JP6612656B2 - Spice detection primer - Google Patents

Description

Distinguishing plant species used as spices (pepper, pepper, garlic, ginger, turmeric, salamander, citrus, mustard) from other plant species and biological species, even in samples such as foods mixed with various raw materials, The present invention relates to a PCR primer set that can specifically and highly sensitively detect contained spices.

A spice is a group of plants having fragrance and irritation used for cooking food.
There are a wide variety of plant species called spices, such as mulberry, celery, ginger, perilla, mandarin, pepper, cruciferous, eggplant, chrysanthemum, and lily. There are various seeds, flowers, leaves, bark, etc. The part is used. Examples of spices that have a large production and distribution volume are wasabi, mustard, garlic, pepper, pepper, ginger, turmeric and the like. Used in various foods alone or as a mixture.

Among the spices, it is known that mustard, ginger, and turmeric cause food allergy, and pepper, pepper, and the like show cases of hypersensitivity.
Consumers with these symptoms must avoid these spices, but in processed foods in Japan, even if multiple spices are used, if the ratio of the weight to the raw material is 2% or less, It can be described collectively as “spicy” and “spicy extract”, and only the producer can know which spice is used in the food. In addition, unintentional contamination and differences in the composition of these spices can also reduce the quality of products even in processed food producers, and test methods that can individually detect the plant species used as spices. Need to be established.

  As a method for detecting a plant species of a spice, an ELISA method for detecting a specific protein derived from the plant species and a PCR method for detecting a specific DNA sequence derived from the plant species are used. In general, proteins are less stable to various processings in the food production process than DNA, and therefore the method for detecting proteins is likely not applicable to highly processed test foods. Therefore, it is considered that the PCR method targeting a DNA base sequence, which is considered to be relatively stronger in processing than protein, is suitable for detection from food materials and products that have undergone various processing steps.

In fact, as a method for detecting plant species used in spices, a method by PCR has been reported (Non-patent Document 1). The PCR primers described therein can detect 18 kinds of spices such as allspice, cardamom, clove, etc., but garlic, turmeric, salamander and citrus used in Japan are not tested.

In the above document, pepper, pepper, ginger and mustard are targeted for detection, but all are test methods that perform whole genome amplification by the multiple displacement amplification (MDA) method before the PCR reaction. Take it. In addition, in the verification of the cross-reactivity of the PCR primers used in this method, that is, the detection specificity, various spices are used as samples, but there is no description for other edible plants, and it is closely related that verification is necessary. No verification has been shown for plants. Furthermore, there is no description that the target spice DNA can be specifically detected in a sample containing a plurality of animals and plants such as food. Therefore, the method for specifically detecting the target spice DNA in a food containing a plurality of animals and plants is not a well-validated method.

As mentioned above, no clear detection method for plant species used as spices (pepper, pepper, garlic, ginger, turmeric, salamander, citrus, mustard) has been reported, and these specific plants are used as food ingredients. There is a long-awaited method for quality control of foods that can be scientifically verified as to whether or not it is mixed in products.

Ferix Focke, Ilka Haase, and Markus Fischer DNA-Based Identification of Spices: DNA Isolation, Whole Genome Amplification, and Polymerase Chain Reacton; Journal of agiricultual and food chemistry, 59: 513-520, 2011

Distinguishing plant species used as spices (pepper, pepper, garlic, ginger, turmeric, salamander, citrus, mustard) from other plant species and biological species, even in samples such as foods mixed with various raw materials, Provided is a means capable of specifically and highly sensitively detecting contained spices.

  In order to achieve the above-mentioned problems, the present inventors, from a molecular biological point of view, the spices to be detected (pepper, pepper, garlic, ginger, turmeric, salamander, citrus, mustard) and other organisms Focusing on the commonality and specificity in gene sequences, we have intensively studied methods that can detect pepper, pepper, garlic, ginger, turmeric, salamander, citrus fruits, and mustard with high sensitivity. As a result, we found unique base sequences for each, and by using these base sequences to perform nucleic acid analysis such as PCR, pepper, capsicum, garlic, ginger, turmeric, salmon, citrus fruits, mustard, respectively It has been found that the detection can be easily performed, and further earnest studies have been made, and the present invention has been completed. That is, the present invention relates to the following PCR primer set for detecting spices.

Item 1. The PCR primer set according to any one of (1) to (18) below.
(1) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 at the 3 ′ end in SEQ ID NO: 1 in the sequence listing;
A PCR primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 on the 3 ′ end side in SEQ ID NO: 2 in the sequence listing.
(2) a PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 12 to 26 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 4 in the sequence listing.
(3) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11-25 in SEQ ID NO: 5 of the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 13 to 27 in SEQ ID NO: 6 in the sequence listing on the 3 ′ end side.
(4) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.
(5) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in SEQ ID NO: 9 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 4-18 in the sequence listing, SEQ ID NO: 10 on the 3 ′ end side
(6) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 9 to 23 in the sequence listing in SEQ ID NO: 11 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases comprising the base sequence of base numbers 11 to 25 in the sequence listing in the sequence listing on the 3 ′ end side.
(7) a PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of base numbers 4-18 in SEQ ID NO: 13 of the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 24 on the 3 ′ end side in SEQ ID NO: 14 in the sequence listing
(8) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in sequence number 15 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 9 to 23 in the sequence listing at the 3 ′ end side
(9) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 22 on the 3 ′ end side in SEQ ID NO: 17 in the sequence listing;
A PCR primer set consisting of a PCR primer consisting of DNA consisting of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 18 in the sequence listing.
(10) a PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side of the sequence listing
(11) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side of the sequence listing
(12) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 6 on the 3 ′ end side of the sequence listing
(13) a PCR primer composed of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 8 on the 3 ′ end side of the sequence listing
(14) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side;
PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side;
Primer set consisting of
(15) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 ′ end side
(16) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 on the 3 ′ end side of the sequence listing
(17) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 16 on the 3 ′ end side of the sequence listing
(18) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3 ′ end side

Item 2. The primer set according to (1) of claim 1.

Item 3. The primer set according to (2) of claim 1.

Item 4. The primer set according to (1) of claim 1.

Item 5. The primer set according to (1) of claim 1.

Item 6. The primer set according to (5) of claim 1.

Item 7. The primer set according to (1) of claim 1.

Item 8. The primer set according to (7) of claim 1.

Item 9. The primer set according to (1) of claim 1.

Item 10. The primer set according to (9) of claim 1.

Item 11. The primer set according to (10) of claim 1.

Item 12. The primer set according to (11) of claim 1.

Item 13. The primer set according to (12) of claim 1.

Item 14. The primer set according to (13) of claim 1.

Item 15. The primer set according to (14) of claim 1.

Item 16. The primer set according to (15) of claim 1.

Item 17. The primer set according to (16) of claim 1.

Item 18. The primer set according to (17) of Item 1.

Item 19. The primer set according to (18) of Item 1.

According to the present invention, DNA derived from plant species (pepper, pepper, garlic, ginger, turmeric, salmon, citrus, mustard) used as a spice can be obtained with high accuracy and high sensitivity by nucleic acid analysis using PCR or the like. It is possible to detect the above, and it is possible to carry out a quality control inspection such as whether or not the above-mentioned spices are mixed or used in the test food raw material or test food.

It is the photograph after the electrophoresis which showed the detection sensitivity of DNA at the time of using the primer set in this invention. (A) A photograph after electrophoresis showing the detection sensitivity of pepper DNA in PCR using SEQ ID NO: 1 and SEQ ID NO: 2. (B) Photograph after electrophoresis showing the detection sensitivity of red pepper DNA in PCR using SEQ ID NO: 3 and SEQ ID NO: 4. (C) Photograph after electrophoresis showing the detection sensitivity of garlic DNA in PCR using SEQ ID NO: 5 and SEQ ID NO: 6. (D) A photograph after electrophoresis showing the detection sensitivity of ginger DNA in PCR using SEQ ID NO: 7 and SEQ ID NO: 8. (E) A photograph after electrophoresis showing the detection sensitivity of turmeric DNA in PCR using SEQ ID NO: 9 and SEQ ID NO: 10. (F) A photograph after electrophoresis showing the detection sensitivity of salamander DNA in PCR using SEQ ID NO: 11 and SEQ ID NO: 12. (G) A photograph after electrophoresis showing the detection sensitivity of orange DNA in PCR using SEQ ID NO: 13 and SEQ ID NO: 14. (H) A photograph after electrophoresis showing the detection sensitivity of yellow mustard DNA in PCR using SEQ ID NO: 15 and SEQ ID NO: 16. (I) A photograph after electrophoresis showing the detection sensitivity of brown mustard DNA in PCR using SEQ ID NO: 17 and SEQ ID NO: 18.

Hereinafter, the present invention will be described in detail.
Spice detection PCR primer sets The present inventors have developed the following nine spice detection PCR primer sets in accordance with the above-mentioned purpose. The PCR primer set for detecting spices of the present invention includes those having a base sequence characteristic of pepper, those having a base sequence characteristic of pepper, those having a base sequence characteristic of garlic, characteristic of ginger Those having a base sequence, those having a base sequence characteristic of turmeric, those having a base sequence characteristic of salamander, those having a base sequence characteristic of citrus, bases characteristic of mustard (yellow mustard) Some have a sequence, others have a base sequence characteristic of mustard (Brown mustard).

  Each primer set was designed as follows. The target nucleotide sequence is preferably one that has a large number of copies per cell from the viewpoint of improving sensitivity. The chloroplast rbcL (large subunit gene for ribulose-1,5-bisphosphate carboxylase / oxygenase) gene sequence, matk ( maturase-encoding gene) gene sequence, rRNA gene internal transcription spacer region 1 (ITS1) base sequence, and internal transcription spacer region 2 (ITS2) base sequence were selected as candidates. Acquire the sequences of various plants from a known DNA database (GenBank nucleotide sequence database), or obtain some plants by analyzing them independently, and create a multiple parallel sequence diagram of their enormous base sequences did. Among them, the ITS region has a fast evolution rate and can identify more closely related species, and thus is suitable as a target sequence for various spice-specific primers.

  In developing a PCR primer set for detecting pepper, the target species was set to Piper spp., And the nucleotide sequences of the ITS region of pepper and other plants were compared. A base sequence region specific to pepper was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In addition, when developing a PCR primer set for detecting pepper, the target species was set to Capsicum annuum, and pepper and its related species, Solanum eggplant (Solanum) The base sequences of the ITS regions of melongena, potato (Solanum tuberosum), and tomato (Solanum lycopersicum) were compared. A base sequence region specific to red pepper was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In addition, when developing PCR primer sets for garlic detection, we set the target species to the genus Allium sativum, and garlic and its related species, Allium fistulosum, And the base sequence of ITS region of onion (Allium cepa) was compared. A base sequence region specific to garlic was selected, and a PCR primer set was newly designed from the base sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In addition, in developing a PCR primer set for detecting ginger, the target species of detection is set to Ginger family Zingiber officinale, and ginger and its related species Ginger (Zingiber mioga), The base sequences of the ITS region of the turmeric genus Curcuma longa / Curcuma aromatica and the cardamom Elepharia cardamomum were compared. The base sequence of the ITS region is highly homologous to related species, and it was difficult to select a ginger-specific base sequence. A nucleotide sequence region could be selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  Moreover, the plant species used for food as turmeric include turmeric belonging to the genus Turmeric (Curcuma longa) called autumn turmeric and Curcuma aromatica (called Curcuma aromatica) called spring turmeric. The nucleotide sequences of the ITS regions of turmeric and Kyou-o and their closely related species, Zingiber officinale, Zingiber mioga, and Elettaria cardamomum, were compared. A nucleotide sequence region specific to turmeric and kyoto was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  Moreover, in developing PCR primer sets for detecting salamanders, the target species is set to Zanhoxylum sp. And used as salamanders (Zanthoxylum piperitum) and peppers. It was made possible to detect widely, such as Zanthoxylum bungeanum. The base sequence of the ITS region of the genus Citrus genus, such as the genus Salamander, its related species Yuz (Citrus junos), and orange (Citrus sinensis) was compared. A nucleotide sequence region specific to the genus Salamander was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  In developing a PCR primer set for detecting citrus fruits, the target species was set to Citrus sp., And the related species, Zanhoxylum. sp.) ITS region nucleotide sequences were compared. A nucleotide sequence region specific to Citrus genus was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At that time, the base sequence region of the biological species targeted for detection was designed and devised so as to hybridize under stringent conditions but not hybridize with the biological species not targeted for detection.

  Plant species used as mustard include white mustard (Brassica alba) called yellow mustard and brown mustard (Brassica juncea) called oriental mustard. Many mustards are made by mixing these. ing. There are many other edible plants in the Brassicaceae genus Brassica belonging to these, and it was difficult to design PCR primers that specifically detect only two kinds of mustard without detecting them. Therefore, we designed two types of PCR primer sets that detect white pepper and mustard separately. At that time, the mustard is a hybrid of black pepper (Brassica nigra) and Brassica rapa (Brassica rapa var. Perkinensis) and turnip (Brassica rapa var. Glabra), There are many varieties such as Chingensai (Brassica rapa var. Chinensis), and PCR primer set is designed from the base sequence region of black pepper (Brassica nigra) to detect only mustard without detecting them. did. The base sequence of the ITS region is highly homologous to many closely related species, and it was difficult to select each mustard-specific base sequence. A nucleotide sequence region specific to the mustard was selected, and a PCR primer set was newly designed from the nucleotide sequence region. At the time of design, the base sequence region of the organism species targeted for detection hybridizes under stringent conditions, but the ingenuity is designed so that it does not hybridize with species not targeted for detection. did.

  In addition, each primer was designed so as not to cause hybridization between the sense primer and the antisense primer or hybridization by each primer itself, that is, to avoid so-called primer dimer formation as much as possible. .

  Although the base sequence of the primer provided by the present invention has been comprehensively described, a primer that does not have the intended performance (detection specificity, etc.) has been designed even if the primer is theoretically designed successfully. There is a case. For example, in the research stage of the present invention, in the PCR using the brown mustard detection PCR primer set consisting of SEQ ID NO: 37 and SEQ ID NO: 38, the brown mustard DNA is used in spite of using a base sequence peculiar to brown mustard. In addition, DNA of related species such as turnips, Komatsuna and Japanese radish was also detected and did not show the intended detection specificity. In this way, simply designing a primer logically does not necessarily obtain the intended performance (detection specificity, etc.), and may not have the required performance. In addition to logical design, further innovation and performance evaluation tests are important. The primer provided by the present invention is designed by further devising the logical design, and finally the performance evaluation test is cleared.

  Therefore, spices (pepper, pepper, garlic, ginger, turmeric, salmon, citrus fruit, mustard contained in various foods using a nucleic acid analysis technique such as PCR using the PCR primer set for detecting the nuts of the present invention. ) The derived DNA can be detected with high sensitivity and specificity.

Here, nucleic acid analysis refers to the presence or absence of a characteristic base sequence by analyzing the presence or absence of a characteristic base sequence depending on individual species, genus, or group in biological classification. It is an effective means for grasping the species, genus, or group of the organism, and is a method usefully used for detecting a specific microorganism or identifying a species.

The base sequences of the primers provided by the present invention are as follows.
Base number 12345678901234567890123456789
Sequence number 1 (Pepper S) GATGCCCATCGAAACAAGACA
Sequence number 2 (pepper AS) TTCGTCGCTGCCCGACACG
Sequence number 3 (capsicum S) ATTGCAGAATCTCGTGAACCATTGAC
Sequence number 4 (capsicum AS) CAGTATCCGCCCTGTGATGG
Sequence number 5 (garlic S) GATTTCGATGTTTGCTTTCGTAGCA
Sequence number 6 (garlic AS) TCGAGTTAACGCACGATGTCTCTAATC
Sequence number 7 (ginger S) GGTAAAAGTCGGCAGTCGCG
Sequence number 8 (ginger AS) CGCAGGGTCTCTTGAGGAATTCAG
Sequence number 9 (turmeric S) CATAGAATGATGGATGATTGTGAAC
Sequence number 10 (turmeric AS) ACCAACATGGGCGGGCTG
Sequence number 11 (Sauna S) GCAGAACGACCCGTGAACTTGTG
Sequence number 12 (Sunshade AS) CGTTGCCGAGAGTCGTTATAGATAG
Sequence number 13 (citrus S) GGGCGCTCCTCCTTCCCG
Sequence number 14 (citrus AS) GTTGCCGAGAGTCGTTTTGGATAC
Sequence number 15 (yellow mustard S) AGTGTCAAGGAACATTCAACTAGGT
Sequence number 16 (yellow mustard AS) GACCGACAATATGACGAGGTTAC
Sequence number 17 (Brown mustard S) CCCCGGTTCAAGACTTACTTAG
Sequence number 18 (Brown mustard AS) CGACCGACGATATTACGAGGC
Moreover, as a primer which consists of DNA of 30 bases which this invention provides, the thing of the following base sequences can be raised, for example.
Sequence number 19 (pepper S) cgacccgatGATGCCCATCGAAACAAGACA
Sequence number 20 (pepper AS) gacgaacgcacTTCGTCGCTGCCCGACACG
Sequence number 21 (capsicum S) ggtcATTGCAGAATCTCGTGAACCATTGAC
Sequence number 22 (capsicum AS) cggacgaggtCAGTATCCGCCCTGTGATGG
Sequence number 23 (garlic S) acggcaGATTTCGATGTTTGCTTTCGTAGCA
Sequence number 24 (garlic AS) tgtTCGAGTTAACGCACGATGTCTCTAATC
Sequence number 25 (ginger S) cgacggtcggGGTAAAAGTCGGCAGTCGCG
Sequence number 26 (ginger AS) ggtcgcCGCAGGGTCTCTTGAGGAATTCAG
Sequence number 27 (turmeric S) caactCATAGAATGATGGATGATTGTGAAC
Sequence number 28 (turmeric AS) gcaagaacccagACCAACATGGGCGGGCTG
Sequence number 29 (Sauna S) accccggGCAGAACGACCCGTGAACTTGTG
SEQ ID NO: 30 (Sauna AS) gggagCGTTGCCGAGAGTCGTTATAGATAG
Sequence number 31 (citrus S) atcatgccaagcGGGCGCTCCTCCTTCCCG
Sequence number 32 (citrus AS) ccgatgGTTGCCGAGAGTCGTTTTGGATAC
Sequence number 33 (yellow mustard S) gctccAGTGTCAAGGAACATTCAACTAGGT
Sequence number 34 (yellow mustard AS) aatgccaGACCGACAATATGACGAGGTTAC
Sequence number 35 (Brown mustard S) acggcgtgCCCCGGTTCAAGACTTACTTAG
Sequence number 36 (Brown mustard AS) gcgcaacacCGACCGACGATATTACGAGGC

In the research stage of the present invention, the base sequences of primers that did not show the intended detection specificity are as follows.
Sequence number 37 (Brown mustard S) CCCCGGTTCAAGACTTACTTAG
Sequence number 38 (Brown mustard AS) CCGGGTTGGCGAAAGCAGA
(S represents a sense primer and AS represents an antisense primer.)

  The present invention uses, as a first primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 7 to 21 in SEQ ID NO: 1 in the sequence list on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 5 to 19 in SEQ ID NO: 2 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for detecting pepper.

  The present invention uses, as a second primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing a base sequence of base numbers 12 to 26 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 4 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for detecting pepper.

  The present invention uses, as a third primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing SEQ ID NO: 5 on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 13 to 27 in SEQ ID NO: 6 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for garlic detection.

  The present invention uses, as a fourth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 6 to 20 in SEQ ID NO: 7 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 10 to 24 in SEQ ID NO: 8 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for ginger detection.

  The present invention provides, as a fifth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in SEQ ID NO: 9 in the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases containing the base sequence of base numbers 4 to 18 in SEQ ID NO: 10 on the 3 ′ end side is the antisense primer. This primer set can be suitably used for turmeric detection.

  The present invention uses, as a sixth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases including the base sequence of base numbers 9 to 23 in SEQ ID NO: 11 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence number 12 of the sequence table on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for detecting salamanders.

  The present invention provides a seventh primer set, a PCR primer consisting of a DNA of a minimum of 15 and a maximum of 30 bases comprising the base sequence of base numbers 4 to 18 in SEQ ID NO: 13 of the sequence listing on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 10 to 24 in SEQ ID NO: 14 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for citrus detection.

  The present invention provides, as an eighth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases comprising the base sequence of base numbers 11 to 25 in the sequence list of SEQ ID NO: 15 on the 3 ′ end side as a sense primer. A primer set is proposed in which a PCR primer consisting of a DNA consisting of a shortest of 15 and a maximum of 30 bases including the base sequence of base numbers 9 to 23 in SEQ ID NO: 16 on the 3 ′ end side is used as an antisense primer. This primer set can be suitably used for mustard (yellow mustard) detection.

The present invention uses, as a ninth primer set, a PCR primer consisting of a DNA of a shortest 15 and a maximum of 30 bases containing the base sequence of base numbers 8 to 22 on the 3 ′ end side in SEQ ID NO: 17 in the sequence listing as a sense primer, A primer set is proposed in which a PCR primer consisting of DNA consisting of a shortest 15 and a maximum of 30 bases including the base sequence of nucleotide numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 18 in the sequence table is an antisense primer. This primer set can be suitably used for mustard (brown mustard) detection.

  In each primer, the length of the base sequence is 15 to 30 because the appropriate length of the base sequence as a primer for PCR is about 15 to 30, and 15 bases on the 3 ′ end side. It is important to specify the sequence about 15 at the 3 'end in the PCR-specific amplification reaction. The base sequence at the 5' end is slightly different or the sequence length is slightly different. Even so, the adverse effect on the PCR reaction itself is usually small.

  In the present invention, furthermore, as a preferred embodiment of the first primer set, a PCR primer (1 ′) (most preferably) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (2 ') (most preferred) consisting of DNA with a maximum of 30 bases containing the base sequence of SEQ ID NO: 2 in the sequence listing on the 3' end side as a primer, and a primer composed of DNA of the base sequence of SEQ ID NO: 1 Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 2. This primer set can be suitably used for pepper detection, and it is most preferable to use the primer of SEQ ID NO: 1 and the primer of SEQ ID NO: 2 as a set. A specific example of (1 ′) is the primer of SEQ ID NO: 19, and a specific example of (2 ′) is the primer of SEQ ID NO: 20.

  In the present invention, furthermore, as a preferred embodiment of the second primer set, a PCR primer (3 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (4 ') (most preferably) consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 4. This primer set can be suitably used for detecting pepper, and it is most preferable to use the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4 as a set. A specific example of (3 ′) is the primer of SEQ ID NO: 21, and a specific example of (4 ′) is the primer of SEQ ID NO: 22.

  In the present invention, furthermore, as a preferred embodiment of the third primer set, a PCR primer (5 ′) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 5 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (6 ') (most preferred) consisting of DNA of a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 6 on the 3' end side of the sequence listing as a primer (sense primer) Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 6. This primer set can be suitably used for garlic detection, and it is most preferable to use the primer of SEQ ID NO: 5 and the primer of SEQ ID NO: 6 as a set. A specific example of (5 ′) is the primer of SEQ ID NO: 23, and a specific example of (6 ′) is the primer of SEQ ID NO: 24.

  In the present invention, furthermore, as a preferred embodiment of the fourth primer set, a PCR primer (7 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (8 ') (most preferred) consisting of DNA with a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 8 in the sequence listing on the 3' end side as a primer (primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 7) Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 8. This primer set can be suitably used for ginger detection, and it is most preferable to use the primer of SEQ ID NO: 7 and the primer of SEQ ID NO: 8 as a set. A specific example of (7 ′) is the primer of SEQ ID NO: 25, and a specific example of (8 ′) is the primer of SEQ ID NO: 26.

  In the present invention, furthermore, as a preferred embodiment of the fifth primer set, a PCR primer (9 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (10 ') (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3' end side as a primer, using a primer consisting of DNA of the base sequence of SEQ ID NO: 9) as a sense primer Proposes a primer set using a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 10 as an antisense primer. This primer set can be suitably used for turmeric detection, and it is most preferable to use the primer of SEQ ID NO: 9 and the primer of SEQ ID NO: 10 as a set. A specific example of (9 ′) is the primer of SEQ ID NO: 27, and a specific example of (10 ′) is the primer of SEQ ID NO: 28.

  In the present invention, furthermore, as a preferred embodiment of the sixth primer set, a PCR primer (11 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (12 ') (most preferred) consisting of DNA with a maximum of 30 bases comprising the nucleotide sequence of SEQ ID NO: 12 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 12. This primer set can be suitably used for detecting salamanders, and it is most preferable to use the primer of SEQ ID NO: 11 and the primer of SEQ ID NO: 12 as a set. A specific example of (11 ′) is the primer of SEQ ID NO: 29, and a specific example of (12 ′) is the primer of SEQ ID NO: 30.

  In the present invention, furthermore, as a preferred embodiment of the seventh primer set, a PCR primer (13 ′) consisting of a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (14 ') (most preferred) consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer consisting of DNA having the nucleotide sequence of SEQ ID NO: 14. This primer set can be suitably used for citrus detection, and it is most preferable to use the primer of SEQ ID NO: 13 and the primer of SEQ ID NO: 14 as a set. A specific example of (13 ′) is the primer of SEQ ID NO: 31, and a specific example of (14 ′) is the primer of SEQ ID NO: 32.

  In the present invention, furthermore, as a preferred embodiment of the eighth primer set, a PCR primer (15 ′) comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 ′ end side (most preferably) PCR primer (16 ') consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 16 in the sequence listing on the 3' end side (mostly a primer composed of DNA of the base sequence of SEQ ID NO: 15) (most preferred) Proposes a primer set using a primer composed of DNA having the nucleotide sequence of SEQ ID NO: 16 as an antisense primer. This primer set can be suitably used for mustard (white mustard) detection, and it is most preferable to use the primer of SEQ ID NO: 15 and the primer of SEQ ID NO: 16 as a set. A specific example of (15 ′) is the primer of SEQ ID NO: 33, and a specific example of (16 ′) is the primer of SEQ ID NO: 34.

  In the present invention, furthermore, as a preferred embodiment of the ninth primer set, a PCR primer (17 ′) (most preferred) consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 ′ end side is most preferred. PCR primer (18 ') (most preferred) consisting of DNA consisting of a maximum of 30 bases containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3' end side as a primer. Proposes a primer set using an antisense primer as a primer comprising DNA having the nucleotide sequence of SEQ ID NO: 18. This primer set can be suitably used for mustard (black mustard) detection, and it is most preferable to use the primer of SEQ ID NO: 17 and the primer of SEQ ID NO: 18 as a set. A specific example of (17 ′) is the primer of SEQ ID NO: 35, and a specific example of (18 ′) is the primer of SEQ ID NO: 36.

The spice detection method of the present invention comprises a step of extracting DNA from a sample, a step of performing PCR using the primer set of the present invention using this DNA as a template, and a spice in the sample by detecting the amplified DNA. And detecting whether or not (pepper, pepper, garlic, ginger, turmeric, salamander, citrus fruit, mustard) is present.

  That is, by using the PCR primer set for spice detection according to the present invention to analyze nucleic acid of DNA in a sample by PCR or the like, it becomes possible to specifically detect the spice in the sample. At this time, when detecting pepper, a PCR primer set for detecting pepper is used. Similarly, when detecting pepper, garlic, ginger, turmeric, salamander, citrus fruit, and mustard, each is a PCR primer for detecting pepper. A PCR primer set for garlic detection, a PCR primer set for ginger detection, a PCR primer set for turmeric detection, a PCR primer set for sunflower detection, a PCR primer set for citrus detection, and a PCR primer set for mustard detection may be used.

  The type of detection method (nucleic acid analysis) is not particularly limited, and a known method can be used as appropriate. For example, a method of PCR amplification using PCR primers, a method of detecting a PCR amplification product with a probe, and the like can be exemplified.

  As a method of PCR amplification using a PCR primer, a target base sequence in DNA in a sample is selectively amplified using the above-described spice detection primer set of the present invention selected according to the detection purpose, and a PCR amplification product The method of measuring the presence or absence of is mentioned. Confirmation of the presence or absence of a PCR amplification product can usually be performed by separating the PCR amplification product by agarose gel electrophoresis and staining with nucleic acid such as ethidium bromide or cyber green I. When PCR is performed using a real-time PCR apparatus, the presence or absence of a PCR amplification product can be automatically confirmed by the detection system of the apparatus. For example, when Cyber Green I is added to the PCR reaction solution, the amount of PCR amplification product depending on the amount of fluorescence emitted when Cyber Green I binds to double-stranded DNA can be monitored for each cycle. When PCR amplification is observed depending on the amount of fluorescence, the presence and size of the amplification product may be confirmed by the agarose gel electrophoresis described above.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 1 and the primer set forth in SEQ ID NO: 2 is about 100 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that pepper was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 3 and the primer set forth in SEQ ID NO: 4 is about 154 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that red pepper was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 5 and the primer set forth in SEQ ID NO: 6 is about 71 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that garlic was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 7 and the primer set forth in SEQ ID NO: 8 is about 105 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that ginger was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 9 and the primer set forth in SEQ ID NO: 10 is about 67 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that turmeric was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 11 and the primer set forth in SEQ ID NO: 12 is about 238 bp. When an amplification product of this size is detected by agarose electrophoresis, it indicates that salamander was present in the test sample.

  Specifically, the size of the PCR amplification product using the primer shown in SEQ ID NO: 13 and the primer shown in SEQ ID NO: 14 is about 193 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that citrus fruits were present in the test sample.

  Specifically, the size of the PCR amplification product using the primer set forth in SEQ ID NO: 15 and the primer set forth in SEQ ID NO: 16 is about 399 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that mustard (yellow mustard) was present in the test sample.

Specifically, the size of the PCR amplification product using the primer shown in SEQ ID NO: 17 and the primer shown in SEQ ID NO: 18 is about 576 bp. When an amplification product of the size is detected by agarose electrophoresis, it indicates that mustard (Brown mustard) was present in the test sample.

  As a method for detecting a PCR amplification product with a probe, as represented by the Taq Man method, a fluorescent substance-labeled probe that hybridizes with the internal base sequence of the PCR amplification product is added to the reaction solution, and the probe is used for PCR. There is a method of confirming the presence or absence of a PCR amplification product by automatically detecting the amount of fluorescence generated when the probe is decomposed after hybridization with an amplification product with a real-time PCR apparatus. Examples of other methods for detecting a PCR amplification product with a probe include a Molecular Beacon method, a Cycleave PCR method, and a method using a hybrid probe. The PCR primer used in these methods may be any of the spice detection PCR primer sets of the present invention, and the target species from the internal base sequence of the PCR amplification product amplified by each PCR primer set. A base sequence region that is common to the regions may be separately selected and a probe based on that region may be used.

  In the spice detection method of the present invention, the type of the test sample to be targeted is not particularly limited. For example, food raw materials and processed foods can be mentioned. Examples of processed foods include confectionery, noodles, powdered soup, liquid soup, hot-air dried or freeze-dried ingredients, and various cooked foods containing these processed foods.

In addition, the form of the sample is not particularly limited, and a general known DNA extraction method (Notice of Deputy Director of Consumer Affairs Agency, Food Inspection Method with Allergic Substances, March 26, 2014, Table 36) And various commercially available DNA extraction kits [eg Nucleon PhytoPure, plant and fungal DNA extraction kits (GE Healthcare Biosciences Corp., USA), DNA Extraction IsoplantII kit (Nippon Gene Co. Ltd., Japan), DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), etc.] can be applied to the above detection method as long as the sample can recover DNA. Genomic DNA and organelle-derived DNA (mitochondrial DNA or chloroplast DNA) can usually be extracted from a sample by the above-described DNA extraction method.

Examples Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not construed as being limited to these examples. The present invention can be changed as appropriate without departing from the gist of the present invention.

Example 1
Confirmation of detection specificity of spice detection PCR primer set for various plant-derived DNA <br/> In order to confirm the effectiveness of the PCR analysis method using the spice detection PCR primer set of the present invention, it was performed on various plant-derived DNA. Experiments to determine the detection specificity of PCR were performed as follows.

Pepper, pepper, tomato, garlic, leek, salamander, orange, yuzu, cabbage, peanut, soybean, ginger, ginger, turmeric, cardamom, kahokuzansho, yellow mustard, brown mustard, Chinese cabbage, turnip, chingensai, mizuna, komatsuna , Cabbage, broccoli, cauliflower, radish were purchased from a store. For these purified DNAs, a portion of each sample (seed, pericarp, leaf, tuber) was washed with 70% ethanol, and then quickly washed with TE buffer, followed by a multi-bead shocker (Yasui Kikai, Osaka). ) Prepared using Genomic-tip 20 / G (Qiagen GmbH, Germany), DNeasy plant Mini kits (Qiagen GmbH, Germany), Nucleon PhytoPure, plant and fungal DNA extraction kits, or DNA Extraction Isoplant II kit We used what we did.

  The purified DNA of buckwheat and wheat was prepared from buckwheat flour and wheat flour purchased from a store using Genomic-tip 20 / G.

The purified corn DNA used was purchased from BioChain Institute, Inc., USA.
All purified DNAs have been subjected to RNA removal by RNase.

  Each PCR primer set forth in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18 is eurofin genomics. The one synthesized by the company was used in the following PCR.

After measuring the amount of various plant DNAs prepared as described above, the DNA concentration was adjusted to 10 ng / μL using sterilized water. A 20 μL reaction solution containing the prepared 1 μL DNA sample solution was prepared using SYBR Premix Ex Taq (Tli RNase H Plus) (Takara Bio Inc., Japan) manufactured by Takara Bio Inc. This reagent contains TaKaRa Ex Taq HS (hot start type), dNTP Mixture, Mg ²⁺ and SYBR Green I in the solution. The reaction solution was prepared as a composition containing 250 nM sense primer and 250 nM antisense primer based on SYBR Premix Ex Taq. PCR reaction is performed with LightCycler (Roche Diagnostics GmbH, Germany), and amplification reaction conditions are as follows.

  After one cycle of 95 ° C for 1 minute, heat up to 95 ° C at a rate of 20 ° C / second, hold at that temperature for 5 seconds, then drop to T ° C at a rate of 20 ° C / second, The temperature was maintained at the same temperature for 2 seconds, further heated to 72 ° C. at a rate of 10 ° C./second, and then subjected to 35 amplification cycles consisting of 3 steps of keeping at the same temperature for t seconds. Note that T is 56 for the PCR primer for detecting pepper, pepper, and garlic, 62 for the PCR primer for detecting turmeric, and 64 for the PCR primer for detecting ginger, salamander, citrus, and mustard. It was. In addition, t was 30 in the case of PCR primer for mustard detection, and 20 in other cases. The PCR amplification product was recorded as the SYBR Green I-dependent fluorescence amount at the final step of each cycle. When amplification is confirmed from the amount of fluorescence, the PCR amplification product (5 μL of the reaction solution) is separated by 2-5% (wt / vol) agarose gel electrophoresis, and the separated gel is stained with ethidium bromide. The presence or absence of the amplification product was confirmed by visualizing the amplification product using Gel DOC EZ (Bio Rad). A 100 bp DNA ldder or 20 bp DNA ladder (Sigma) was used as a molecular weight marker. When an amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are listed in Tables 1-4. In the table, + (plus) indicates a positive PCR reaction, and-(minus) indicates a negative PCR reaction.

  When the pepper detection PCR primer (PCR primer set consisting of SEQ ID NOs: 1 and 2) was used, an amplification product of about 100 bp was confirmed only when pepper DNA was used, and it was determined to be positive (Table 1). When other plant species DNA was used, it was negative (Table 1).

  In addition, when the PCR primer for detecting pepper (PCR primer set consisting of SEQ ID NOs: 3 and 4) was used, an amplification product of about 154 bp was confirmed only when the pepper DNA was used, and it was determined to be positive (Table 1). It was negative when using tomato DNA, which is a related species, and DNA of other plant species (Table 1).

  In addition, when PCR primers for garlic detection (PCR primer set consisting of SEQ ID NOs: 5 and 6) were used, an amplification product of about 71 bp was confirmed only when garlic DNA was used, and was determined to be positive (Table 1). The results were negative when using the related species leek DNA and other plant species DNA (Table 1).

  In addition, when a PCR primer for detecting ginger (PCR primer set consisting of SEQ ID NOs: 7 and 8) was used, an amplification product of around 105 bp was confirmed only when ginger DNA was used, and it was determined to be positive (Table 2). When using closely related species such as myoga DNA, turmeric DNA, cardamom DNA, and other plant species DNA, they were negative (Table 2).

  In addition, when a turmeric PCR primer for detection (PCR primer set consisting of SEQ ID NOs: 9 and 10) was used, an amplification product of about 67 bp was confirmed only when turmeric DNA was used, and it was determined to be positive (Table 2). It was negative when related species such as ginger DNA, ginger DNA, cardamom DNA, and other plant species DNA were used (Table 2).

  In addition, when using PCR primers for detecting salamander (PCR primer set consisting of SEQ ID NOs: 11 and 12), amplification products of around 238 bp were confirmed only when using salamander DNA and kahakuzansho DNA, and positive. Determined (Table 3). It was negative when related species such as Yuzu DNA, Orange DNA, and other plant species DNA were used (Table 3).

  In addition, when PCR primers for detecting citrus fruits (PCR primer set consisting of SEQ ID NOS: 13 and 14) were used, an amplification product of around 193 bp was confirmed only when Yuzu DNA or Orange DNA was used, and was determined to be positive (Table). 3). The results were negative when using closely related species such as salamander DNA, kahokuzansho DNA, and other plant species DNA (Table 3).

  In addition, when PCR primer for detection of mustard (yellow mustard) (PCR primer set consisting of SEQ ID NOs: 15 and 16) was used, an amplification product of around 399 bp was confirmed only when yellow mustard DNA was used, and was determined to be positive. (Table 4). Negative when using brown mustard DNA, Chinese cabbage DNA, turnip DNA, chingensai DNA, Mizuna DNA, Komatsuna DNA, cabbage DNA, broccoli DNA, cauliflower DNA, radish DNA, and other plant species DNA, which are closely related species (Table 4).

In addition, when PCR primers for detection of mustard (Brown mustard) (PCR primer set consisting of SEQ ID NOs: 17 and 18) were used, amplification products of around 576 bp were confirmed only when Brown mustard DNA was used, and were determined to be positive. (Table 4). Negative when using mustard DNA such as yellow mustard DNA, Chinese cabbage DNA, turnip DNA, Mizuna DNA, Komatsuna DNA, cabbage DNA, broccoli DNA, cauliflower DNA, Japanese radish DNA, and other plant species DNA (Table 4).

Example 2
Confirmation of PCR Detection Sensitivity Using Spice Detection PCR Primer Set In order to examine PCR detection sensitivity using the spice detection PCR primer set used in Example 1, the following experiment was conducted.
Pepper, pepper, garlic, ginger, turmeric, salamander, orange, yellow mustard, and brown mustard DNA prepared in Example 1 were diluted with sterile water to obtain 1 fg / μl, 10 fg / μl, 100 fg / μl. , 1 pg / μl, 10 pg / μl, 100 pg / μl of DNA solution dilution series was prepared, and 1 μL of these diluted test DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1. Provided. After the PCR reaction, the presence or absence of the amplified product was confirmed by agarose gel electrophoresis.

As shown in FIG. 1, the detection sensitivity when using a PCR primer for pepper detection (PCR primer set consisting of SEQ ID NO: 1 and 2) is 10 pg DNA / analysis, and a PCR primer for detecting pepper (SEQ ID NO: 3 The detection sensitivity is 10 pg DNA / analysis using the PCR primer set consisting of 4 and 4, and the detection sensitivity when using the PCR primer for garlic detection (the PCR primer set consisting of SEQ ID NOs: 5 and 6) is , 1 pg DNA / analysis, and using ginger detection PCR primers (PCR primer set consisting of SEQ ID NOs: 7 and 8), the detection sensitivity is 100 fg DNA / analysis, and turmeric detection PCR primers (sequence Detection sensitivity when using PCR primer set consisting of Nos. 9 and 10 is 1 pg DNA / analysis, and PCR primer for detecting salamander (PCR primer consisting of SEQ ID Nos. 11 and 12) Detection sensitivity is 100 fg DNA / analysis, and the detection sensitivity is 1 pg DNA / analysis when using citrus detection PCR primers (PCR primer set consisting of SEQ ID NOs: 13 and 14). The detection sensitivity when using yellow mustard detection PCR primers (PCR primer set consisting of SEQ ID NOs: 15 and 16) is 100 fg DNA / analysis, and brown mustard detection PCR primers (SEQ ID NOs: 17 and 18) The detection sensitivity was 10 fg DNA / analysis using a PCR primer set consisting of

Example 3
Detection of spice-derived DNA in spice-containing foods by PCR using a PCR primer set for spice detection PCR analysis using the PCR primer set for spice detection of the present invention for commercially available foods containing various spices as follows The practicality of the present invention was examined.

  Commercially available spice mixes (Table 5) specified to contain various spices as raw materials were prepared, and 1 to 10 g was pulverized with a multi-bead shocker. Each DNA was extracted from 1 g of the mixed crushed material using Genomic-tip 20 / G kit. At the time of extraction, RNA was also removed by RNase. After measuring the amount of the extracted food sample DNA, the concentration of the food sample DNA was adjusted to 10 ng / μL using sterilized water. 1 μL of these prepared DNA solutions were subjected to PCR under the PCR reaction conditions described in Example 1 using the spice detection PCR primer set used in Example 1. When amplification is confirmed from the amount of fluorescence, the PCR amplification product (5 μL of the reaction solution) is separated by 2-5% (wt / vol) agarose gel electrophoresis, and the separated gel is stained with ethidium bromide. The presence or absence of the amplification product was confirmed by visualizing the amplification product using Gel DOC EZ (Bio Rad). A 100 bp DNA ldder or 20 bp DNA ladder (Sigma) was used as a molecular weight marker. When an amplification product of the target size was detected by electrophoresis, it was determined that the PCR reaction was positive. The results of these PCRs are listed in Table 5. In the table, + (plus) indicates a positive PCR reaction, and-(minus) indicates a negative PCR reaction. Furthermore, the PCR amplification product amplified from the food sample DNA was directly sequenced from both directions using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), and then the base sequence was determined using the Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems). Was analyzed. Analyze the analyzed base sequence data with GenBank nucleotide sequence database (BLAST search) or the DNA database owned by the inventors, and assign the species of DNA derived from PCR amplification products based on the similarity of the base sequence. Identified.

  As a result, when using the PCR primer for detecting pepper (PCR primer set consisting of SEQ ID NOs: 1 and 2), only about 100 bp of amplified product in spice mix A, C, and D-derived DNA, which is a food containing pepper Confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 5). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix A, C, and D-derived DNAs was identical to the ITS base sequence of pepper. That is, PCR using the PCR primer does not detect pepper-derived DNA or other DNA from pepper-free food samples in multiple commercially available foods, but can specifically detect pepper-derived DNA from pepper-containing food samples. confirmed.

  In addition, when using the PCR primer for detecting pepper (PCR primer set consisting of SEQ ID NOs: 3 and 4), the amplification product of around 154 bp is only found in the spice mix B, C, and D-derived DNA that is a food containing pepper. Was confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 5). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix B, C, and D-derived DNAs coincided with the ITS base sequence of pepper. That is, PCR using the PCR primers does not detect pepper-derived DNA or other DNA from pepper-free food samples in multiple commercial foods, but can confirm that pepper-derived DNA can be specifically detected from pepper-containing foods did.

  In addition, when PCR primers for garlic detection (PCR primer set consisting of SEQ ID NOs: 5 and 6) were used, amplification products of about 71 bp were confirmed only in the garlic-containing foods, spice mix A, C, and D-derived DNA And determined to be positive. When DNA from other food samples was used, it was negative (Table 5). As a result of analysis of the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix A, C, and D-derived DNA was identical to the garlic ITS base sequence. That is, PCR using the PCR primer does not detect garlic-derived DNA or other DNA from garlic-free food samples in multiple commercial foods, but can specifically detect garlic-derived DNA from garlic-containing food samples. confirmed.

  In addition, when PCR primers for detection of ginger (PCR primer set consisting of SEQ ID NOs: 7 and 8) were used, amplification products of around 105 bp were found only in spice mix A, C, and D-derived DNAs that are ginger-containing foods. Confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 5). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix A, C, and D-derived DNAs was consistent with the ginger ITS base sequence. That is, PCR using the PCR primers does not detect ginger-derived DNA or other DNA from non-ginger-containing food samples in a plurality of commercially available foods, but can specifically detect ginger-derived DNA from ginger-containing food samples. confirmed.

  In addition, when PCR primers for turmeric detection (PCR primer set consisting of SEQ ID NOs: 9 and 10) were used, amplification products of around 67 bp were confirmed only in the turmeric-containing foods, spice mix D and E-derived DNA. , Positive. When DNA from other food samples was used, it was negative (Table 5). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix D and E-derived DNAs was consistent with the turmeric ITS base sequence. That is, PCR using the PCR primer does not detect turmeric-derived DNA or other DNA from turmeric-free food samples in multiple commercial foods, but can specifically detect turmeric-derived DNA from turmeric-containing food samples. confirmed.

  In addition, when using the salamander detection PCR primer (PCR primer set consisting of SEQ ID NOs: 11 and 12), only 238 bp amplification products are present in the salmon-containing food, spice mix B and C-derived DNA. Confirmed and determined to be positive. When DNA from other food samples was used, it was negative (Table 5). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix B and C-derived DNAs was consistent with the salamander ITS base sequence. That is, PCR using the PCR primers does not detect salamander-derived DNA or other DNA from food products that do not contain salamander in multiple commercially available foods, but specifically identifies salamander-derived DNA from salamander-containing food samples. It was confirmed that it could be detected.

  In addition, when PCR primers for detection of citrus fruits (PCR primer set consisting of SEQ ID NOs: 13 and 14) were used, only 193 bp amplification products were confirmed in spice mix B-derived DNA, which is a citrus-containing food, and positive It was judged. When DNA from other food samples was used, it was negative (Table 5). As a result of analyzing the base sequence of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix B-derived DNA was identical to the ITS base sequence of citrus fruits. That is, PCR using the PCR primer does not detect citrus-derived DNA or other DNA from citrus-free food samples in multiple commercially available foods, but can specifically detect citrus-derived DNA from citrus-containing food samples. confirmed.

In addition, when using PCR primers for mustard detection (PCR primer set consisting of SEQ ID NOs: 15 and 16 and PCR primer set consisting of SEQ ID NOs: 17 and 18), mustard-containing foods, spice mix D and E-derived DNA Only, amplification products of around 399 bp or around 476 bp were confirmed and judged positive. When DNA from other food samples was used, it was negative (Table 5). As a result of the base sequence analysis of the PCR amplification product, the base sequence of the PCR amplification product amplified from the spice mix D and E-derived DNAs matched the ITS base sequence of mustard (yellow mustard or brown mustard). That is, PCR using the PCR primers does not detect mustard-derived DNA or other DNA from mustard-free food samples in multiple commercial foods, but can detect mustard-derived DNA specifically from mustard-containing food samples. confirmed.

Claims (17)

The primer set according to any one of (1) to (16) below.
(1) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 at the 3 ′ end in SEQ ID NO: 1 in the sequence listing;
A PCR primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 5 to 19 on the 3 ′ end side in SEQ ID NO: 2 in the sequence listing.
(2) a PCR primer comprising DNA of a maximum of 30 bases including the base sequence of base numbers 12 to 26 in SEQ ID NO: 3 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6 to 20 on the 3 ′ end side in SEQ ID NO: 4 in the sequence listing.
(3) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 6-20 in SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10-24 in SEQ ID NO: 8 in the sequence listing on the 3 ′ end side.
(4) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in SEQ ID NO: 9 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 4-18 in the sequence listing, SEQ ID NO: 10 on the 3 ′ end side
(5) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 9 to 23 in the sequence listing in SEQ ID NO: 11 on the 3 ′ end side;
A primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases comprising the base sequence of base numbers 11 to 25 in the sequence listing in the sequence listing on the 3 ′ end side.
(6) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 4 to 18 on the 3 ′ end side in SEQ ID NO: 13 in the sequence listing;
Primer set consisting of a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 24 on the 3 ′ end side in SEQ ID NO: 14 in the sequence listing
(7) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of base numbers 11 to 25 in the sequence listing in SEQ ID NO: 15 on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA comprising the base sequence of base numbers 9 to 23 in the sequence listing at the 3 ′ end side
(8) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of base numbers 10 to 22 in SEQ ID NO: 17 in the sequence table on the 3 ′ end side;
A PCR primer set consisting of a PCR primer consisting of DNA consisting of a maximum of 30 bases containing the base sequence of base numbers 7 to 21 on the 3 ′ end side in SEQ ID NO: 18 in the sequence listing.
(9) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 1 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 2 on the 3 ′ end side of the sequence listing
(10) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 3 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 4 on the 3 ′ end side of the sequence listing
(11) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 7 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 8 on the 3 ′ end side of the sequence listing
(12) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 9 in the sequence listing on the 3 ′ end side;
PCR primers consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 10 in the sequence listing on the 3 ′ end side;
Primer set consisting of
(13) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 11 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 12 in the sequence listing on the 3 ′ end side
(14) a PCR primer comprising a DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 13 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of DNA of up to 30 bases containing the base sequence of SEQ ID NO: 14 on the 3 ′ end side of the sequence listing
(15) a PCR primer consisting of DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 15 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 16 on the 3 ′ end side of the sequence listing
(16) a PCR primer comprising DNA of a maximum of 30 bases containing the base sequence of SEQ ID NO: 17 in the sequence listing on the 3 ′ end side;
Primer set consisting of a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequence of SEQ ID NO: 18 in the sequence listing on the 3 ′ end side   The primer set according to claim 1 (1).   The primer set according to claim 1 (2).   The primer set according to claim 1 (3).   The primer set according to (4) of claim 1.   The primer set according to claim 5 (5).   The primer set according to claim 6 (6).   The primer set according to (7) of claim 1.   The primer set according to (8) of claim 1.   The primer set according to (9) of claim 1.   The primer set according to (10) of claim 1.   The primer set according to (11) of claim 1.   The primer set according to (12) of claim 1.   The primer set according to (13) of claim 1.   The primer set according to (14) of claim 1.   The primer set according to (15) of claim 1.   The primer set according to (16) of claim 1.

Images