CN114410820B - High-sensitivity primer group, kit and method for identifying stramonium toxic plant - Google Patents

Abstract

The invention discloses a primer group, a kit and an identification method for identifying toxic stramonium plants, wherein the primer group comprises primers da F and da R, and the nucleotide sequence of the primers is as follows: da F:5'-CAAAAACCTTGGCTGCGGTT-3'; da R:5'-TGAAGGGTCTAGGAGCACAAA-3'. The identification method comprises the following steps: 1) Extracting genome DNA of a sample to be detected; 2) Carrying out PCR amplification on the extracted genome DNA by adopting the primer group or the kit; 3) Detecting whether the PCR amplified product contains target amplified fragments or not, and identifying the sample containing the target amplified fragments as positive of toxic stramonium plants. The invention can rapidly and accurately distinguish toxic stramonium plants from other confusing materials, has strong detection specificity and high sensitivity of 1 ng/mu l.

Description

High-sensitivity primer group, kit and method for identifying stramonium toxic plant

Technical Field

The invention relates to the technical field of stramonium plant identification, in particular to a high-sensitivity primer group, a kit and a method for identifying stramonium toxic plants.

Background

In recent years, poisoning events caused by toxic organisms in China are reported frequently, and the toxic organisms become public health problems which are serious to public health, and the toxic organisms mainly comprise toxic microorganisms, toxic animals and plants and toxic mushrooms. Microorganisms are statistically the leading cause of food poisoning, but toxic animals, plants and toxic mushrooms are the leading cause of toxic mortality. Toxic plants refer to plants that have been shown to have a potential to enter the body by ingestion, contact or other means, causing death or long-term or temporary injury to the body function in humans, domestic animals or some other animal, all of which are referred to as toxic plants. The method has the advantages that the method is widely and easily available, people always have the habit of picking wild plants to eat, various Chinese herbal medicines are widely used in traditional Chinese medicine treatment, the opportunities of miseating and contacting toxic plants are large, the mistakes are easy to be considered as food materials or medicinal materials, in addition, some important economic crops, edible plants, a plurality of ornamental plants for gardens and the like have greater or smaller toxicity, and the occurrence of plant poisoning caused by the toxicity is not rare. Toxic plants have wide and prominent influence on life of people. Toxic plants can cause acute and chronic poisoning, and part of plants have mutagenic, cancerous and teratogenic effects. There are about 1300 kinds of toxic plants in our country, and they are distributed in 140 families.

The stramonium is a Solanaceae plant, and the whole plant of the stramonium is extremely toxic, and has the highest seed toxicity, and the tender leaves, flowers, roots and stems. Datura flower (academic name: datura metelL), which is a plant of the genus Datura, is called dried flower of Datura stramonium, and is called flos Rhododendri mollis, paeniaca verniciflua, datura stramonium. The clinical report indicates that the mistakes eating the seeds, flowers or the self-made medicated liquor of the stramonium are mostly seen. The seedling of the stramonium is easy to be confused with edible wild herbs such as wild herbs, spinach, shepherd's purse and the like, so that the stramonium is caused to be eaten by mistake and poisoned; flower-like horn, children are easy to eat by mistake to cause poisoning; the method is characterized in that a pharmacy buys the sauropus leaves of patients, the sauropus leaves are mistakenly grabbed into dried flowers of stramonium, and the dried flowers are sold to the patients to cause poisoning, and the sauropus flowers are mistakenly replaced by the Chinese trumpet flowers in a traditional Chinese medicine formula in the pharmacy, so that the patients are poisoned for a plurality of times; there are reports at home and abroad that the drug farmer venues datura flower as a campsis flower; or flos Daturae Metelis is decocted with water for oral administration, and can be used as flos Lonicerae for treating children poisoning; toxic plant poisoning events of various datura species frequently occur.

In the world, there are reports of stramonium planting and poisoning, and misdiagnosis is the biggest obstacle in the treatment of stramonium poisoning. Early, rapid and accurate diagnosis, and rapid elimination of poison, and symptomatic use of antidote are key to improving rescue success rate and cure rate.

Disclosure of Invention

Aiming at the problems, the invention provides a high-sensitivity primer group and a kit capable of rapidly and accurately identifying stramonium toxic plants, which concretely adopts the following technical scheme:

a primer set for identifying a toxic stramonium plant, the primer set comprising primers da F, da R having the nucleotide sequence:

da F：5’-CAAAAACCTTGGCTGCGGTT-3’；

da R：5’-TGAAGGGTCTAGGAGCACAAA-3’。

in another embodiment, the primer set further comprises a probe da P, the nucleotide sequence of the probe da P is: TGGTGGTTGGAACTCAACTCTCGT;

preferably, the probe da P is marked with a fluorescent reporter group at the 5 'end and a fluorescent quenching group at the 3' end; further preferably, the fluorescence reporter group is FAM and the fluorescence quencher group is BHQ1.

Preferably, the toxic Datura plant comprises Datura innoxia, datura Metel, and Datura Datura stramonium.

A kit for identifying toxic Datura plants comprises the primer set and a reaction reagent for PCR amplification or real-time fluorescence PCR amplification.

The kit also comprises a DNA extraction reagent, a positive control and a negative control, wherein the reaction reagent for PCR amplification or real-time fluorescence PCR amplification comprises DNA polymerase and DNA polymerase buffer solution.

In another aspect of the present invention, there is provided a method for identifying toxic Datura plants, comprising the steps of:

1) Extracting genome DNA of a sample to be detected;

2) Performing PCR amplification on the extracted genomic DNA by using the primer set or the kit;

3) Detecting whether the PCR amplified product contains target amplified fragments, and identifying the sample containing the target amplified fragments as positive to toxic stramonium plants, wherein the size of the target amplified fragments is 181bp.

The PCR amplification reaction system comprises: the total volume was 25. Mu.l, and 1. Mu.l of each forward and reverse primer was 2X Taq PCR MasterMix 12.5.5. Mu.l, 1. Mu.l of genomic DNA and the balance ddH were used at a concentration of 10. Mu.M ₂ O；

The reaction conditions for PCR amplification in the step 2) are as follows: 94 ℃ for 3min; cycling for 30 times at 94 ℃ for 30s,54 ℃ for 30s and 72 ℃ for 1min; 72 ℃ for 5min;

preferably, in the step 3), agarose gel electrophoresis is used to detect whether the PCR amplification product contains the target band.

In yet another aspect, the present invention provides a real-time fluorescent PCR method for identifying toxic Datura plants, comprising the steps of:

1) Extracting genome DNA of a sample to be detected;

2) And (3) carrying out real-time fluorescence PCR amplification on the extracted genome DNA by adopting the primer group or the kit, judging whether the object to be detected contains toxic stramonium plants according to the amplification result, judging that the stramonium species is positive if Ct is less than 30, and judging that the stramonium species is negative if Ct is more than or equal to 30.

The reaction system of the real-time fluorescence PCR is as follows: the total volume was 20. Mu.l, wherein 2 XPromix Ex Taq was 10. Mu.l, each 1. Mu.l of primer da F/da R at a concentration of 10. Mu.M, probe da P0.5. Mu.l at a concentration of 10. Mu.M, genomic DNA 1. Mu.l, and the balance ddH ₂ O; the qPCR amplification procedure was: pre-denaturation at 95℃for 20s, denaturation at 95℃for 3s for 40 cycles, annealing at 54℃for 30s.

In a final aspect, the invention provides the use of the aforementioned primer set or kit for identifying toxic Datura plants; preferably, the toxic Datura plant comprises Datura capillaris, datura Metel, and Datura Datura stramonium.

The beneficial effects of the invention are as follows: based on other plants which are not easy to distinguish in morphology with the stramonium, a technology for rapidly identifying the toxic stramonium is established, and the primer group, the kit and the detection method provided by the invention can rapidly and accurately distinguish the toxic stramonium from other confusing materials, and have strong detection specificity; the detection sensitivity is as high as 1 ng/. Mu.l, and the detection sensitivity is very high; can meet the early, rapid and accurate diagnosis in the poisoning event, thereby using antidote for symptomatic use as soon as possible and improving the rescue success rate and cure rate in the poisoning event.

Drawings

FIG. 1 is a diagram showing the results of comparing the sequences of ITS2 genes of Datura and similar species using BioEdit software, wherein the material names of species represented by abbreviated letters are shown in Table 1; "-" indicates a missing base; "." means the same base; the box part is the specific base sequence of Datura species.

FIG. 2 shows the results of the electrophoresis of the common PCR specific amplification and sensitivity detection, wherein FIG. a shows the results of the primer specific detection, lanes 1-14 are samples corresponding to numbers 1-14 in Table 1 in sequence, and M is DL500 Marker; FIG. b shows the results of primer sensitivity assays, lanes 1-5 show template DNA at different concentrations, in order of 100 ng/. Mu.l, 10 ng/. Mu.l, 1 ng/. Mu.l, 0.01 ng/. Mu.l, 0.001 ng/. Mu.l, and lane 6 shows ddH ₂ O and M are DL500 Marker.

FIG. 3 is a real-time fluorescent quantitative PCR amplification curve.

Detailed Description

The invention is further illustrated, but is not limited, by the following examples.

The experimental methods in the following examples are conventional methods unless otherwise specified; the biological and chemical reagents used, unless specified, are commercially available and conventional.

Example 1

1. Experimental materials

The specific names and material sources of the materials selected for the experiments are shown in table 1, and the plant materials used for the experiments are silica gel dried leaves.

Table 1 Experimental materials and sources thereof

Numbering device	Abbreviations (abbreviations)	Sample name	Latin name	Generic name	Source
						1	di-1	Herba Daturae Metelis	Datura innoxia	Datura genus	Beijing
2	di-2	Herba Daturae Metelis	Datura innoxia	Datura genus	Shandong province
						3	di-3	Herba Daturae Metelis	Datura innoxia	Datura genus	Shandong province
4	di-4	Herba Daturae Metelis	Datura innoxia	Datura genus	Shandong province
						5	dm-1	Datura flower	Datura metel	Datura genus	Yunnan (Yunnan) province
6	dm-4	Datura flower	Datura metel	Datura genus	Chinese medicine inspection standard sample
						7	ds-1	Datura stramonium (L.) Ohwi	Datura stramonium	Datura genus	Liaoning (Liaoning)
8	ds-4	Datura stramonium (L.) Ohwi	Datura stramonium	Datura genus	(Jiangxi)
						9	ds-5	Datura stramonium (L.) Ohwi	Datura stramonium	Datura genus	Chinese medicine inspection standard sample
10	lj-1	Honeysuckle	Lonicera japonica	Lonicera genus	(Jiangxi)
						11	lj-2	Honeysuckle	Lonicera japonica	Lonicera genus	Chinese medicine inspection standard sample
12	cr-1	Chinese trumpet creeper	Campsis radicans	Campsis genus	Chinese medicine inspection standard sample
						13	ss	Saururus chinensis (L.) Baker	Sauropus spatulifolius	Gekko Swinhonis genus	Chinese medicine inspection standard sample
14	cr-2	Chinese trumpet creeper	Campsis radicans	Campsis genus	Guangdong aspect

2. Experimental methods and results

1. Extraction of genomic DNA

100mg of the silica gel dried test material leaf in Table 1 was placed in a 2ml EP tube with 4mm steel balls added in advance, rapidly placed in liquid nitrogen and cooled for 30min, and the EP tube was placed on a Geno/Grinder 2000 (SPEX samplePrep) high throughput Grinder, ground for 3min at 1000rpm/min. Leaf total DNA was extracted using a plant genomic DNA extraction kit (DNeasy Plant MiniKit, qiagen) for later use as a template for subsequent PCR amplification.

2. ITS2 sequence PCR amplification and sequencing

The study selects the DNA bar code international general sequence ITS2, and the primer sequence is as follows:

ITS2-F：ATGCGATACTTGGTGTGAAT(SEQ ID NO.1)；

ITS2-R：GACGCTTCTCCAGACTACAAT(SEQ ID NO.2)。

the PCR reaction system was 25. Mu.L, which contained KODone PCR mastermix (Toyobo (Shanghai) Biotechnology Co., ltd.) in 12.5. Mu.L, 1. Mu.L of the extracted DNA template, primers ITS2-F, ITS2-R (each at a concentration of 10. Mu.M) in each of 0.75. Mu.L, ddH ₂ O10. Mu.L. The PCR amplification procedure for ITS2 sequences was: pre-denaturation at 95℃for 1min; the template is deformed for 10s at 98 ℃, annealed for 5s at 56 ℃ and subjected to 40 cycles; extending at 68℃for 1s. After the PCR products were detected by 1% agarose gel electrophoresis, two-way sequencing was performed by Shanghai Biotechnology Co., ltd.

3. Specific primer design

The sequencing peak pattern was corrected using Codon CodeAligner V3.0.3.0 to remove low mass sequences and primer regions. The 5.8S and 28S segments at both ends were then removed from all sequences and the desired GenBank sequences using a Hidden Markov Model (HMMER) based annotation method to obtain ITS2 spacer sequences.

All sequences were analyzed by comparison with BioEdit software (fig. 1) and found to be specific for other materials in the 18bp-216bp region of the ITS2 gene of stramonium (shown in SEQ ID No. 3), suitable for designing upstream and downstream specific primers, and the candidate primers were screened and evaluated for specificity and sensitivity, and the information of the selected specific primers da F, da R are shown in table 2:

TABLE 2 specific primers for the identification of Datura plants

Primer name	Primer sequence (5 '-3')	SEQ ID NO.	Primer sites
				Upstream primer da F	CAAAAACCTTGGCTGCGGTT	SEQ ID NO.4	29bp-48bp interval
Downstream primer da R	TGAAGGGTCTAGGAGCACAAA	SEQ ID NO.5	Interval 189bp-209bp

4. Ordinary PCR specific amplification and sensitivity detection

The specificity of the primers was detected by PCR amplification of 14 samples of DNA from Table 1 using the primer pair da F/da R designed in this study.

PCR reaction system: total volume 25 μl, containing: 2X Taq PCR Master mix (Tiangen Biochemical Co., ltd., product No. KT 201) 12.5. Mu.L, primers da F/da R (10. Mu.M concentration) 1. Mu.L each, DNA template 1. Mu.L, and the balance ddH ₂ O。

The PCR amplification procedure was: 94 ℃ for 3min; cycling for 30 times at 94 ℃ for 30s,54 ℃ for 30s and 72 ℃ for 1min; and at 72℃for 5min.

After the reaction, 5. Mu.L of the amplified product was collected and subjected to 1.5% agarose gel electrophoresis to obtain a detection result. The result of the specificity detection electrophoresis is shown in FIG. 2a, and the electrophoresis result shows that only 9 samples of the stramonium genus have specificity amplification, the length of the amplified fragment is about 181bp, and the other 5 samples have no amplified fragment, so that the primer has specificity to the stramonium genus.

Meanwhile, BLAST comparison results of the amplified sequences show that the target fragment belongs to the stramonium genus.

The template DNA of sample No. 9 in table 1 was used for gradient concentration dilution for sensitivity detection, and the concentration gradient was set as follows: 100 ng/. Mu.l, 10 ng/. Mu.l, 1 ng/. Mu.l, 0.01 ng/. Mu.l and 0.001 ng/. Mu.l, and the detection results are shown in FIG. 2b, when the concentration of the template DNA is 1 ng/. Mu.l, a bright detection band can be still generated, and the detection sensitivity is high.

5. TaqMan probe design

And (3) designing a seed-specific TaqMan probe based on the screened seed-specific primer.

According to the sequence comparison result, in the respective specific primer range of the stramonium species, a species-specific fluorescent probe is designed in an upstream and downstream primer-to-primer region through PrimerQuest Tool (https:// sg.idtdna.com/PrimerQuest/Home/Index) software, and the probe design principle is as follows: (1) the first base at the 5' end cannot be G; (2) the first four bases of the 3' end avoid 3 or more Gs; (3) the closer the probe is to the primer, the better; (4) GC% between 30% and 70% and annealing temperature between 65 ℃ and 67 ℃; (5) the probe length is between 13bp and 25 bp; (6) The repeated base is avoided, particularly more than 4 repeated G are avoided, and 6A are avoided to appear continuously; (7) selecting a sequence having more C than G as a probe. The probe was commissioned for synthesis by Shanghai Biotechnology Co., ltd.

The sequence of the designed probe da P is (SEQ ID NO. 6):

5’-(FAM)TGGTGGTTGGAACTCAACTCTCGT(BHQ1)-3’。

6. fluorescent quantitative PCR reaction

The total real-time fluorescence PCR reaction system is 20. Mu.l, wherein the total real-time fluorescence PCR reaction system comprises 0. Mu.l of 2 XPromix Ex Taq (Takara), 1. Mu.l of upstream and downstream primers da F/da R (10. Mu. Mol/L), 0.5. Mu.l of probe da P (10. Mu. Mol/L) and ddH ₂ O6.5. Mu.l, 1. Mu.l of DNA template; the reaction conditions were 95℃pre-denaturation for 20s,40 cycles of 95℃denaturation for 3s, 54℃annealing for 30s. The material in Table 1And carrying out fluorescent quantitative PCR reaction on the template DNA extracted by the material according to the reaction system and the amplification procedure.

The resulting amplification curve (as shown in FIG. 3) shows that only 9 samples of Datura had specific amplification of DNA, CT < 30; while the other 5 confusing species of DNA and ddH ₂ The O control has no fluorescence increase signal before 30 th cycle reaction, which indicates that the probe and primer combination has specificity to Datura species only, if Ct is less than 30, the probe and primer combination is judged to be positive to Datura species, and if Ct is more than or equal to 30, the probe and primer combination is judged to be negative to Datura species.

Sequence listing

<110> national institute of inspection and quarantine science

<120> high sensitivity primer set, kit and method for identifying toxic plants of Datura

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer ITS2-F

<400> 1

atgcgatact tggtgtgaat 20

<210> 2

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer ITS2-R

<400> 2

gacgcttctc cagactacaa t 21

<210> 3

<211> 230

<212> DNA

<213> artificial sequence

<220>

<223> ITS2 Gene of Datura plant

<400> 3

cgcatcgcgt cgcccccgca ctccgcacca aaaaccttgg ctgcggttgt gtcgtgggac 60

ggatactggc ctcccgtgag cccccgagcc tgcggctggc ctaaatgcga gtccacgtcg 120

acggacgtca cggcaagtgg tggttggaac tcaactctcg taatgtcgtg gctacagccc 180

gtcgctcgtt tgtgctccta gacccttcac gcgcttaggc gctccgaccg 230

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer da F

<400> 4

caaaaacctt ggctgcggtt 20

<210> 5

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer da R

<400> 5

tgaagggtct aggagcacaa a 21

<210> 6

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> Probe da P

<400> 6

tggtggttgg aactcaactc tcgt 24

Claims (4)

1. A method for identifying a confusing article of toxic stramonium and its non-related genus, comprising the steps of:

1) Extracting genome DNA of a sample to be detected;

2) Performing PCR amplification on the extracted genome DNA by adopting a primer group;

the primer group comprises primers da F and da R, and the nucleotide sequence of the primers is as follows:

da F：5’-CAAAAACCTTGGCTGCGGTT-3’；

da R：5’-TGAAGGGTCTAGGAGCACAAA-3’；

the PCR amplification reaction system comprises: the total volume was 25. Mu.l, and 1. Mu.l of each forward and reverse primer was 2X Taq PCR MasterMix 12.5.5. Mu.l, 1. Mu.l of genomic DNA and the balance ddH were used at a concentration of 10. Mu.M ₂ O; the concentration of genomic DNA may be as low as 1ng/ul;

the reaction conditions for PCR amplification were: 94 ℃ for 3min; cycling for 30 times at 94 ℃ for 30s,54 ℃ for 30s and 72 ℃ for 1min; 72 ℃ for 5min;

3) Detecting whether the PCR amplification product contains a target amplification fragment, wherein a sample containing the target amplification fragment is identified as positive by toxic stramonium plants, and the size of the target amplification fragment is 181bp;

the toxic Datura plant comprises Datura inoxia, datura Metel, and Datura Datura stramonium;

the non-kindred confusing products comprise honeysuckle Lonicera japonica, campsis radials, sauropus sputifoliatus.

2. The method according to claim 1, characterized in that: and 3) detecting whether the PCR amplification product contains a target band or not by agarose gel electrophoresis.

3. A real-time fluorescent PCR method for identifying a toxic stramonium plant and its non-closely related confusing products, comprising the steps of:

1) Extracting genome DNA of a sample to be detected;

2) Carrying out real-time fluorescence PCR amplification on the extracted genome DNA by adopting a primer group, judging whether an object to be detected contains toxic stramonium plants according to an amplification result, if Ct is less than 30, judging that stramonium species is positive, and if Ct is more than or equal to 30, judging that stramonium species is negative;

the primer group comprises primers da F, da R and a probe da P, and the nucleotide sequence of the primer group is as follows:

da F：5’-CAAAAACCTTGGCTGCGGTT-3’；

da R：5’-TGAAGGGTCTAGGAGCACAAA-3’；

the nucleotide sequence of probe da P is: TGGTGGTTGGAACTCAACTCTCGT; the 5 'end of the probe da P is marked with a fluorescence report group, and the 3' end is marked with a fluorescence quenching group;

the reaction system of the real-time fluorescence PCR is as follows: the total volume was 20. Mu.l, wherein 2 XPromix Ex Taq was 10. Mu.l, each 1. Mu.l of primer da F/da R at a concentration of 10. Mu.M, probe da P0.5. Mu.l at a concentration of 10. Mu.M, genomic DNA 1. Mu.l, and the balance ddH ₂ O; the qPCR amplification procedure was: pre-denaturation at 95℃for 20s, denaturation at 95℃for 3s for 40 cycles, annealing at 54℃for 30s;

the concentration of genomic DNA may be as low as 1ng/ul;

the toxic Datura plant comprises Datura inoxia, datura Metel, and Datura Datura stramonium;

the non-kindred confusing products comprise honeysuckle Lonicera japonica, campsis radials, sauropus sputifoliatus.

4. A method according to claim 3, characterized in that: the fluorescence report group is FAM, and the fluorescence quenching group is BHQ1.