KR102395589B1 - Biomarker for discrimination between Artemisia annua and Ambrosia artemisiifolia - Google Patents

Abstract

Through the present invention, using chloroplast and ITS sequence, a specific primer was developed to distinguish wild wormwood, a wild herb, and ragweed, a poisonous herb. The developed primer obtained significant results in reproducibility, specificity and reliability evaluation, and it was confirmed that the target species could be detected even in processed food and samples digested from artificial gastric juice. Therefore, it is expected to be useful not only in food but also in forensic analysis.

Description

Biomarker for discrimination between Artemisia annua and Ambrosia artemisiifolia}

The present invention relates to a biomarker for discriminating wild plants, wormwood ( Artemisia annua ) and poison ragweed ( A mbrosia artemisiifolia ).

Not only in Korea, but also in many countries, wild vegetables are cooked or eaten raw and have a food culture. However, not all plants in the world are edible and some are toxic to humans. Occasionally, there are morphological similarities between poisonous weeds and edible wild plants with this toxicity. This morphological similarity leads to confusion between wild plants and poisonous plants, which can lead to natural poisoning and even death by ingesting the poisonous plants. In fact, according to the Ministry of Food and Drug Safety (MFDS), a total of 42 patients occurred in Korea from 2013 to 2017 after ingestion of poisonous herbs due to confusion due to the morphological similarity between wild greens and poisonous plants.

In this study, wild herbs confused by morphological similarity, Artemisia annua and The ragweed (A mbrosia artemisiifolia ) was dealt with.

On the other hand, wormwood is a medicinal herb and its scientific name is Artemisia annua . It is an annual plant of the genus Asteraceae. In herbal medicine, it is called cheongho (菁蒿) and has traditionally been widely used for medicinal purposes. There are studies showing that it has anticancer effects. When you tear it apart and rub it with your hands, it says, “It smells like dog dung”, so it was given the name 'gae dung mugwort'. Dr. Youyu Tu (Chinese Institute of Traditional Medicine), who received the Nobel Prize in Medicine in 2015, found an ingredient to treat malaria from wormwood and developed 'artemisinin' extracted from wormwood, contributing to the eradication of malaria since the 1990s. Wormwood has been reported to have antioxidant and antibacterial effects. It is also reported that artemisin has an inhibitory effect on skin hypersensitivity reaction and that flavonoids have antioxidant and anticancer effects. It is a plant different from yellow sea mugwort (Aeyeop, 艾葉) and wormwood (Injinho, 茵蔯蒿), which are often used for medicinal purposes.

On the other hand, ragweed is an annual herb belonging to the Asteraceae. It is a naturalized plant native to North America. It is also called thief grass or rag grass. It is 1~2 meters high and has short thorn hairs all over, and branches are often divided. The leaves are opposite or opposite, and are divided into two or three times in an idol, and the length is 3-11 centimeters. The front side of the leaf is dark green, and the back side is grayish and has soft hairs. Flowers hang in the shape of ears at the ends of stems and branches in August-September, and the head flowers are unisexual. The gun gun is green, and the gun pieces are attached to each other. Ragweed is a grass that causes pollen disease and is not used as livestock feed. In Korea, it was introduced from North America during the Korean War and is distributed in the wild throughout the country, and the fertility is very strong. It is also known as a plant that causes allergic rhinitis and various respiratory diseases. Its pollen can cause an anaphylactic reaction. In fact, there is a case report that anaphylaxis symptoms such as dizziness, angioedema, and breathing difficulties developed after ingestion of bee pollen containing ragweed pollen (Park et al., 2007).

However, research and development of molecular markers capable of distinguishing edible plants from toxic plants causing confusion have not yet been conducted.

PCR (Polymerase Chain Reaction) analysis, a molecular biological technique, is widely used due to its rapid and economical advantages (An et al., 2018). In particular, the quantitative real-time PCR (qPCR) method used in this study has the advantage of being able to detect even a very small amount of target DNA in food and having high specificity and sensitivity. There are two main methods of analysis using this. The first is a probe-based TaqMan method, and the second is a real-time PCR method based on the SYBR Green I intercalating reagent.

However, the probe-based real-time PCR technique has difficulties in making probes and establishing real-time PCR conditions. Instead, in this study, a more flexible, convenient, and economical technique using the SYBR Green I reagent was used. In fact, processed meats such as beef and pork (Safdar et al., 2015), Baeksuo (Kim et al., 2017), rock sol (An et al., 2018) and wild berries (An et al., 2019) are processed. Research results have been reported that a real-time PCR technique based on SYBR Green was used to detect target species in food in its original state.

On the other hand, chloroplast cells exist only in plants and aquatic cells and play a very important role in photosynthesis. Most chloroplast genomes have a circular shape with a size of 120-170 kb. The single chloroplast genome has a simple and stable genetic structure. In the case of chloroplast genes, the frequency of SNPs (single-nucleotide polymorphisms) and InDels (insertion/deletion) was high on average, so it was used to confirm the relationship at the species level.

In addition, chloroplast genes were used to develop specific barcode markers in Asteraceae. In the case of peach, DNA barcoding markers were successfully developed using the clpP and psbM-trnD gene regions (Wenpang et al., 2012). In other studies, chloroplast genes have been used for species identification (CBOL, 2009). In addition, the International Transcribed Spacer (ITS) region is also widely used to analyze phylogenetic relationships between species that are evolutionarily very similar.

Therefore, in this study, using the chloroplast gene and the nucleotide sequence of the ITS region in the nucleus, 3 pairs of molecular markers capable of detecting wild green wormwood and poison ragweed were developed for a total of 6 primers, and applied to processed foods and artificial gastric juice. The invention was completed by evaluating the efficacy and effectiveness of the marker.

The present inventors developed a specific primer for distinguishing wild wormwood from ragweed, a poisonous herb, using chloroplast and ITS nucleotide sequences through the present invention. The developed primer obtained significant results in reproducibility, specificity and reliability evaluation, and it was confirmed that the target species could be detected even in processed food and samples digested from artificial gastric juice. Therefore, it is expected to be useful not only in food but also in forensic analysis.

In order to solve the above problems, the present invention provides a primer set represented by each nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; a primer set represented by each nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; a primer set represented by each nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; a primer set represented by each nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8; a primer set represented by each nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10; and a primer set represented by each nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12; With one or more primer sets selected from the group consisting of, as an active ingredient, Artemisia annua and Ragweed (A mbrosia artemisiifolia ) Provides a biomarker composition for discrimination.

In one embodiment of the present invention, the primer set represented by each nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; And the primer set represented by each nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 may be characterized in that it amplifies the ndhA gene, but is not limited thereto.

In one embodiment of the present invention, the primer set represented by each of the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4; And the primer set represented by each nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10 may be characterized by amplifying the rpoC1 gene, but is not limited thereto.

In one embodiment of the present invention, the primer set represented by each nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; And the primer set represented by each nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12 may be characterized by amplifying the ITS gene, but is not limited thereto.

In addition, the present invention provides the above wormwood ( Artemisia annua ) and Ragweed (A mbrosia artemisiifolia ) Biomarker composition for discrimination; And a reagent for performing an amplification reaction; containing Artemisia annua ) and Ragweed (A mbrosia artemisiifolia ) It may be a kit for discrimination.

In an embodiment of the present invention, the reagent for performing the amplification reaction may include, but is not limited to, DNA polymerase, dTNPs, and a buffer.

Finally, the present invention is 1) wormwood ( Artemisia annua ) or Extracting DNA from a sample containing ragweed (A mbrosia artemisiifolia ); 2) preparing an amplification product by performing an amplification reaction of the genomic DNA isolated in step 1) using the composition comprising the primer set according to item 1 above; And 3) detecting the amplification product of step 2); It may be a discrimination method of ragweed (A mbrosia artemisiifolia ).

In one embodiment of the present invention, the sample in step 1 may be characterized in that it is a processed food or a sample digested from the gastric juice of an animal, but is not limited thereto.

In one embodiment of the present invention, the detection of the three steps may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto.

Through the present invention, using chloroplast and ITS nucleotide sequences, a specific primer was developed to distinguish wild wormwood, a wild herb, and ragweed, a poisonous herb, and the developed primers obtained significant results in reproducibility, specificity and reliability evaluation. In addition, it is expected that the present invention will be utilized not only in food but also in forensic analysis by confirming that the target species can be detected even in processed food and samples digested from artificial gastric juice.

1 is a diagram showing the PCR amplicons of wormwood and ragweed (meaning wormwood_ndhA, wormwood_rpoC1, wormwood_ITS, ragweed_ndhA, ragweed_rpoC1, ragweed_ITS, from the top. do).
FIG. 2 is a diagram showing Ct values obtained by sequentially diluting wild herb and poison ivy DNA using all the developed primer sets, plotted against the logarithm of the DNA concentration.
3 is a diagram showing the Ct value obtained from the reference binary mixture by plotting the log % [the values of the three primers of each species represent different colors (red, green, blue)].
Figure 4 is a diagram visualized using an agarose gel by extracting DNA from ragweed (A) and ragweed (B) samples treated with artificial gastric juice for each time period.

Hereinafter, the present invention will be described in detail by way of embodiments of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples of the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted, and , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, terms used in this specification are terms used to properly express preferred embodiments of the present invention, which may vary according to the intention of a user or operator, or customs in the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

Throughout this specification, '%' used to indicate the concentration of a specific substance is (w/w) % for solid/solid, (w/v) % for solid/liquid, and Liquid/liquid is (v/v) %.

Hereinafter, the present invention will be described in more detail through examples. However, the above embodiments and experimental examples are presented as examples for the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description thereof will be omitted. , and the present invention is not limited thereto. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

Example 1. Chloroplast and ITS region-based DNA marker development

In order to analyze the species-specific nucleotide sequence, wormwood and ragweed plant nucleotide sequences were obtained from the database of the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.gov/). Based on SNPs and InDels between these wild plants and poisonous plants, primers specific to each species were developed (see FIG. 1 and Table 1). In addition, when there is difficulty in developing a marker because the frequency of SNP is low, the specificity is increased by randomly giving a mismatch of the nucleotide sequence to the 5' part of the primer.

target species target SEQ ID NO: and primer name Primer length (bp) gene sequence (5'→3') amplicon length annealing
temperature Extension time gene (bp) (℃) (s) wormwood
( A. annua ) ndhA One ArA_ndhA_F 18 ATTCTTCAAGCTCTAGCG 100 58 30 2 ArA_ndhA_R 20 CTATAGACGGTCCAATACTG rpoC1 3 ArA_rpoC1_F 20 GCATCAATTTAGGTAGTCCC 89 58 30 4 ArA_rpoC1_R 21 ATAGTGAATTTCGATGGGAAT ITS 5 ArA_ITS_F 20 ATTCTCTGTAAAGGGAACTC 89 59 30 6 ArA_ITS_R 17 TAACGGCACGAAACAAA ragweed
( A. artemisiifolia ) ndhA 7 AmA_ndhA_F 18 AAACTGAATGGAATTGCA 159 61 30 8 AmA_ndhA_R 22 AACAATATCAATACAACCTAAC rpoC1 9 AmA_rpoC1_F 18 ACTCTACTTGGTAAACGA 114 56 30 10 AmA_rpoC1_R 19 CTGGAAAAGTTCTATTGCA ITS 11 AmA_ITS_F 20 TTGATAACACAGTCGTCTCG 91 57 30 12 AmA_ITS_R 18 AAGCATCATCGCAAGACA plant system Nuclear
18S rRNA 18S rRNA_F 24 TCGATGGTAGGATAGTGGCCTACT 109 63 30 18S rRNA_R 23 TGCTGCCTTCCTTGGATGTGGTA

Example 2. Efficiency evaluation of the developed marker

In order to confirm the specificity and sensitivity of the primers developed based on the chloroplast gene and ITS region, genomic DNAs of wild plants, sagebrush and poison ivy, were extracted and real-time PCR analysis was used. All extracted DNA was sequentially diluted from 10 ng to 0.001 ng, and when real-time PCR analysis was applied using primers for each target species, the amplification efficiency was 91.443 to 100.416 %, and the correlation coefficient (R ² ) showed a value of 0.997 to 1 (see FIG. 2 and Table 2).

target species primer Y (Slope) R ² Amplification Efficiency (%) wormwood
( A. annua ) ArA_ndhA -3.446 0.999 95.082 ArA_rpoC1 -3.546 0.999 91.443 ArA_ITS -3.316 One 100.265 ragweed
( A. artemisiifolia ) AmA_ndhA -3.312 0.997 100.416 AmA_rpoC1 -3.349 0.999 98.883 AmA_ITS -3.553 0.999 100.015

In addition, for the sensitivity analysis of the developed primer, wheat flour and the plant of the target species were mixed at a certain ratio (0.1, 1, 10, and 100%), and then DNA was extracted from this mixture using the CTAB method. The extracted DNA was amplified using the developed primer, and showed an amplification efficiency of 88.614 to 96.672% and a correlation coefficient (R ² ) value of 0.984 to 0.998. In addition, it was possible to confirm the limit of quantification (LOQ) of each primer. As a result, the limit of quantitation of all primers was up to 0.1%, and in this study, the Ct value at this time was designated as a cut-off line (see FIG. 3 and Table 3).

target species primer Slope R ² Amplification Efficiency (%) cut-off cycle wormwood
( A. annua ) ArA_ndhA -3.574 0.984 90.444 29 ArA_rpoC1 -3.543 0.985 91.545 29 ArA_ITS -3.629 0.998 88.614 25 ragweed
( A. artemisiifolia ) AmA_ndhA -3.511 0.997 96.672 27 AmA_rpoC1 -3.52 0.995 92.342 27 AmA_ITS -3.452 0.996 91.282 26

Example 3. Evaluation of specificity of the developed marker

The specificity was evaluated by applying the developed markers to a total of 19 species of flowers, crops, and herbs that are likely to be consumed together with wild plants and poisonous herbs. As a result, as shown in Table 4 below, it was confirmed that only the target species were specifically amplified by the ndhA/ITS and ragweed rpoC1/ITS primers.

Sample target species wormwood ( Artemisia annua ) ragweed ( Ambrosia artemisiifolia ) ndhA rpoC1 ITS ndhA rpoC1 ITS Edible and poisonous plants gomchwi
( Ligularia fischeri ) - - - - - - dong namul
( Caltha palustris ) - - - - - - wormwood
( Artemisia annua ) +++ +++ +++ - - - ragweed
( Ambrosia artemisiifolia ) - - - +++ +++ +++ conical
( Hemerocallis fulva ) - - - - - - road
( Veratrum maackii var. japonicum ) - - - - - - oleracea
(Oleracea) cabbage
( Brassica oleracea var. acephala ) - - - - - - cabbage
( Brassica oleracea var. capitata ) - - - - - - spinach
( Spinacia oleracea ) - - - + - - Grapeaceae
(Gramineae) oats
( Avena sativa ) - - - - - - rice
( Oryza sativa ) - - - - - - barley
( Hodeum vulgare ) - - - - - - sugarcane
( Sorghum bicolor ) - - - - - - wheat
( Triticum aestivum ) - - - - - - corn
( Zea mays ) - - - - - - vegetable
(Vegetables) green onion
( Allium fistulosum ) - - - - - - peanut
( Arachis hypogaea ) - - - - - - radish
( Raphanus sativa ) - + - - - - cucumber
( Cucumis sativus ) - - - - - -

^a +++, Positive amplification (amplify like target species cycle) ; ^b +, Positive amplification (amplify between target species cycle and non-target species cycle); ^c -, Negative amplification (amplified after than cut-off cycle)

Example 4. Efficacy and effectiveness evaluation through the application of the developed marker

In order to confirm the reproducibility of the developed marker, it was evaluated through cross-validation between laboratories. At this time, all reagents and analysis conditions were set identically to the existing conditions, and as a result, it was confirmed that there was reproducibility compared to the existing experimental results (see Table 5).

target species primer lab 1 lab 2 Y (Slope) R ² Amplification efficiency (%) Y (Slope) R ² Amplification Efficiency (%) wormwood
( A. annua ) ArA_ndhA -3.644 0.994 88.112 -3.642 0.996 88.2 ArA_rpoC1 -3.127 0.996 108.836 -3.164 0.997 107.0 ArA_ITS -3.35 One 98.846 -3.477 0.999 93.9 ragweed
( A. artemisiifolia ) AmA_ndhA -3.281 0.999 101.732 -3.268 0.998 102.3 AmA_rpoC1 -3.275 0.998 102.009 -3.178 0.992 106.4 AmA_ITS -3.27 0.998 102.209 -3.642 0.996 88.2

In addition, it was confirmed whether wild herbs, wormwood, and poisonous ragweed, were detected using a primer developed for 10 commercially available foods. Table 6 shows information on food purchased from the market.

Bell sample number sample type ingredient wormwood
( A. annua ) One Artemisia annua dried material Artemisia annua 100% 2 Artemisia annua dried material Artemisia annua 100% 3 Artemisia annua dried material Artemisia annua 100% 4 Artemisia annua Pill Artemisia annua 90%, rice 10% 5 Artemisia annua Pill Artemisia annua 90%, rice 10% 6 Artemisia annua Pill Artemisia annua 100% 7 Artemisia annua Pill Artemisia annua 95%, wheat 5% 8 Artemisia annua Pill Artemisia annua 100% 9 Artemisia annua powder Artemisia annua 100% 10 Artemisia annua powder Artemisia annua 100%

All food extracted from food prior to this analysis was confirmed for the presence of DNA using 18s rRNA primer (positive control). DNA extracted from food was amplified using the developed primer, and whether the target species was detected is shown in Table 7 below.

Commercial food products that declare to contain A. annua in labeling sample number plant system
(18s rRNA) ArA_ITS ArA_ndhA ArA_rpoC1 AmA_ITS AmA_ndhA AmA_rpoC1 One 13.317 13.559 19.142 19.035 34.497 31.907 34.235 ±0.038 ±0.161 ±0.091 ±0.039 ±1.432 ±0.845 ±0.321 2 13.576 14.165 19.252 19.238 34.305 32.98 34.451 ±0.026 ±0.13 ±0.124 ±0.038 ±0.855 ±1.086 ±0.85 3 13.622 14.263 18.851 18.978 34.377 33.972 32.65 ±0.017 ±0.041 ±0.054 ±0.07 ±0.458 ±1.872 ±0.515 4 13.225 14.052 18.453 18.169 31.746 32.921 31.477 ±0.083 ±0.052 ±0.099 ±0.125 ±0.151 ±2.009 ±0.395 5 16.097 16.572 20.585 20.555 34.731 34.143 34.033 ±0.055 ±0.075 ±0.085 ±0.089 ±1.719 ±2.549 ±0.338 6 13.314 13.873 17.849 17.841 34.915 35.873 31.923 ±0.042 ±0.049 ±0.054 ±0.115 ±0.245 ±3.217 ±0.94 7 15.02 15.727 20.274 20.123 35.726 33.301 34.617 ±0.046 ±0.102 ±0.088 ±0.041 ±1.826 ±1.799 ±1.356 8 14.46 15.161 19.09 19.038 32.544 32.96 35.223 ±0.044 ±0.198 ±0.1 ±0.041 ±0.625 ±1.472 ±0 9 13.32 13.95 17.99 18.106 31.954 36.593 28.393 ±0.08 ±0.081 ±0.039 ±0.008 ±0.372 ±2.628 ±0.118 10 12.831 14.263 18.024 17.934 32.291 34.562 32.934 ±0.089 ±0.041 ±0.101 ±0.043 ±0.626 ±0.365 ±0.47

As shown in Table 7 above, it was confirmed that all primers specifically detected each target species.

Furthermore, if poisonous herbs were mistaken for wild vegetables and ingested, it was checked whether they could be detected by treating them with artificial gastric juice in order to use them as a tool to identify causative plants in vomit and stomach. As a result, it was confirmed that the detection of the target species in all primers was possible until the target species was treated in artificial gastric juice for a minimum of 2 hours and a maximum of 6 hours (see Table 8).

Bell primer processing time no processing 1 hours 2 hours 4 hours 6 hours wormwood
( A. annua ) ArA_ndhA 19.084 19.477 18.64 20.77 22.235 ±0.094 ±0.053 ±0.608 ±0.046 ±0.053 ArA_rpoC1 18.889 19.215 18.238 20.196 21.358 ±0.097 ±0.05 ±0.132 ±0.078 ±0.062 ArA_ITS 15.548 17.015 17.032 21.545 24.132 ±0.024 ±0.021 ±0.02 ±0.03 ±0.203 ragweed
( A. artemisiifolia ) AmA_ndhA 16.174 18.696 18.959 23.361 26.464 ±0.006 ±0.046 ±0.023 ±0.01 ±0.045 AmA_rpoC1 16.926 18.914 18.255 21.408 24.746 ±0.015 ±0.065 ±0.071 ±0.085 ±0.009 AmA_ITS 13.769 14.642 14.313 16.67 19.348 ±0.063 ±0.031 ±0.059 ±0.214 ±0.048

As such, it is confirmed that the reason for the different detection time for each primer is because the amplicon size of each primer is different. was found to be detectable (see FIG. 4).

Example 5. Reliability evaluation of developed markers

Incorporation was determined by applying the developed primer to a total of 20 blind samples mixed in an arbitrary ratio. Prior to the experiment, the presence of DNA was checked using 18s rRNA primer. It was confirmed that the results of the blinded test showed the results consistent with the actual mixing in 19 of the total of 20 blind samples except for 1, and as a result of analyzing this with Kappa statistics, it was confirmed that the result value was 0.75 or higher, indicating high reliability. could be (see Table 9).

sample number ingredient 18S rRNA primer (Ct) experimenter 1 experimenter 2 Whether Concordance or Discordance One ArA 15.991±0.002 - ^b - C ^c 2 ArA+AmA 16.332±0.093 - + ^a d ^d 3 ArA 17.244±0.061 - - C 4 ArA+AmA 15.134±0.070 + + C 5 ArA+AmA 16.921±0.194 + + C 6 ArA+AmA 16.072±0.254 + + C 7 ArA+AmA 15.110±0.197 + + C 8 ArA+AmA 15.898±0.053 + + C 9 ArA+AmA 16.690±0.011 + + C 10 ArA+AmA 16.462±0.001 + + C 11 ArA+AmA 17.239±0.097 + + C 12 ArA 17.310±0.134 - - C 13 ArA+AmA 15.949±0.012 + + C 14 ArA+AmA 15.718±0.074 + + C 15 ArA+AmA 17.191±0.056 + + C 16 ArA+AmA 15.698±0.057 + + C 17 ArA+AmA 16.573±0.044 + + C 18 ArA 15.050±0.116 - - C 19 ArA+AmA 16.741±0.182 + + C 20 ArA+AmA 15.777±0.108 + + C ArA is wormwood; AmA represents ragweed. ^a detection. ^b notdetection.
^c Concordance between two observers.
^d Discordance between two observers.

Therefore, a primer specific to wild plants and poisonous plants was developed using the chloroplast and ITS base sequences through the present invention. The developed primer obtained significant results in reproducibility, specificity, and reliability evaluation, and it was possible to detect target species even in processed food and samples digested from artificial gastric juice. Therefore, it is expected to be useful not only in food but also in forensic analysis.

So far, the present invention has been looked at with respect to preferred embodiments thereof. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Kangwon National University Industry-Academic Cooperation Foundation KOREA FOOD & DRUG ADMINISTRATION <120> Biomarker for discrimination between Artemisia annua and Ambrosia artemisiifolia <130> PN2003-106 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ArA_ndhA_F <400> 1 attcttcaag ctctagcg 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ArA_ndhA_R <400> 2 ctatagacgg tccaatactg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ArA_rpoC1_F <400> 3 gcatcaattt aggtagtccc 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ArA_rpoC1_R <400> 4 atagtgaatt tcgatgggaa t 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ArA_ITS_F <400> 5 attctctgta aagggaactc 20 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ArA_ITS_R <400> 6 taacggcacg aaacaaa 17 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AmA_ndhA_F <400> 7 aaactgaatg gaattgca 18 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AmA_ndhA_R <400> 8 aacaatatca atacaaccta ac 22 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AmA_rpoC1_F <400> 9 actctacttg gtaaacga 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AmA_rpoC1_R <400> 10 ctggaaaagt tctattgca 19 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AmA_ITS_F <400> 11 ttgataacac agtcgtctcg 20 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AmA_ITS_R <400> 12 aagcatcatc gcaagaca 18

Claims (9)

a primer set represented by each nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; a primer set represented by each nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; a primer set represented by each nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; a primer set represented by each nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8; a primer set represented by each nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10; And SEQ ID NO: 11 and SEQ ID NO: 12 comprising a primer set represented by each nucleotide sequence as an active ingredient, Artemisia annua ) and ragweed ( Ambrosia artemisiifolia ) Biomarker composition for discrimination.
The method of claim 1,
a primer set represented by each nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; and
The primer set represented by each nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 is characterized by amplifying the ndhA gene ( Artemisia annua ) and Ragweed (A mbrosia artemisiifolia ) Biomarker composition for discrimination.
The method of claim 1,
a primer set represented by each nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; and
The primer set represented by each nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10 is characterized by amplifying the rpoC1 gene ( Artemisia annua ) and Ragweed (A mbrosia artemisiifolia ) Biomarker composition for discrimination.
The method of claim 1,
a primer set represented by each nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; and
The primer set represented by each nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12 amplifies the ITS gene. Artemisia annua and Ragweed (A mbrosia artemisiifolia ) Biomarker composition for discrimination.
Artemisia annua according to claim 1 and Ragweed (A mbrosia artemisiifolia ) Biomarker composition for discrimination; And a reagent for performing an amplification reaction; containing Artemisia annua ) and A kit for identification of ragweed (A mbrosia artemisiifolia ).
6. The method of claim 5,
The reagent for performing the amplification reaction is Artemisia annua , characterized in that it includes a DNA polymerase, dTNPs and a buffer A kit for identification of ragweed (A mbrosia artemisiifolia ).
1) Wormwood ( Artemisia annua ) or Extracting DNA from a sample containing ragweed (A mbrosia artemisiifolia );
2) preparing an amplification product by performing an amplification reaction of the genomic DNA isolated in step 1) using the composition comprising the primer set according to item 1 above; and
3) detecting the amplification product of step 2); containing mugwort ( Artemisia annua ) and A method of identification of ragweed (A mbrosia artemisiifolia ).
8. The method of claim 7,
The sample of step 1 is a sample digested from processed food or animal gastric juice ( Artemisia annua ) and A method of identification of ragweed (A mbrosia artemisiifolia ).
8. The method of claim 7,
The detection of the three steps is carried out through capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement or phosphorescence measurement ( Artemisia annua ) and A method of identification of ragweed (A mbrosia artemisiifolia ).

Images