JP6998805B2 - Primer for detection of wild bean genus and detection method - Google Patents

Description

The present invention is a PCR primer using a sequence specific to the DNA of a wild bean plant for quickly determining whether or not a wild bean plant is present in an object such as food, and detection of a wild bean plant using the primer. It's about the method.

"Wild bean" is one of the plants often used in processed foods. On the other hand, in recent years, the allergenicity of plants of the genus Wild bean has been suggested, and there is a demand for a simple means for detecting trace amounts of plants of the genus Wild bean contained in food raw materials and products with high sensitivity.
From this point of view, it would be convenient if a test method using a gene that can be quickly tested even with a small amount of sample can be used. That is, if the method is to extract DNA from an object and examine the sequence of the gene, it is possible to perform a rapid examination using a small sample amount.

On the other hand, for example, Patent Document 1 is disclosed as a method for examining the sequence of such a gene. Patent Document 1 describes the internal transfer spacer region 1 (ITS1) or the internal transfer spacer region 2 (ITS1).
Targeting ITS2), two plant universal primer sets designed based on the base sequences of the regions existing on both sides of ITS1 or ITS2 were constructed, and DNA prepared from a foreign substance was used as a template using the primer set. Amplification reaction is performed. The method for identifying a sample in this method is to determine the base sequence of an amplified nucleic acid fragment and identify the organism species from the base sequence.

JP-A-2004-337069

The plants of the genus Wild bean can be distinguished by the method of Patent Document 1. However, this method is complicated because it requires a step of determining the base sequence. Furthermore, in processed foods, a plurality of plants are often mixed, and it is difficult to determine the sequence with a plant universal primer set due to the influence of contamination.
In addition, considering the above-mentioned purpose, if there is a primer specific to the DNA of a plant belonging to the genus Wild bean, it can be quickly detected depending on the presence or absence of an amplification product by using the primer. On the other hand, until now, there has been no PCR primer targeting plants of the genus Bean.

Therefore, the present inventors have developed a primer capable of detecting a specific gene for the genus Wild bean with high sensitivity and a detection method thereof so that the presence can be confirmed in a plant belonging to the genus Wild bean using DNA extracted from the object. The challenge was to develop.

In order to solve the above problems, the present inventors have attempted to prepare a primer specific to the genus Wild bean. First, the present inventors examined the range-specific region targeting the rbcL region: ribulose 1,5-bisphosphate carboxylase / oxygenase [ribulose 1,5-bisphosphate carboxylase / oxygenase], which is widely used for identification of plant species. did. However, the homology with related species was very high, there were few distinguishable regions, and it was difficult to find a specific region.

On the other hand, since the ITS region of ribosomal DNA (rDNA) has a specific base sequence for each species, it is easy to differentiate by species and distinguish it from related species. Therefore, in this method, as a result of investigating specific DNA regions targeting ITS regions with abundant changes, we found a region specific to plants of the genus Bean. In addition, the present invention was completed by designing a primer that can obtain an amplification product in the vicinity of 200 bp that can be detected even in processed foods.

That is, the present inventors prepared a wild bean-specific primer. Then, by using these primers, it was possible to construct a detection method capable of detecting the genus Wild bean.
Specifically, the present invention provides the following PCR primers, PCR primer sets, and methods for detecting the genus Common Bean.
Item 1. A maximum of 3 containing the base sequences of base numbers 14 to 25 in SEQ ID NO: 1 in the sequence listing on the 3'end side
PCR primer term consisting of 0-base DNA 2. A maximum of 3 containing the base sequences of base numbers 13 to 24 in SEQ ID NO: 2 in the sequence listing on the 3'end side
PCR primer term consisting of 0-base DNA 3. A PCR primer set comprising the primer according to claim 1 and the primer according to claim 2.
Item 4. A step of extracting DNA from the sample, a step of performing PCR using this DNA as a template, and a step of performing PCR using the primer set according to claim 3, and whether or not green beans are present in the sample by detecting the amplified DNA. A method for detecting a common bean genus, which comprises a step of detecting a common bean.

The presence of the genus Bean can be quickly determined by performing a PCR test using the primers of the present invention.

It is an electrophoretogram which showed the reactivity of this primer to the plant of the genus Bean. It is an electrophoretogram which showed the detection limit of this primer. It is an electrophoretogram which shows the detection result of the common bean-derived DNA in the commercial processed food.

Hereinafter, the present invention will be described in detail.
Primer for detection of wild bean genus
The PCR primer set of the present invention has a base sequence characteristic of the genus Bean. Here, the genus Wild bean (Phaseolus) is one of the genus belonging to the subfamily Lima bean, and includes common bean (P. vulgaris), runner bean (P. coccineus), and lima bean (P. lunatus). The present invention is directed to these wild bean genera.
Since many lima beans contain cyanide compounds, they are not generally sold or distributed in Japan. Therefore, common beans and safflower beans are sometimes collectively referred to as "green beans".

Using this primer set, a specific region of the genus Wild bean is amplified by the PCR method, and the amplified DNA fragment is subjected to agarose gel electrophoresis to detect a DNA fragment of a specific size from the pattern of the electrophoresis. , The presence of DNA derived from the genus Wild bean can be determined.
In addition, if it is a real-time PCR device, the presence of DNA derived from the genus Wild bean can be determined by analysis of the melting curve of the amplified DNA fragment in addition to gel electrophoresis.

Furthermore, the primer was designed so as not to intersect with other species and form a primer dimer. In addition, considering the case of using a primer together, it was designed so that the conditions for using the primer can be set uniformly.
The base sequence of the primer provided by the present invention is as follows. S represents a sense primer and AS represents an antisense primer.
SEQ ID NO: 1 (S): CACCCCTTCATCCACACTGAACTAG
SEQ ID NO: 2 (Wild bean genus AS): GATAAGTCCGTTACGTCGGAGTCC

Further, each of the above primers may be a primer having a maximum of 30 bases as a whole by adding an arbitrary sequence to the 5'end side thereof. In addition, for each primer, 3
‘Detection is possible if 12 bases from the end match the template DNA.
Therefore, the present invention first proposes, as the first primer, a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequences of base numbers 14 to 25 in SEQ ID NO: 1 in the sequence listing on the 3'end side. Next, as a second primer, we propose a PCR primer consisting of a maximum of 30 bases of DNA containing the base sequences of base numbers 13 to 24 in SEQ ID NO: 2 in the sequence listing on the 3'end side. Moreover, it is preferable to use these primers as a set. By using these primers as a set, the genus Wild bean can be detected.

How to detect the genus Wild bean
-Items to be inspected The object to be inspected in this detection method is not particularly limited, and specific examples thereof include foods and foreign substances. Beverages and the like are also possible. Specific examples of the food include raw or heated raw materials and processed foods. Further, since the present invention uses the PCR method, it can be detected if a small amount of DNA is present. Therefore, if there is a small amount of food or the like, it can be detected.

-DNA extraction process Regarding the extraction of DNA from the inspection target, the morphology of the sample is not particularly limited. General known DNA extraction method (Notice of Director of Food and Health Department, Pharmaceutical Affairs Bureau, Ministry of Health, Labor and Welfare, Inspection method for foods containing allergens, November 06, 2002, Shokuhin No. 1106001) and various commercially available DNA extraction kits [ For example, Nucleon PhytoPure, plant and fungal DNA extraction kits (Amersham Bios)
ciences Corp., USA), DNA Extraction IsoplantII kit (Nippon Gene Co. Ltd., Japan)
), DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), etc.], any sample that can recover DNA can be applied to the above detection method.

-PCR process using the present primer set The method for detecting the genus Wild bean of the present invention includes a step of extracting DNA from a sample, a step of performing PCR using this DNA as a template, and a step of performing PCR using the primer set of the present invention described above. By detecting the DNA, it is possible to confirm whether or not the wild bean genus was present in the sample.
In the PCR reaction step, PCR is performed using the extracted DNA as a template and a primer set for detecting the genus Wild bean. As the PCR device, for example, a block type or capillary type commercially available device can be used. In addition, if a capillary-type real-time PCR device is used, the increase of DNA fragments, which are amplification products, can be monitored in real time, so that the presence or absence of kidney bean DNA can be quickly confirmed.

・ Detection of amplified DNA fragments
To confirm the presence or absence of a DNA fragment that is a PCR amplification product, gel electrophoresis of the amplification product is performed in the case of a normal PCR device, and further, melting curve analysis of the amplification product is performed in the case of a real-time PCR device. By deriving the melting temperature (Tm) value of the PCR amplification product from the analysis, it can be confirmed whether the PCR amplification product is the target amplification product. Specifically, this primer set can detect DNA of the genus Wild bean. The theoretical DNA fragment size and Tm by PCR amplification for each species are roughly as shown in Table 1 below.

上記のインゲンマメ属特異プライマーを用いてPCR工程を行えば、インゲンマメ属を特異的に識別・検出することができる。

By performing a PCR step using the above-mentioned wild bean-specific primer, the common bean genus can be specifically identified and detected.

Examples of the present invention will be described below. However, the present invention is not limited to the following examples.

[Test Example 1]
─ Confirmation of detection using primer set for detecting wild bean DNA ─
The following tests were performed to confirm the detection of PCR primers for the genus Wild Bean.
・ Used bean
The following five types of common beans were used.
(1) Vine Ariingen Moroccan (green beans)
(2) Vineless common bean Aaron (green bean)
(3) Vine-bearing green beans Kentucky Wonder (green beans)
(4) Midori Satsuki (green beans)
(5) White flower beans (runner bean)

-DNA extraction method Commercially available seeds were purchased for the above 5 species of wild bean plants used as samples. For these purified DNAs, each sample is germinated, a part of the tissue is washed with 70% ethanol, washed quickly with sterile water, and then crushed with a multi-bead shocker (Yasui Kikai, Osaka). Those prepared using Mini kits (Qiagen GmbH, Germany) were used. After measuring the amount of various plant DNAs prepared as described above, the concentration of DNA was adjusted to 1 ng / μL using sterile water. At the time of extraction, an operation for removing RNA by an RNA degrading enzyme was also performed.

・ PCR reaction conditions
A 20 μL volume reaction solution containing 2 μL of DNA sample solution to be donated to PCR was prepared using SYBR Premix Ex TaqTM (Tli RNase H Plus) (Takara Bio Inc., Japan) manufactured by Takara Bio Inc. The reaction solution was prepared based on SYBR Premix Ex TaqTM as a composition containing a 250nM sense primer and a 250nM antisense primer. The PCR reaction is performed by LightCycler (Roche Diagnostics GmbH, Germany), and the amplification reaction conditions are as follows.

After performing one 1-minute cycle at 95 ° C, raise the temperature to 95 ° C at a rate of 20 ° C / sec, keep the temperature at the same temperature for 10 seconds, and then heat to 62 ° C (annealing temperature) at a rate of 20 ° C / sec. After the temperature was lowered, the temperature was kept at the same temperature for 20 seconds, the temperature was raised to 72 ° C at a rate of 10 ° C / sec, and then the temperature was kept at the same temperature for 20 seconds. An amplification cycle consisting of three steps was carried out 35 times.

The PCR amplification product was recorded as a SYBR Green I-dependent fluorescence amount at the final step of each cycle. After the amplification cycle, the melting curve is heated to 97 ° C at a rate of 20 ° C / sec, then lowered to 60 ° C at a rate of 20 ° C / sec, kept at the same temperature for 10 seconds, and then 0.2 ° C. Obtained by recording fluorescence intensities every 0.2 seconds during a gradual warming up to 97 ° C. at a rate of / second. The Tm value of the PCR amplification product obtained from the melting curve by the software of the PCR device was used to estimate the presence or absence of the specific amplification product by PCR. Furthermore, by separating the PCR amplification product (5 μL of the reaction solution) by 3.0% (wt / vol) agarose gel electrophoresis, staining the separated gel with ethidium bromide, and then visualizing the amplification product under UV irradiation. , The presence or absence of amplification products was confirmed. A 100 bp DNA Ladder (TOYOBO CO., Japan) was used as a molecular weight marker. The results of these PCRs are shown in Table 2. In the table, + (plus) indicates that the amplification product of the target size was detected by electrophoresis, and-(minus) indicates that the amplification product was not detected. The results of electrophoresis are shown in FIG.

The detection of target-sized amplification products is considered positive if a band is confirmed at a position below 200 bp when a wild bean-specific primer is used, and no band is confirmed at any position, or at other positions. If a band was confirmed in the wild bean, it was considered negative.

<Results and discussion>
The novel PCR primer reacted with all five varieties of the genus Wild bean and was shown to have a DNA amplification effect of the genus Wild bean.

[Test Example 2]
─ Confirmation of detection sensitivity of PCR analysis using primer set for detecting wild bean DNA ─
The following tests were performed to confirm the detection sensitivity of PCR primers for the genus Common Bean.

・ DNA used
The vine red bean Morocco (green bean) used in Test Example 1 was prepared by the DNA extraction method shown in Test Example 1 (DNA concentration was adjusted to 1 ng / μL). 2 μL of DNA that donates the DNA to PCR was used. Dilute the DNA solution with sterile water and dilute with about 0.001 pg / μl, about 0.01 pg / μl, about 0.1 pg / μl, about 1 pg / μl, about 10 pg / μl, about 100 pg / μl and about 1 ng / μl. 2 μl of the diluted solution was used for PCR analysis. Other test conditions are the same as those shown in Test Example 1. The results are shown in Table 3.
<PCR conditions>
It was carried out in 95 ° C., 1 minute- (95 ° C., 10 seconds-62 ° C., 20 seconds-72 ° C., 20 seconds) x 35 cycles. Other test conditions are the same as those shown in Test Example 1.

<Results and discussion>
In the table, + (plus) indicates that the amplification product of the target size was detected by electrophoresis, and-(minus) indicates that the amplification product was not detected. The detection sensitivity of the new PCR primers was 2 pgDNA / analysis. The results of electrophoresis are shown in FIG.

[Test Example 3]
─ Confirmation of reaction specificity of the PCR primer of the present invention─
It was confirmed that the PCR primer of the present invention reacts specifically with the genus Wild bean and does not react with other species (plant species and animal species other than the genus Wild bean).
・ DNA used
Purified human DNA was purchased from CeMines, LLC, USA.
Purified DNA of bovine, pig, chicken, chub mackerel, squid, and madako is obtained from Nucleon PhytoPure, a sample crushed by a multi-bead shocker (Yasui Kikai, Osaka) after freezing the (muscle) fleshy part of each sample purchased from a store. Those prepared using a plantand fungal DNA extraction kits (Amersham Biosciences Corp., USA) or a DNA Extraction IsoplantII kit (Nippon Gene Co. Ltd., Japan) were used.

Wheat and corn DNA purchased from the BioChain Institute, Inc., USA was used. The purified DNA of buckwheat was prepared by using a multi-bead shocker for buckwheat flour purchased from a store and using Nucleon PhytoPure, plant and fungal DNA extraction kits from a crushed sample.

Peas, sages, green beans, broad beans, chickpeas, lens beans, peanuts, green onions, onions, rice, soybeans, sesame seeds, carrots, burdock roots, cabbage, capsicum, garlic chives, tomatoes, pakuchi, and parsley were purchased from stores. For these purified DNAs, a part of each sample was washed with 70% ethanol, quickly washed with sterile water, and then crushed with a multi-bead shocker (Yasui Kikai, Osaka) to DN easy plant Mini kits (Qiagen GmbH). , Germany) was used. Purified DNA of Bacillus cereus (Bacillus cereus ATCC 11950), Pichia anomala, and Fusarium crookwellense is obtained from pure gene Yeast and Gram- from the culture medium after culturing each strain in an appropriate medium. Those prepared using the Positive DNA Isolation kit (Gentra Systems Inc., USA) were used. All purified DNAs have been subjected to RNA removal operations using RNA-degrading enzymes. Other test conditions are the same as those shown in Test Example 1. The results are shown in Table 4.
<PCR conditions>
It was carried out in 95 ° C., 1 minute- (95 ° C., 10 seconds-62 ° C., 20 seconds-72 ° C., 20 seconds) x 35 cycles. Other test conditions are the same as those shown in Test Example 1.

<Results and discussion>
The novel PCR primer did not react with plants other than the genus Wild bean (including plants of the family Leguminosae) and DNA of other animals and bacteria, indicating that it has reaction specificity for plants of the genus Wild bean. ..

[Test Example 4]
─ Detection of common bean-derived DNA in commercially available processed foods by PCR analysis using a primer set for detecting wild bean DNA ─
An implementation test was conducted to confirm whether or not the wild bean genus primer of the present invention can actually be detected in a commercially available product that clearly states that the genus Common bean is used as a raw material.
As a sample, a commercially available dry food that clearly states that a plant of the genus Wild bean is used as a raw material and a non-use commercially available dry food are prepared, and after crushing each sample with a whole meal, DNA is obtained in the same manner as in Test Example 1. After extraction, 2 μl of about 10 ng / μl DNA solution was used for PCR analysis.
At the time of extraction, an operation for removing RNA by an RNA degrading enzyme was also performed. The following products were used as test samples. The results are shown in Table 5.

Products containing common beans
(1) Cup Noodle Chili Tomato Noodle (Nissin Food Products Co., Ltd.)
(2) Cup Noodle Light Plus Beef and Vegetable Borsch (Nissin Food Products Co., Ltd.)
(3) Nissin Cup Noodle Risotto Chili Tomato (Nissin Food Products Co., Ltd.)
(4) French noodle demiglace sauce style (Nissin Food Products Co., Ltd.)
(5) Soup Curry Wonton (Toyo Suisan Kaisha, Ltd.)

Products that do not contain green beans
(6) Cup Noodle (Nissin Food Products Co., Ltd.)
(7) Nissin Donbei Tempura Soba (Nissin Food Products Co., Ltd.)
(8) Nissin Curry Meshi Beef (Nissin Food Products Co., Ltd.)
<PCR conditions>
It was carried out in 95 ° C., 1 minute- (95 ° C., 10 seconds-62 ° C., 20 seconds-72 ° C., 20 seconds) x 35 cycles. Other test conditions are the same as those shown in Test Example 1. The results are shown in Table 5.

<Results and discussion>
Accurate detection was possible only in products in which the genus Wild bean is used as a raw material. The results of electrophoresis are shown in FIG.

Claims (2)

A PCR primer set containing the PCR primer of SEQ ID NO: 1 in the sequence listing and the PCR primer of SEQ ID NO: 2 in the sequence listing. The step of extracting DNA from the sample, the step of performing PCR using this DNA as a template and the PCR primer set according to claim 1, and the step of detecting the amplified DNA, the genus Wild bean is present in the sample. A method for detecting a wild bean genus, which comprises a step of detecting whether or not it is present.

Images