. 36) And commercially available DNA extraction kits (eg, Nucleon PhytoPure, plant and fungal DNA extraction kits (GE Healthcare Biosciences Corp., USA), DNA Extraction Isoplant II kits (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen) GmbH, Hilden, Germany), etc.] can be applied to the above detection method as long as the sample is capable of recovering DNA. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from the sample by the above-described DNA extraction method.

Tree Nut Detection Kit The present invention also relates to a tree nut detection kit. The composition of the kit is not particularly limited as long as it comprises at least one set of the above-mentioned real detection PCR primer set of the present invention tree.
Specifically, a PCR primer consisting of a DNA of up to 30 bases containing the nucleotide sequence of nucleotide numbers 9 to 23 in SEQ ID NO: 1 at the 3 'end, and the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 2 are 3' A set with a PCR primer consisting of a maximum of 30 bases of DNA contained at the end side; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base Nos. 7 to 21 in SEQ ID NO: 3 at the 3 'end; With a PCR primer consisting of a DNA of up to 30 bases containing the nucleotide sequence of nucleotide numbers 6 to 20 at the 3 'end; and at most 30 comprising the nucleotide sequence of nucleotide numbers 9 to 23 in SEQ ID NO: 5 at the 3' end A set of a PCR primer consisting of a DNA of bases and a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base Nos. 5 to 19 in SEQ ID NO: 6 at the 3 'end; PCR consisting of DNA of up to 30 bases containing the nucleotide sequence of A set of a primer and a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base Nos. 5 to 19 in SEQ ID NO: 8 at its 3 'end; the base sequence of base Nos. 6 to 20 in SEQ ID NO: 9 is 3' A set of a PCR primer consisting of a DNA of up to 30 bases included at the end side and a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 10 at the 3 'end; And a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of base numbers 4 to 18 at the 3 'end, and a maximum of 30 bases containing the base sequence of base numbers 4 to 18 at SEQ ID NO. A set with a PCR primer consisting of DNA; a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of base Nos. 7 to 21 in SEQ ID NO: 13 at the 3 'end, and the bases of base Nos. 13 to 27 in SEQ ID NO: 14 From a maximum of 30 bases of DNA containing the sequence at the 3 'end PCR primer consisting of a DNA of up to 30 bases including the nucleotide sequence of base Nos. 7 to 21 in SEQ ID NO: 15 at its 3 'end, and the base sequence of nucleotide Nos. 11 to 25 in SEQ ID NO: 16 A set of PCR primers consisting of a maximum of 30 bases of DNA contained on the 3 'end side; a PCR primer consisting of a DNA of up to 30 bases containing on the 3' end side a base sequence of base numbers 6 to 20 in SEQ ID NO: 17 A set of PCR primers consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of nucleotide numbers 9 to 23 at 18 in the 3 'end; containing the nucleotide sequence of nucleotide numbers 7 to 21 in SEQ ID NO 19 at the 3' end A set of a PCR primer consisting of a DNA of up to 30 bases and a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base Nos. 6 to 20 in SEQ ID NO: 20 at the 3 'end; base No. 6 in SEQ ID NO: 21 Maximum containing the sequence of ~ 20 at the 3 'end A set of a PCR primer consisting of a DNA of 30 bases and a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base Nos. 8 to 22 in SEQ ID NO: 22 at the 3 'end; a base in SEQ ID NO: 23 of the sequence listing From a PCR primer consisting of a DNA of up to 30 bases containing the nucleotide sequence of Nos. 4 to 18 at its 3 'end, and a DNA of up to 30 bases containing a nucleotide sequence of bases No. 6 to 20 at SEQ ID NO: 24 at its 3' end A set of PCR primers and a PCR primer consisting of a DNA of up to 30 bases including the nucleotide sequence of nucleotide numbers 5 to 19 in SEQ ID NO: 25 at the 3 'end, and the nucleotide sequence of nucleotide numbers 8 to 22 in SEQ ID NO: 26 A set of PCR primers consisting of a maximum of 30 bases of DNA contained on the 3 'end side; a PCR primer consisting of a DNA of up to 30 bases containing on the 3' end side a base sequence of base numbers 8 to 22 in SEQ ID NO: 27 The base sequence of base numbers 4 to 18 at No. 28 A set with a PCR primer consisting of a maximum of 30 bases of DNA contained on the end side; a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 29 on the 3 'end; A set of PCR primers consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of nucleotide numbers 15 to 29 in the 3 'end on the side; a maximum of 30 comprising the nucleotide sequence of nucleotide numbers 8 to 22 in SEQ ID NO 31 at the 3' end A set of a PCR primer consisting of a DNA of bases and a PCR primer consisting of a DNA of up to 30 bases including the base sequence of base Nos. 4 to 18 in SEQ ID NO: 32 at the 3 'end; base Nos. 6 to 20 in SEQ ID NO: 33 And a PCR primer consisting of a DNA of up to 30 bases containing 3 'of the nucleotide sequence of 3' and a PCR primer consisting of a DNA of up to 30 bases containing 3 'of the nucleotide sequence of bases 6 to 20 in SEQ ID NO: 34 Detection of trees containing more than one set of Tsu door, and the like.

  And preferably, it comprises a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 1 on the 3 'end side, and a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 2 on the 3' end side A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 3 on the 3 'end, and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 4 on the 3' end A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 5 on the 3 'end side; and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 6 on the 3' end side A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 7 at the 3 'end, and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 8 at the 3' end Set with PCR primer; base sequence of SEQ ID NO: 9 to 3 'end side A set of a PCR primer consisting of a DNA of up to 30 bases comprising and a PCR primer consisting of a DNA of up to 30 bases comprising the base sequence of SEQ ID NO: 10 at the 3 'end; a base sequence of SEQ ID NO: 11 towards the 3' end A set of a PCR primer consisting of a DNA of up to 30 bases, and a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 12 at the 3 'end; the base sequence of SEQ ID NO: 13 on the 3' end A set of a PCR primer consisting of a maximum of 30 bases of DNA and a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 14 at the 3 'end; the base sequence of SEQ ID NO: 15 to the 3' end A set of a PCR primer consisting of a DNA of up to 30 bases comprising and a PCR primer consisting of a DNA of up to 30 bases comprising the base sequence of SEQ ID NO: 16 at the 3 'end; a base sequence of SEQ ID NO: 17 towards the 3' end And a PCR primer consisting of a DNA of up to 30 bases, A set of PCR primers consisting of DNA of up to 30 bases containing the base sequence at the 3 'end; PCR primers consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 19 at the 3' end; A set of PCR primers consisting of a DNA of up to 30 bases containing the base sequence at the 3 'end; a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 21 at the 3' end; A set of PCR primers consisting of a maximum of 30 bases of DNA containing the nucleotide sequence on the 3 'end side; a PCR primer consisting of DNA of up to 30 bases containing the nucleotide sequence of SEQ ID NO: 23 in the sequence listing on the 3' end side A set of PCR primers consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of No. 24 at the 3 'end; a PCR primer consisting of DNA of up to 30 bases containing the nucleotide sequence of SEQ ID NO: 25 at the 3' end; P consisting of a maximum of 30 bases of DNA containing the nucleotide sequence of No. 26 at its 3 'end A set with a CR primer; a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 27 at the 3 'end, and a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 28 at the 3' end A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 29 on the 3 'end side, and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 30 on the 3' end side A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 31 on the 3 'end side; and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 32 on the 3' end side A set with a PCR primer; a PCR primer consisting of a DNA of up to 30 bases containing the base sequence of SEQ ID NO: 33 at the 3 'end, and a DNA up to 30 bases containing the base sequence of SEQ ID NO: 34 at the 3' end A tree detection key comprising one or more sets with PCR primers Door and the like.

Among them, particularly preferred is a set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 2;
A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 4; a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 5 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 6 A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 8; a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 9; a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 10 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 11 and a PCR primer consisting of the base sequence of SEQ ID NO: 12; a PCR primer consisting of the base sequence of SEQ ID NO: 13; a PCR primer consisting of SEQ ID NO: 14 A set of a PCR primer consisting of the base sequence of SEQ ID NO: 15 and a PCR primer consisting of the base sequence of SEQ ID NO: 16; a base arrangement of SEQ ID NO: 17 A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 18; a set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 20; A set of a PCR primer consisting of a nucleotide sequence and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 22; A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 23 in the sequence listing and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 24 A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 26; a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 27; a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 28 A set of a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 29 and a PCR primer consisting of the nucleotide sequence of SEQ ID NO: 30; a salt of SEQ ID NO: 31 A set of a PCR primer consisting of a sequence and a PCR primer consisting of the base sequence of SEQ ID NO: 32; One or more sets of a PCR primer consisting of the base sequence SEQ ID NO: 33 and a PCR primer consisting of the base sequence of SEQ ID NO: 34 There is a tree detection kit including
In addition, there may be mentioned a tree detection kit including each primer set described above, a probe for detecting a PCR amplification product amplified by each primer set, and the like.

The kit can contain appropriate reagents, various containers, and the like according to the purpose of use and the like. Specifically, a polymerization reagent for synthesizing a PCR primer extension product, for example, a thermostable DNA polymerase, deoxyribonucleotide, magnesium, a buffer for PCR reaction, and storage capable of appropriately maintaining the quality thereof Containers etc. can be included.

EXAMPLES The present invention will be described in more detail by way of examples, but the present invention is not construed as being limited to these examples. Moreover, it is possible to change suitably, without deviating from the summary of this invention.

Example 1
Confirmation of detection specificity of PCR primer set for detection of fruit of tree against DNA derived from various animals, plants, fungi and bacteria For confirming effectiveness of PCR analysis using PCR primer set for detection of fruit of tree of the present invention In addition, an experiment was conducted to examine the detection specificity of PCR for various organism-derived DNA as follows.

The purified human DNA used was purchased from Cemines (CeMines, LLC, USA).

Purified DNA of cattle, pig, chicken, white shrimp, white crab, cuttlefish, sockeye salmon, and mackerel was crushed with multi-beads shocker (Yasui Kikai, Osaka) after freezing (muscle) meat parts of each sample purchased from the store Prepared from samples using Nucleon PhytoPure, plant and fungal DNA extraction kits (GE Healthcare Biosciences Corp., USA), DNA Extraction Isoplant II kit (Nippon Gene Co. Ltd., Japan), or DNeasy Blood & Tissue kit (Qiagen GmbH, Germany) I used one.

Pepper, Chinese yam, green onion, coconut, date palm, acai, banana, macadamia nut (Australia, Kenya), lotus root, peanut, soybean, almond (US, Spain), peach, prune, plum, plum, plum, apricot, cherry , Apple, loquat, strawberry, pumpkin, pecan nut, walnut (American, French), hazelnut, pyri nut, cashew (Indian, Vietnamese), pistachio (Iranian, American), mango, pink pepper, lychee, Rambutan, cabbage, brazil nuts, shea nuts, miracle fruits, oysters, tea, kiwifruit, blueberries, sesame seeds, potatoes, carrots, ginkgo, pine nuts were purchased from stores, and rice was obtained from domestic growers. These purified DNAs were obtained by washing a portion of each sample (seed, pericarp, leaves, tubers) with 70% ethanol and, after rapid washing with TE buffer, multi-bead shocker (Yasui Instruments, Osaka, Japan) Prepared from genomically disrupted samples using Genomic-tip 20 / G (Qiagen GmbH, Germany), DNeasy plant Mini kits (Qiagen GmbH, Germany), Nucleon PhytoPure, plant and fungal DNA extraction kits, or DNA Extraction Isoplant II kits I used what I did.

  The purified DNA of buckwheat and wheat was prepared from buckwheat flour and wheat flour purchased from a store using Genomic-tip 20 / G.

  The purified corn DNA was purchased from BioChain Institute, Inc., USA.

  The purified DNA of hickory nuts (overta hickory) was prepared from leaves distributed from the University of Tokyo Graduate School of Science and Technology attached botanical garden using DNeasy Plant Mini Kit.

  The purified DNA of chestnut (Japanese chestnut, Chinese gourd, European chestnut) was prepared using the DNeasy Plant Mini Kit from leaves provided by the National Institute of Agriculture and Food Technology Research Institute Fruit Tree Research Institute.

  The purified DNA of chestnut (Chincapine) was prepared from the leaves distributed from the National Forest Research Institute, Tama Forest Science Park using the DNeasy Plant Mini Kit.

  The purified DNAs of beach nuts (beech and canine beech), shii and acorn (silaka) were prepared from leaves obtained from nature using DNeasy Plant Mini Kit.

  The purified DNAs of Pichia anomala (Pichia anomala IFO 0144) and Bacillus cereus (Bacillus cereus ATCC 11950) are cultured in an appropriate medium from the respective cultures, and then the Puregene Yeast and Gram-Positive DNA Isolation kit ( The one prepared using Gentra Systems Inc., USA) was used. All purified DNAs have been subjected to an operation for removing RNA with an RNase.

  Sequence number 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, Respective PCR primers described in 25, 26, 27, 28, 29, 30, 31, 32, 33 and 34 were synthesized by Eurofin Genomics and used in the following PCR.

  After measuring the amounts of various animals, plants, fungi and bacteria DNA prepared as described above, the concentration of DNA was adjusted to 10 ng / μL using sterile water. A 20 μL reaction solution containing 5 μL of the prepared DNA sample solution was prepared using SYBR Premix Ex Taq (Tli RNase H Plus) (Takara Bio Inc., Japan) manufactured by Takara Bio Inc. This reagent contains TaKaRa Ex Taq HS (hot start type), dNTP Mixture, Mg 2+ and SYBR Green I in solution. The reaction solution was prepared as a composition based on SYBR Premix ExTaq and containing 250 nM sense primer and 250 nM antisense primer. The PCR reaction is performed on a LightCycler (Roche Diagnostics GmbH, Germany), and amplification reaction conditions are as follows.

  After one cycle at 95 ° C for 1 minute, the temperature is raised to 95 ° C at a rate of 20 ° C / sec, kept at the same temperature for 5 seconds, and then lowered to 68 ° C at a rate of 20 ° C / sec, 10 The amplification cycle was carried out 35 times consisting of three steps of incubating at the same temperature for 2 seconds, and further raising the temperature to 72 ° C. at a rate of 10 ° C./sec, followed by incubating at the same temperature for 30 seconds. The PCR amplification products were recorded as SYBR Green I-dependent fluorescence at the final step of each cycle. If amplification is confirmed from the amount of fluorescence, separate the PCR amplification product (5 μL of the reaction solution) by 2% (wt / vol) agarose gel electrophoresis, and use Gel Doc ez EZ (Bio Rad) to separate the amplification product. The presence of amplification product was confirmed by visualization. One MARK 100 (GeneDireX) was used as a molecular weight marker. When the amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are described in Table 1. In the table, + (plus) indicates that the PCR reaction is positive, and-(minus) indicates that the PCR reaction is negative.

  When using a PCR primer for detecting almond (a PCR primer set consisting of SEQ ID NOs: 1 and 2), an amplification product of around 515 bp was confirmed only when using almond (American, Spanish) DNA and it was judged positive. (table 1). It was negative when the closely related species peach DNA, prune DNA, plum DNA, plum DNA, apricot DNA, cherry DNA, and other species DNA including other plants were used (Table 1).

  Moreover, when the PCR primer for beach nut detection (PCR primer set consisting of SEQ ID NOs: 3 and 4) is used, an amplification product of around 75 bp is confirmed only when using beach nut (beech, canine beech) DNA, and it is judged positive. It was done (Table 1). Related species of chestnut (Japanese chestnut, Chinese chestnut, black gourd, chinkapin) DNA, chii DNA, acorn (silaka) DNA, pecan nut DNA, hickory nut DNA, walnut (American, French origin) DNA, hazelnut DNA, It was negative when other species DNA including other plants were used (Table 1).

  Moreover, when the PCR primer for detecting Brazil nut (PCR primer set consisting of SEQ ID NOs: 5 and 6) was used, an amplification product of around 91 bp was confirmed only when using Brazil nut DNA, and it was judged as positive (Table 1) ). It was negative when using the related species of shea nut DNA, miracle fruit DNA, oyster DNA, tea DNA, kiwifruit DNA, blueberry DNA, and other species DNA including other plants (Table 1). ).

  In addition, when a cashew nut detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 7 and 8) is used, an amplification product of about 102 bp is confirmed only when cashew nut (Indian, Vietnamese) DNA is used, and it is judged positive. It was done (Table 1). It was negative when the closely related species pistachio (from Iran and American) DNA, mango DNA, pink pepper DNA, and other species DNA including other plants were used (Table 1).

  Also, when using a PCR primer for detection of chestnut (a PCR primer set consisting of SEQ ID NOs: 9 and 10), an amplification product of around 293 bp is confirmed only when using chestnut (Japanese chestnut, Chinese gourd, European chestnut, chincapin) DNA. , Was determined to be positive (Table 1). Related species include beach nut (beech and dog beech) DNA, chii DNA, acorn (silaka) DNA, pecan nut DNA, hickory nut DNA, walnut (American and French) DNA, hazelnut DNA and other plants When other species DNA was used, it was negative (Table 1).

  When a coconut detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 11 and 12) was used, an amplification product of around 224 bp was confirmed only when coconut DNA was used, and it was judged as positive (Table 1). It was negative when the closely related species of date palm DNA, acai DNA, and other species DNA including other plants were used (Table 1).

  In addition, when using a PCR primer for detecting ginkgo (a PCR primer set consisting of SEQ ID NOs: 13 and 14), an amplification product of around 186 bp was confirmed only when using ginkgo DNA, and it was judged as positive (Table 1). It was negative when other species DNA including other plants were used (Table 1).

  When a hazelnut detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 15 and 16) was used, an amplification product of around 361 bp was confirmed only when hazelnut DNA was used, and it was judged as positive (Table 1). Related species pecan nut DNA, hickory nut DNA, walnut (American-made, French-made) DNA, chestnut (Japanese chestnut, Chinese gourd, European gourd, chincapin) DNA, beach nut (beech, inubuna) DNA, cyii DNA, acorn It was negative when (silaka) DNA and other species DNAs including other plants were used (Table 1).

  Moreover, when PCR primers for detecting hickory nuts (PCR primer set consisting of SEQ ID NOS: 17 and 18) are used, amplification products of around 543 bp are confirmed only when using hickory nuts (overtahickory) DNA and pecan nut DNA , Was determined to be positive (Table 1). Walnut (American origin, France origin) DNA, chestnut (Japanese chestnut, Chinese gourd, European grit, chinkapin) DNA, beach nut (beech, canine beech) DNA, hazelnut DNA, shii DNA, acorn (silake) DNA It was negative when using other species DNA including other plants (Table 1).

  When a litchi detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 19 and 20) was used, an amplification product of about 162 bp was confirmed only when litchi DNA was used, and it was judged as positive (Table 1). It was negative when the closely related species, rambutan DNA, or other species DNA including other plants was used (Table 1).

  Moreover, when using a PCR primer for detection of macadamia nut (a PCR primer set consisting of SEQ ID NOs: 21 and 22), an amplification product of around 111 bp is confirmed only when macadamia nut (Australia, Kenya) DNA is used, and positive It was determined that (Table 1). It was negative when the closely related species, lotus root DNA, and other species DNA including other plants were used (Table 1).

  In addition, when a pecan nut detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 23 and 24) was used, an amplification product of around 468 bp was confirmed only when using pecan nut DNA, and it was judged positive (Table 1) ). Related species Hickory nut (over Ta Hickory) DNA, walnut (American origin, French origin) DNA, chestnut (Japanese chestnut, Chinese gourd, European gourd, chinkapin) DNA, beach nut (beech, inubuna) DNA, hazelnut DNA, It was negative when using the DNA of a species, DNA of acorn (silaka), and other species of species including other plants (Table 1).

  In addition, when a pine seed detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 25 and 26) was used, an amplification product of around 139 bp was confirmed only when a pine seed DNA was used, and it was judged positive ( table 1). It was negative when other species DNA including other plants were used (Table 1).

  In addition, when a pyri nut detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 27 and 28) was used, an amplification product of around 83 bp was confirmed only when pyri nut DNA was used, and it was judged as positive (Table 1). Cashew nut (Indian, Vietnamese) DNA, pistachio (Iranian, American) DNA, mango DNA, pink pepper DNA, lychee DNA, rambutan DNA, orange DNA, and other plants including other plants that are closely related species It was negative when species DNA was used (Table 1).

  In addition, when using a pistathio detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 29 and 30), an amplification product of around 163 bp is confirmed only when pistachio (from Iran, from USA) DNA is used, and it is judged positive. It was done (Table 1). It was negative when the closely related species cashew nut (Indian, Vietnamese) DNA, mango DNA, pink pepper DNA, and other species DNA including other plants were used (Table 1).

  Moreover, when the PCR primer for shear nut detection (PCR primer set consisting of SEQ ID NOs: 31 and 32) was used, an amplification product of around 518 bp was confirmed only when shear DNA was used (Table 1). It was negative when the relative species miracle fruit DNA, brazil nut DNA, oyster DNA, tea DNA, kiwifruit DNA, blueberry DNA and other species DNA including other plants were used ( table 1).

  Also, when using a PCR primer for detecting walnut (a PCR primer set consisting of SEQ ID NOS: 33 and 34), an amplification product of about 501 bp is confirmed only when using walnut (American, French) DNA and is judged as positive. It was done (Table 1). Peanut nut DNA, hickory nut (overhead hickory) DNA, chestnut (Japanese chestnut, Chinese gourd, blackcurrant, chincapine) DNA, beach nut (beech, canine beech) DNA, hazelnut DNA, sweet potato DNA, acorn (silaka) 2.) It was negative when DNA and other species DNA including other plants were used (Table 1).

Example 2
Confirmation of detection sensitivity of PCR using PCR primer set for detection of tree fruit In order to investigate detection sensitivity of PCR using the PCR primer set for detection of tree fruit used in Example 1, the following experiment was performed. Almonds (American), Beech Nuts (Beech), Brazil Nuts, Cashew Nuts (Indian), Chestnuts (Chukokuguri), Coconut, Hazelnuts, Ginkgo, Lychee, Macadamia Nuts (Australia), Pecan Nuts Prepared in Example 1 Dilute the DNA of pine nuts, pyri nuts, pistachios (American), shea nuts, and walnuts (American) with sterile water, 1 fg / μl, 10 fg / μl, 100 fg / μl, 1 pg / μl A dilution series of 10 pg / μl and 100 pg / μl DNA solutions was prepared, and 1 μL of these diluted test DNA solutions was subjected to PCR under the PCR reaction conditions described in Example 1. After the PCR reaction, the presence or absence of the amplification product was confirmed by agarose gel electrophoresis.

  As shown in FIG. 1, the detection sensitivity when using a PCR primer for detecting almond (a PCR primer set consisting of SEQ ID NOS: 1 and 2) is 100 fg DNA / analysis, and a PCR primer for detecting beach nuts (SEQ ID NO: The detection sensitivity when using a PCR primer set consisting of 3 and 4) is 10 fg DNA / analysis, and the detection sensitivity using a PCR primer for detecting Brazil nut (a PCR primer set consisting of SEQ ID NOs: 5 and 6) The sensitivity is 100 fg DNA / analysis, and the detection sensitivity when using a PCR primer for detecting cashew nut (a PCR primer set consisting of SEQ ID NOs: 7 and 8) is 1 pg DNA / analysis, and the PCR primer for chestnut detection The detection sensitivity when using (a PCR primer set consisting of SEQ ID NOs: 9 and 10) is 1 pg DNA / analysis, and a PCR primer for detecting coconut (PC consisting of SEQ ID NOs: 11 and 12) The detection sensitivity when using R primer set is 100 pg DNA / analysis, and the detection sensitivity when using a PCR primer for detecting silver globule (PCR primer set consisting of SEQ ID NOs: 13 and 14) is 100 fg DNA Detection sensitivity when using a PCR primer for detection of hazelnut (a PCR primer set consisting of SEQ ID NOs: 15 and 16) is 100 fg DNA / analysis, and a PCR primer for detecting hickory nuts (SEQ ID NO: 17 and The detection sensitivity when using 18 PCR primer sets is 100 fg DNA / analysis, and the detection sensitivity when using litchi detection PCR primers (PCR primer sets consisting of SEQ ID NOs: 19 and 20) is The detection sensitivity is 100 fg DNA / analysis when using 100 fg DNA / analysis and a PCR primer for detecting macadamia nut (a PCR primer set consisting of SEQ ID NOs: 21 and 22). The detection sensitivity when using a PCR primer for detecting pecan nut (PCR primer set consisting of SEQ ID NOS: 23 and 24) is 10 fg DNA / analysis, and a PCR primer for detecting pine real (SEQ ID NOS: 25 and 26) The detection sensitivity when using a PCR primer set consisting of 100 fg DNA / analysis is used, and the detection sensitivity when using a PCR primer for detecting pyrinut (a PCR primer set consisting of SEQ ID NOs: 27 and 28) is 100 Detection sensitivity when using fg DNA / analysis and PCR primers for pistachio detection (a PCR primer set consisting of SEQ ID NOs: 29 and 30) is 100 fg DNA / analysis and a PCR primer for shea nut detection (SEQ ID NO: 31) The detection sensitivity is 10 fg DNA / analysis, and the PCR primer set consisting of SEQ ID NOs: 33 and 34 has a detection sensitivity of 10 fg DNA / analysis. The detection sensitivity was 1 fg DNA / analytical when using

Example 3
Detection of DNA derived from fruit of trees in fruit containing foods by means of PCR using a PCR primer set for detecting fruit of trees The PCR analysis using a PCR primer set for detection of fruit of trees of the present invention is as follows. The practicality of the present invention was examined.

  The commercial food (Table 2) which specified that it contains various nuts as a raw material (Table 2) was prepared, and 10-100 g was grind | pulverized by multi-bead shocker. Each DNA was extracted from 2 g of the mixed disrupted substance using Genomic-tip 20 / G kit. At the time of extraction, an operation of removing RNA with a RNase was also performed. After measuring the amount of food sample DNA extracted, the concentration of food sample DNA was adjusted to 10 ng / μL using sterile water. In addition, since it was difficult to obtain commercial foods containing beach nuts, hickory nuts, and shea nuts as raw materials, 10 pg of each DNA was prepared as a coconut sample (Nisshin Cisco) DNA solution (10 ng / μL) as a substitute sample. The one added at a concentration of / μL was used. Using 5 μl of the PCR primer set for detection of wood used in Example 1, 5 μL of the prepared DNA solution was subjected to PCR under the PCR reaction conditions described in Example 1. If amplification is confirmed from the amount of fluorescence, separate the PCR amplification product (5 μL of the reaction solution) by 2% (wt / vol) agarose gel electrophoresis, and use Gel Doc ez EZ (Bio Rad) to separate the amplification product. The presence of amplification product was confirmed by visualization. One MARK 100 (GeneDireX) was used as a molecular weight marker. When the amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are described in Table 2. In the table, + (plus) indicates that the PCR reaction is positive, and-(minus) indicates that the PCR reaction is negative. Furthermore, PCR amplification products amplified from food sample DNA are sequenced directly by Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems) after direct sequencing from both directions using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems) Was analyzed. The analyzed nucleotide sequence data is compared and analyzed with the GenBank nucleotide sequence database (BLAST search) or the DNA database owned by the inventors, and the species of DNA derived from the PCR amplification product is assigned based on the similarity of the nucleotide sequence. Identified.

  As a result, when using the PCR primer for detecting almond (PCR primer set consisting of SEQ ID NOs: 1 and 2), DNA derived from realatine muesli (Dorset cereal) and petit chocolate leaf pie (El Madron), which are almond-containing foods The amplification product around 515 bp was confirmed only in and was judged as positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequences of the PCR amplification products amplified from DNAs derived from realiment muesli (Dorset cereal) and Petit Chocolate leaf pie (El Madron) coincide with the ITS base sequences of almond. did. That is, although PCR using the PCR primers does not detect almond-derived DNA or other DNA from almond-free food samples in a plurality of commercial food products, it can specifically detect almond-derived DNA from almond-containing food samples. confirmed.

  In addition, when a PCR primer for detecting beach nuts (PCR primer set consisting of SEQ ID NOs: 3 and 4) is used, it is derived from a beach nut-containing food substitute sample [Coconutable (50 ng of beach nut DNA added (Nisshin Cisco))] Only in DNA, amplification products around 75 bp were confirmed and judged as positive. It was negative when DNA from other food samples was used (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of the beach nut-containing food matched the ITS base sequence of the beach nut. That is, PCR using the PCR primer does not detect beach nut-derived DNA or other DNA from beach nut-free food samples in a plurality of commercial foods, but a small amount of beach added to the beach nut-free food It was confirmed that nut-derived DNA could be specifically detected.

  In addition, when PCR primers for detection of brazil nuts (PCR primer set consisting of SEQ ID NOs: 5 and 6) are used, amplification products of around 91 bp only in DNA derived from realatin muesli (doset cereal), which is a food containing brazil nuts Was confirmed and judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from DNA derived from reality muesli (Doset serial) matched the ITS nucleotide sequence of Brazil nut. That is, although PCR using the PCR primer does not detect brazil nut-derived DNA or other DNA from brazil nut-free food samples in a plurality of commercial foods, it is specific to brazil nut-containing food samples from brazil nut-containing food samples Confirmed that it can be detected.

  In addition, when a PCR primer for detecting cashew nut (a PCR primer set consisting of SEQ ID NOs: 7 and 8) is used, DNA derived from realatin muesli (doset cereal) and triple nut chocolate (merry chocolate kampani), which are cashew nut containing foods The amplification product around 102 bp was confirmed only in and was judged as positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of PCR amplification products, the base sequences of PCR amplification products amplified from DNAs derived from reality muesli (doset cereal) and triple nut chocolate (merry chocolate kampani) match the ITS base sequences of cashew nuts. did. That is, PCR using the PCR primers does not detect cashew nut-derived DNA or other DNA from cashew nut-free food samples in a plurality of commercial food products, but can specifically detect cashew nut-derived DNA from cashew nut-containing food samples. confirmed.

  In addition, when using a PCR primer for detection of chestnut (a PCR primer set consisting of SEQ ID NO: 9 and 10), an amplification product of around 293 bp is confirmed only in the chestnut stem (Yamahisa YK) derived DNA which is a chestnut-containing food , Was determined to be positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the chestnut stem (Yamahisa YK) matched the ITS base sequence of the chestnut. That is, although PCR using the PCR primers does not detect chestnut-derived DNA or other DNA from chestnut-free food samples in a plurality of commercial foods, it is confirmed that chestnut-derived DNA can be specifically detected from the contained food samples did.

  In addition, in the case of using coconut detection PCR primers (PCR primer set consisting of SEQ ID NOs: 11 and 12), it is a DNA containing triple nut chocolate (Merry Chocolate Kampani) and coconut rice (Nisshin Cisco), which are coconut-containing foods. Only the amplified product around 224 bp was confirmed and judged as positive. It was negative when DNA from other food samples was used (Table 2). As a result of nucleotide sequence analysis of PCR amplification products, the nucleotide sequences of PCR amplification products amplified from DNA derived from triple nut chocolate (Merry Chocolate Kampani) and coconut sablet (Nisshin Cisco) matched the ITS nucleotide sequences of coconut. . That is, although PCR using the PCR primers does not detect coconut-derived DNA or other DNA from coconut-free food samples in a plurality of commercial foods, it can specifically detect coconut-derived DNA from coconut-containing food samples. confirmed.

  In addition, when a PCR primer for detecting ginkgo (a PCR primer set consisting of SEQ ID NOs: 13 and 14) is used, an amplification product of around 186 bp is confirmed only in a ginna-containing food, Ginnan sheep (Yamagishi Motors) derived DNA , Was determined to be positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Ginnan sheep (Yamushi Motors) matched the chloroplast matK gene sequence of ginkgo. That is, PCR using the PCR primers does not detect ginkgo-derived DNA or other DNA from ginkgo non-containing food samples in a plurality of commercial food products, but can specifically detect ginkgo-derived DNA from ginkgo-containing food samples confirmed.

  In addition, when using a PCR primer for detection of hazelnut (a PCR primer set consisting of SEQ ID NOs: 15 and 16), an amplification product of around 361 bp is obtained only in DNA derived from reality muesli (doset cereal), which is a hazelnut-containing food. It was confirmed and judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from DNA derived from reality muesli (Doset serial) matched the ITS base sequence of hazelnut. That is, although PCR using the PCR primers does not detect hazelnut-derived DNA or other DNA from hazelnut-free food samples in a plurality of commercial food products, it can specifically detect hazelnut-derived DNA from hazelnut-containing food samples. confirmed.

  When a PCR primer for detecting hickory nuts (a PCR primer set consisting of SEQ ID NOs: 17 and 18) is used, it is derived from a substitute sample of hickory nut-containing food [Coconutable with 50pg hickory nut DNA (Nisshin Cisco)] An amplification product of around 543 bp was confirmed and judged as positive only in triple-nut chocolate (Merry Chocolate Kampani), which is a food containing DNA and pecan nuts. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of hickory nut-containing food and the DNA derived from triple nut chocolate (Merry Chocolate Kampani) is the ITS base sequence of hickory nut Matched with. That is, although PCR using the PCR primers does not detect hickory-derived DNA or other DNA from hickory nut-free food samples in a plurality of commercial food products, it can be used in pecan nut-containing food samples and hickory nut-free foods. It was confirmed that a trace amount of added hickory nut-derived DNA could be specifically detected.

  Moreover, when the PCR primer for lychee detection (PCR primer set consisting of SEQ ID NOs: 19 and 20) is used, an amplification product of around 162 bp is confirmed only in DNA derived from fruit therapy white peach (Fusicco) which is a lychee-containing food And was judged positive. It was negative when DNA from other food samples was used (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from fruit therapy white peach (Fusicco) matched the ITS base sequence of lychee. That is, PCR using the PCR primers does not detect lychee-derived DNA or other DNA from lychee non-containing food samples in a plurality of commercial food products, but can specifically detect lychee-derived DNA from lychee-containing food samples confirmed.

  In addition, when using a PCR primer for detection of macadamia nut (a PCR primer set consisting of SEQ ID NOs: 21 and 22), an amplification product of about 111 bp only in the DNA derived from petit chocolate leaf pie (El Madron) which is a macadamia nut-containing food Was confirmed and judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the petite chocolate leaf pie (L. madron) -derived DNA matched the ITS base sequence of macadamia nut. That is, although PCR using the PCR primers does not detect macadamia nut-derived DNA or other DNA from macadamia nut-free food samples in a plurality of commercial food products, it is specific to macadamia nut-derived DNA from macadamia nut-containing food samples. Confirmed that it can be detected.

  In addition, when a PCR primer for detecting pecan nut (a PCR primer set consisting of SEQ ID NOs: 23 and 24) is used, an amplification product of around 468 bp is obtained only in triple nut chocolate (merry chocolate kampani) which is a pecan nut-containing food. It was confirmed and judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the triple nut chocolate (Merry Chocolate Kampani) -derived DNA matched the ITS nucleotide sequence of pecan nut. That is, although PCR using the PCR primers does not detect pecan nut-derived DNA or other DNA from pecan nut-free food samples in a plurality of commercial food products, it is specific to pecan nut-derived DNA from pecan nut-containing food samples Confirmed that it can be detected.

  In addition, when using PCR primers for detection of pine nuts (a PCR primer set consisting of SEQ ID NOs: 25 and 26), only a mixture of spaghetti sauce basil (Esby's food), which is a pine nut-containing food, is around 139 bp. The amplified product of was confirmed and judged as positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from spaghetti source basil (SB Foods) only mixed matched the ITS base sequence of pine nuts. That is, although PCR using the PCR primers does not detect pine nut-derived DNA or other DNA from a pine nut-free food sample in a plurality of commercial food products, it does not detect pine nut-containing food samples. It was confirmed that DNA could be specifically detected.

  In addition, when PCR primers for detection of pyri nut (PCR primer set consisting of SEQ ID NOs: 27 and 28) are used, amplification products around 83 bp are confirmed only in LA2 PU CRISPY PILINUT with Garlic (Royal Konzern), which is a pyri nut-containing food And was judged positive. It was negative when DNA from other food samples was used (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from LA2 PU CRISPY PILINUT with Garlic (Royal Konzern) matched the ITS base sequence of pyrinut. That is, PCR using the PCR primer does not detect pyrinut-derived DNA or other DNA from pyri-nut-free food samples in a plurality of commercial food products, but can specifically detect pyrinut-derived DNA from pyrinut-containing food samples confirmed.

  In addition, when using a pistathio detection PCR primer (a PCR primer set consisting of SEQ ID NOs: 29 and 30), an amplification product of around 163 bp is confirmed only in petit chocolate leaf pie (El Madron) derived DNA which is a pistathio-containing food And was judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the petite chocolate leaf pie (L. madron) -derived DNA matched the ITS base sequence of pistachio. That is, although PCR using the PCR primer does not detect pistachio-derived DNA or other DNA from pistachio-free food samples in a plurality of commercial food products, it can specifically detect pistathio-derived DNA from pistachio-containing food samples. confirmed.

  In addition, when using a PCR primer for detecting shearnut (PCR primer set consisting of SEQ ID NOs: 31 and 32), it is only for DNA derived from a substitute sample of a shea nut-containing food [Coconuts rice (Nisshin Cisco) supplemented with 50pg shearnut DNA] An amplification product of around 518 bp was confirmed and judged as positive. It was negative when DNA from other food samples was used (Table 2). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from the alternative sample of the shea nut-containing food matched the ITS base sequence of the shea nut. That is, PCR using the PCR primer does not detect shea nut DNA or other DNA from a shea nut non-containing food sample in a plurality of commercial food products, but a small amount of shea nut DNA added to a shea nut non-food food It confirmed that it could detect specifically.

  In addition, when using a PCR primer for detecting walnut (a PCR primer set consisting of SEQ ID NOs: 33 and 34), an amplification product of around 501 bp is confirmed only in DNA derived from azuki-kilnut danish (a bread made by Shikishima), which is a walnut-containing food. And was judged positive. It was negative when DNA from other food samples was used (Table 2). In addition, as a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the DNA derived from Azuki crunch danish (Bunki bread) was in agreement with the ITS base sequence of walnut. That is, PCR using the PCR primer does not detect walnut-derived DNA or other DNA from walnut-free food samples in a plurality of commercial food products, but can specifically detect walnut-derived DNA from walnut-containing food samples. confirmed.

Claims (2)

  A PCR primer consisting of a DNA of up to 30 bases containing at its 3 'end the base sequence of base Nos. 7 to 21 in SEQ ID NO: 13 in the sequence listing, and the base sequence of base Nos. 13 to 27 in SEQ ID NO: A primer set comprising a PCR primer consisting of DNA of up to 30 bases contained at the 'end side   Is a step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and the primer set according to claim 1, and whether ginkgo is present in the sample by detecting amplified DNA And detecting the presence or absence of ginkgo.

Images