CN114410820A - High-sensitivity primer group, kit and method for identifying toxic plants in datura - Google Patents
High-sensitivity primer group, kit and method for identifying toxic plants in datura Download PDFInfo
- Publication number
- CN114410820A CN114410820A CN202210076523.9A CN202210076523A CN114410820A CN 114410820 A CN114410820 A CN 114410820A CN 202210076523 A CN202210076523 A CN 202210076523A CN 114410820 A CN114410820 A CN 114410820A
- Authority
- CN
- China
- Prior art keywords
- datura
- toxic
- plants
- pcr amplification
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group, a kit and an identification method for identifying toxic datura plants, wherein the primer group comprises primers da F and da R, and the nucleotide sequence of the primer group is as follows: da F: 5'-CAAAAACCTTGGCTGCGGTT-3', respectively; da R: 5'-TGAAGGGTCTAGGAGCACAAA-3' are provided. The identification method comprises the following steps: 1) extracting the genome DNA of a sample to be detected; 2) performing PCR amplification on the extracted genome DNA by using the primer group or the kit; 3) and detecting whether the PCR amplification product contains the target amplification fragment or not, and identifying a sample containing the target amplification fragment as a toxic datura plant positive. The method can quickly and accurately distinguish toxic datura plants from other easily-confused materials, and has strong detection specificity and high sensitivity up to 1 ng/mu l.
Description
Technical Field
The invention relates to the technical field of datura plant identification, in particular to a high-sensitivity primer group, a kit and a method for identifying toxic plants in datura.
Background
In recent years, poisoning events caused by toxic organisms in China are frequently reported and become public health problems which are serious to public health, and the toxic organisms mainly comprise toxigenic microorganisms, toxic animals and plants and toxic mushrooms. According to statistics, microorganisms are the primary cause of food poisoning, but poisonous animals and plants and poisonous mushrooms are the main causes of poisoning and death. Toxic plants are plants which are known as toxic plants and can enter the body through ingestion, contact or other routes, so that people, livestock or some other animals die or the body functions are damaged chronically or temporarily. The wild plant-picking Chinese herbal medicine composition is wide and easy to obtain, a habit of picking wild plants for eating is always existed in folks, various Chinese herbal medicines are used in a large amount in the traditional Chinese medicine treatment, the chances of eating by mistake and contacting with toxic plants are high, the toxic plants are easy to be mistaken for food materials or medicinal materials, in addition, some important economic crops, edible plants, a plurality of garden ornamental plants and the like have more or less toxicity, and the plant poisoning events caused by the toxicity are not rare. Toxic plants have a wide and prominent influence on the life of people. The toxic plants can cause acute and chronic poisoning, and some plants have mutagenic, cancerating, and teratocarcinoma effects. The toxic plants in China are about 1300 kinds and are distributed in 140 families.
Datura is a solanaceous plant, and the whole plant of the Datura is virulent, with the greatest toxicity of seeds, and then tender leaves, flowers, roots and stems. Flos Daturae Metelis (Datura Metel), also known as flos Rhododendri mollis, flos Pterocarpi Fortunei, flos Solani Melongenae, and flos Daturae Metelis, is a plant of Daturae, and the traditional Chinese medicine flos Daturae Metelis generally refers to the dried flower of Daturae Metelis. Clinical reports show that the datura stramonium seed, flower or self-made datura stramonium medicinal liquor is often poisoned by mistake. Seedlings of datura stramonium are easy to be confused with edible wild vegetables such as wild vegetables, spinach and shepherd's purse to cause mistaking poisoning; the flower looks like a trumpet, so children are easy to eat by mistake to cause poisoning; the method is characterized in that a drugstore mistakenly grabs the spatholobus rostratum leaves bought by a patient into datura flower to be sold to the patient to cause poisoning, and the flos datura is mistakenly substituted for the campsis in a traditional Chinese medicine formula by a pharmacy, so that the patient is poisoned for several times; there is a report that datura flower is sold as campsis flower by pesticide farmers at home and abroad; or flos Daturae Metelis is decocted in water for oral administration, and is used as flos Lonicerae, which causes poisoning of flos Daturae Metelis for children; various toxic plants of Datura have been frequently poisoned.
There are reports of planting and poisoning of datura stramonium in the world, and misdiagnosis is the biggest obstacle in treating datura stramonium poisoning. Early, fast and accurate diagnosis, and rapid elimination of poison, and the use of antidote according to symptoms is the key to improve the success rate and cure rate of rescue.
Disclosure of Invention
The invention aims to solve the problems and provides a high-sensitivity primer group and a kit which can quickly and accurately identify toxic plants in datura, and the specific technical scheme is as follows:
a primer group for identifying toxic datura plants, wherein the primer group comprises primers da F and da R, and the nucleotide sequences of the primers da F and da R are as follows:
da F：5’-CAAAAACCTTGGCTGCGGTT-3’；
da R：5’-TGAAGGGTCTAGGAGCACAAA-3’。
in another embodiment, the primer set further comprises a probe da P, and the nucleotide sequence of the probe da P is: TGGTGGTTGGAACTCAACTCTCGT, respectively;
preferably, the 5 'end of the probe da P is marked with a fluorescent reporter group, and the 3' end of the probe da P is marked with a fluorescent quencher group; further preferably, the fluorescence reporter is FAM and the fluorescence quencher is BHQ 1.
Preferably, the toxic Datura plants include Datura innoxia, Datura metel, Datura stramnonium.
A kit for identifying toxic datura plants comprises the primer group and a reaction reagent for PCR amplification or real-time fluorescence PCR amplification.
The kit also comprises a DNA extraction reagent, a positive control and a negative control, and the reaction reagent for PCR amplification or real-time fluorescence PCR amplification comprises DNA polymerase and DNA polymerase buffer solution.
In another aspect of the present invention, there is provided a method for identifying toxic datura plants, comprising the steps of:
1) extracting the genome DNA of a sample to be detected;
2) carrying out PCR amplification on the extracted genome DNA by adopting the primer group or the kit;
3) and detecting whether the PCR amplification product contains a target amplification fragment, identifying a sample containing the target amplification fragment as a toxic datura plant positive, wherein the size of the target amplification fragment is 181 bp.
The reaction system of the PCR amplification is as follows: a total volume of 25. mu.l was obtained, wherein 2 XTaq PCR MasterMix 12.5. mu.l, forward and reverse primers at a concentration of 10. mu.M each 1. mu.l, genomic DNA 1. mu.l, and the balance ddH2O；
The reaction conditions of the PCR amplification in the step 2) are as follows: 3min at 94 ℃; circulating for 30 times at 94 ℃ for 30s, at 54 ℃ for 30s and at 72 ℃ for 1 min; 5min at 72 ℃;
preferably, agarose gel electrophoresis is used in the step 3) to detect whether the PCR amplification product contains the target band.
In another aspect, the present invention provides a real-time fluorescence PCR method for identifying toxic Datura plants, comprising the following steps:
1) extracting the genome DNA of a sample to be detected;
2) and performing real-time fluorescence PCR amplification on the extracted genomic DNA by adopting the primer group or the kit, judging whether the object to be detected contains toxic datura plants or not according to the amplification result, judging that the datura species are positive if Ct is less than 30, and judging that the datura species are negative if Ct is more than or equal to 30.
The reaction system of the real-time fluorescent PCR is as follows: a total volume of 20. mu.l was determined, wherein 2X Premix Ex Taq 10. mu.l, primers da F/da R each having a concentration of 10. mu.M 1. mu.l, probe da P having a concentration of 10. mu.M 0.5. mu.l, genomic DNA 1. mu.l, and the balance ddH2O; the qPCR amplification procedure was: pre-denaturation at 95 ℃ for 20s, 40 cycles of denaturation at 95 ℃ for 3s, and annealing at 54 ℃ for 30 s.
The last aspect of the invention provides the application of the primer group or the kit in identifying toxic datura plants; preferably, the poisonous Datura plants include Datura innoxia, Datura metel, and Datura stramnonium.
The invention has the beneficial effects that: the technology for rapidly identifying toxic datura plants is established on the basis of other plants which are not easily distinguished from datura in morphology, and the toxic datura plants can be rapidly and accurately distinguished from other confusable materials by the primer group, the kit and the detection method provided by the invention, so that the detection specificity is strong; the detection sensitivity is as high as 1 ng/mul, and the detection sensitivity is very high; can meet the requirement of early, rapid and accurate diagnosis in the poisoning event, thereby using antidote as soon as possible according to symptoms and improving the rescue success rate and cure rate in the poisoning event.
Drawings
FIG. 1 is a graph showing the result of aligning the ITS2 gene sequences of Datura and related species using BioEdit software, in which the material names of the species represented by the abbreviated letters are shown in Table 1; "-" indicates a missing base; "·" denotes the same base; the square frame part is a specific base sequence of the datura species.
FIG. 2 shows the results of general PCR specific amplification and sensitivity detection electrophoresis, wherein, FIG. a shows the results of primer specificity detection, lanes 1-14 are samples corresponding to numbers 1-14 in Table 1, and M is DL500 Marker; FIG. b shows the results of the primer sensitivity detection, lanes 1 to 5 are template DNAs at different concentrations, 100 ng/. mu.l, 10 ng/. mu.l, 1 ng/. mu.l, 0.01 ng/. mu.l, and 0.001 ng/. mu.l in this order, and lane 6 is ddH2O and M are DL500 Marker.
FIG. 3 is a real-time fluorescent quantitative PCR amplification curve.
Detailed Description
The invention is further illustrated by the following examples, which are not intended to be limiting.
The experimental methods in the following examples are all conventional methods unless otherwise specified; the biological and chemical reagents used are all conventional commercial products and are commercially available unless otherwise specified.
Example 1
First, experimental material
The specific names and sources of the materials selected for the experiment are shown in table 1, and the plant material used for the experiment was silica gel dried leaves.
TABLE 1 Experimental materials and sources thereof
| Numbering | Abbreviations | Sample name | Latin name | Name of the genus | Source |
| 1 | di-1 | Datura stramonium L | Datura innoxia | Datura genus | Beijing |
| 2 | di-2 | Datura stramonium L | Datura innoxia | Datura genus | Shandong (mountain east) |
| 3 | di-3 | MaomangaoLuo | Datura innoxia | Datura genus | Shandong (mountain east) |
| 4 | di-4 | Datura stramonium L | Datura innoxia | Datura genus | Shandong (mountain east) |
| 5 | dm-1 | Flos Daturae Metelis | Datura metel | Datura genus | Yunnan |
| 6 | dm-4 | Flos Daturae Metelis | Datura metel | Datura genus | Chinese drug test |
| 7 | ds-1 | All-grass of Datura | Datura stramonium | Datura genus | Liaoning medicine |
| 8 | ds-4 | All-grass of Datura | Datura stramonium | Datura genus | (Jiangxi) |
| 9 | ds-5 | All-grass of Datura | Datura stramonium | Datura genus | Chinese drug test |
| 10 | lj-1 | Honeysuckle | Lonicera japonica | Lonicera genus | (Jiangxi) |
| 11 | lj-2 | Honeysuckle | Lonicera japonica | Lonicera genus | Chinese drug test |
| 12 | cr-1 | Chinese trumpet creeper | Campsis radicans | Campsis genus | Chinese drug test |
| 13 | ss | Sauropus spatulis (Lindl.) Ker | Sauropus spatulifolius | Genus Gekko | Chinese drug |
| 14 | cr-2 | Chinese trumpet creeper | Campsis radicans | Campsis genus | Guangdong (Chinese character of Guangdong) |
Second, Experimental methods and results
1. Extraction of genomic DNA
The silica gel-dried experimental material leaves of Table 1 were placed 100mg in a 2ml EP tube previously charged with 4mm steel balls, rapidly frozen in liquid nitrogen for 30min, and the EP tube was placed on a Geno/Grinder 2000(SPEX samplePrep) high throughput Grinder for 3min at 1000 rpm/min. Total DNA from leaves was extracted using a Plant genomic DNA extraction kit (DNeasy Plant Minikit, Qiagen) and used as a template for subsequent PCR amplification.
2. ITS2 sequence PCR amplification and sequencing
The study selects a DNA barcode international universal sequence ITS2, and the primer sequence is as follows:
ITS2-F：ATGCGATACTTGGTGTGAAT(SEQ ID NO.1)；
ITS2-R：GACGCTTCTCCAGACTACAAT(SEQ ID NO.2)。
the PCR reaction system was 25. mu.L, and contained 12.5. mu.L of KODone PCR mastermix (Toyobo, Shanghai, Biotech Co., Ltd.), 1. mu.L of the extracted DNA template, 0.75. mu.L of each of primers ITS2-F, ITS2-R (each concentration was 10. mu.M), and ddH2O10. mu.L. The PCR amplification procedure for the ITS2 sequence was: pre-denaturation at 95 ℃ for 1 min; deforming the template at 98 ℃ for 10s, annealing at 56 ℃ for 5s, and performing 40 cycles; extension at 68 ℃ for 1 s. After the PCR product was detected by 1% agarose gel electrophoresis, Shanghai was commissionedBiotechnology engineering, Inc. performs bidirectional sequencing.
3. Specific primer design
The sequencing peak profile was corrected using Codon CodeAligner V3.0 to remove low mass sequence and primer regions. The ITS2 spacer sequence was then obtained by removing the 5.8S and 28S sections at both ends of all sequences and the desired GenBank sequence using a Hidden Markov Model (HMMER) based annotation method.
All the sequences were analyzed by alignment using BioEdit software (FIG. 1), and it was found that the 18bp-216bp interval of ITS2 gene (SEQ ID NO. 3) of Datura has specificity to other materials, and is suitable for designing upstream and downstream specific primers, and screening and evaluating the specificity and sensitivity of candidate primers, and the information of the selected specific primers da F and da R is shown in Table 2:
TABLE 2 specific primers for identifying Datura plants
| Primer name | Primer sequence (5 '-3') | SEQ ID NO. | Primer sites |
| Upstream primer da F | CAAAAACCTTGGCTGCGGTT | SEQ ID NO.4 | 29bp-48bp interval |
| Downstream primer da R | TGAAGGGTCTAGGAGCACAAA | SEQ ID NO.5 | 189bp-209bp interval |
4. Common PCR specific amplification and sensitivity detection
The primer pair da F/da R designed in the research is used for carrying out PCR amplification on 14 sample DNAs in the table 1, and the specificity of the primers is detected.
And (3) PCR reaction system: total volume 25 μ L, containing: 2 XTAQAQQ PCR Master mix (Tiangen Biochemical technology Co., Ltd., Beijing, product No. KT201) 12.5. mu.L, primers da F/da R each 1. mu.L, DNA template 1. mu.L, and the balance ddH2O。
The PCR amplification procedure was: 3min at 94 ℃; circulating for 30 times at 94 ℃ for 30s, at 54 ℃ for 30s and at 72 ℃ for 1 min; 5min at 72 ℃.
After the reaction, 5. mu.L of the amplification product was collected and subjected to 1.5% agarose gel electrophoresis to detect the result. The electrophoresis result of the specificity detection is shown in fig. 2a, and the electrophoresis result shows that only 9 samples of datura have specificity amplification, the length of the amplified fragment is about 181bp, and other 5 samples have no amplified fragment, which indicates that the primer has specificity to the datura.
Meanwhile, the alignment result of the amplified sequence BLAST shows that the target fragment belongs to the genus Datura.
The template DNA of sample No. 9 in Table 1 was used for gradient concentration dilution for sensitivity detection, and the concentration gradient was set as follows: 100 ng/ul, 10 ng/ul, 1 ng/ul, 0.01 ng/ul, 0.001 ng/ul, the detection result is shown in FIG. 2b, when the concentration of the template DNA is 1 ng/ul, a bright detection strip can still be generated, and the detection sensitivity is very high.
5. TaqMan probe design
And (3) designing a species-specific TaqMan probe on the basis of the screened species-specific primer.
According to the sequence alignment result, in the range of the specific primers of Datura species, the fluorescent probe with species specificity is designed in the upstream and downstream primer-space region by PrimeQuest touch (https:// sg. idtdna. com/PrimeQuest/Home/Index) software, and the design principle of the probe is as follows: (1) the first base at the 5' end cannot be G; (2) the first four bases at the 3' end are free of 3 or more G; (3) the closer the probe is to the primer, the better; (4) GC% is between 30% and 70%, and the annealing temperature is between 65 ℃ and 67 ℃; (5) the length of the probe is between 13bp and 25 bp; (6) repeated bases are avoided, particularly more than 4G repeats are avoided, and 6A repeats are avoided; (7) a sequence having more C than G was selected as a probe. The probe was synthesized by Shanghai Bioengineering Co., Ltd.
The sequence of the designed probe da P is (SEQ ID NO. 6):
5’-(FAM)TGGTGGTTGGAACTCAACTCTCGT(BHQ1)-3’。
6. fluorescent quantitative PCR reaction
The total volume of the real-time fluorescent PCR reaction was 20. mu.l, including 2 XPromix Ex Taq (Takara) L0. mu.l, 1. mu.l upstream and downstream primers da F/da R (10. mu. mol/L), 0.5. mu.l probe da P (10. mu. mol/L), ddH2O6.5. mu.l, DNA template 1. mu.l; the reaction conditions were 95 ℃ pre-denaturation for 20s, 40 cycles of 95 ℃ denaturation for 3s, and 54 ℃ annealing for 30 s. The template DNA extracted from the material in Table 1 was subjected to fluorescent quantitative PCR reaction according to the reaction system and amplification procedure.
The resulting amplification curve (as shown in FIG. 3) shows that only DNA of 9 samples of Datura has specific amplification, and CT value is less than 30; DNA and ddH of the other 5 confusable species2And O control has no fluorescence increasing signal before the 30 th cycle reaction, which indicates that the probe and primer combination only has specificity to the datura species, if the Ct is less than 30, the datura species is judged to be positive, and if the Ct is more than or equal to 30, the datura species is judged to be negative.
Sequence listing
<110> scientific research institute of Chinese inspection and quarantine
<120> high-sensitivity primer set, kit and method for identifying toxic plants in Datura
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> primer ITS2-F
<400> 1
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> primer ITS2-R
<400> 2
gacgcttctc cagactacaa t 21
<210> 3
<211> 230
<212> DNA
<213> Artificial sequence
<220>
<223> ITS2 gene of Datura plant
<400> 3
cgcatcgcgt cgcccccgca ctccgcacca aaaaccttgg ctgcggttgt gtcgtgggac 60
ggatactggc ctcccgtgag cccccgagcc tgcggctggc ctaaatgcga gtccacgtcg 120
acggacgtca cggcaagtgg tggttggaac tcaactctcg taatgtcgtg gctacagccc 180
gtcgctcgtt tgtgctccta gacccttcac gcgcttaggc gctccgaccg 230
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> primer da F
<400> 4
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> primer da R
<400> 5
tgaagggtct aggagcacaa a 21
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Probe da P
<400> 6
tggtggttgg aactcaactc tcgt 24
Claims (10)
1. A primer set for identifying toxic datura plants, which is characterized by comprising the following components in parts by weight: the primer group comprises primers da F and da R, and the nucleotide sequences are as follows:
da F：5’-CAAAAACCTTGGCTGCGGTT-3’；
da R：5’-TGAAGGGTCTAGGAGCACAAA-3’。
2. the primer set of claim 1, wherein: also comprises a probe da P, wherein the nucleotide sequence of the probe da P is as follows: TGGTGGTTGGAACTCAACTCTCGT, respectively;
preferably, the 5 'end of the probe da P is marked with a fluorescent reporter group, and the 3' end of the probe da P is marked with a fluorescent quencher group; further preferably, the fluorescence reporter is FAM and the fluorescence quencher is BHQ 1.
3. The primer set of claim 1 or 2, wherein: the toxic Datura plant includes Datura stramonium Innoxia, Datura stramonium metel and Datura stramonium.
4. A kit for identifying toxic datura plants, comprising: the primer set of claim 1 or 2, further comprising a reaction reagent for PCR amplification or real-time fluorescence PCR amplification.
5. The kit of claim 4, wherein: the kit also comprises a DNA extraction reagent, a positive control and a negative control, wherein the reaction reagent for PCR amplification or real-time fluorescence PCR amplification comprises DNA polymerase and DNA polymerase buffer solution.
6. A method for identifying toxic datura plants, which is characterized by comprising the following steps:
1) extracting the genome DNA of a sample to be detected;
2) performing PCR amplification on the extracted genomic DNA using the primer set of claim 1 or the kit of claim 4 or 5;
3) and detecting whether the PCR amplification product contains a target amplification fragment, identifying a sample containing the target amplification fragment as a toxic datura plant positive, wherein the size of the target amplification fragment is 181 bp.
7. The method of claim 6, wherein: the reaction system of the PCR amplification is as follows: a total volume of 25. mu.l was obtained, wherein 2 XTaq PCR MasterMix 12.5. mu.l, forward and reverse primers at a concentration of 10. mu.M each 1. mu.l, genomic DNA 1. mu.l, and ddH as the remainder2O；
The reaction conditions of the PCR amplification in the step 2) are as follows: 3min at 94 ℃; circulating for 30 times at 94 ℃ for 30s, at 54 ℃ for 30s and at 72 ℃ for 1 min; 5min at 72 ℃;
preferably, agarose gel electrophoresis is used in the step 3) to detect whether the PCR amplification product contains the target band.
8. A real-time fluorescence PCR method for identifying toxic datura plants is characterized by comprising the following steps:
1) extracting the genome DNA of a sample to be detected;
2) the primer group of claim 2 or the kit of claim 4 or 5 is adopted to perform real-time fluorescence PCR amplification on the extracted genomic DNA, whether the object to be detected contains toxic datura plants is judged according to the amplification result, if the Ct is less than 30, the datura species is judged to be positive, and if the Ct is more than or equal to 30, the datura species is judged to be negative.
9. Root of herbaceous plantThe method of claim 8, wherein: the reaction system of the real-time fluorescent PCR is as follows: a total volume of 20. mu.l was determined, wherein 2X Premix Ex Taq 10. mu.l, primers da F/da R each having a concentration of 10. mu.M 1. mu.l, probe da P having a concentration of 10. mu.M 0.5. mu.l, genomic DNA 1. mu.l, and the balance ddH2O; the qPCR amplification procedure was: pre-denaturation at 95 ℃ for 20s, 40 cycles of denaturation at 95 ℃ for 3s, and annealing at 54 ℃ for 30 s.
10. Use of the primer set of claim 1 or 2 or the kit of claim 4 or 5 for identifying toxic datura plants; preferably, the poisonous Datura plants include Datura innoxia, Datura metel, and Datura stramnonium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210076523.9A CN114410820B (en) | 2022-01-21 | 2022-01-21 | High-sensitivity primer group, kit and method for identifying stramonium toxic plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210076523.9A CN114410820B (en) | 2022-01-21 | 2022-01-21 | High-sensitivity primer group, kit and method for identifying stramonium toxic plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114410820A true CN114410820A (en) | 2022-04-29 |
| CN114410820B CN114410820B (en) | 2023-07-21 |
Family
ID=81275842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210076523.9A Active CN114410820B (en) | 2022-01-21 | 2022-01-21 | High-sensitivity primer group, kit and method for identifying stramonium toxic plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114410820B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988126A (en) * | 2010-09-28 | 2011-03-23 | 中华人民共和国上海出入境检验检疫局 | Nucleic acid composition for detecting Datura ferox and application thereof |
-
2022
- 2022-01-21 CN CN202210076523.9A patent/CN114410820B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988126A (en) * | 2010-09-28 | 2011-03-23 | 中华人民共和国上海出入境检验检疫局 | Nucleic acid composition for detecting Datura ferox and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 吴亚男等: "基于ITS2条形码的曼陀罗属药用植物 DNA 分子鉴定", 《中药材》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114410820B (en) | 2023-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Parasnis et al. | A highly reliable sex diagnostic PCR assay for mass screening of papaya seedlings | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN111961750A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof | |
| Ranade et al. | SPAR profiles and genetic diversity amongst pomegranate (Punica granatum L.) genotypes | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| CN105531369B (en) | The anthracnose repellence Research of predicting markers of strawberry plants and its utilization | |
| CN117344054B (en) | Molecular marker primer for amplifying wheat powdery mildew resistance gene pmXQ-0508 and application thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| CN116622876B (en) | Haplotype molecular marker related to vitamin C content of papaya pulp and application thereof | |
| CN109825604B (en) | Molecular marker closely linked with peach aphid resistance character, primer, kit and method for detecting peach aphid resistance character and application of primer, kit and method | |
| CN114410820B (en) | High-sensitivity primer group, kit and method for identifying stramonium toxic plant | |
| CN105112523B (en) | SSR core primers group and application based on the exploitation of Chinese cabbage whole genome sequence | |
| CN108977563B (en) | SSR core primer group developed based on radish whole genome sequence and application thereof | |
| KR20080043164A (en) | Identification of clubroot resistance gene using rapd marker in chines cabbage | |
| Ansari et al. | Molecular diversity of brinjal (Solanum melongena L.) genotypes revealed by RAPD marker | |
| CN117144056B (en) | Application of haplotype molecular marker related to papaya fruit fructose accumulation | |
| CN117165718B (en) | Application of SNP molecular marker related to fructose content of papaya pulp | |
| JP7486147B2 (en) | Oligonucleotides for detecting the mealworm moth | |
| Sanaullah et al. | Assessments of genetic diversity in country bean (Lablab purpureus L.) using RAPD marker against photo-insensitivity | |
| KR102261896B1 (en) | Primer set for discriminating genetic background of Perilla sp. and uses thereof | |
| Sinha et al. | Transferability of genic-SSR markers developed from the transcriptome data of Selaginella bryopteris (L.) Baker | |
| LIU et al. | Improving blast resistance of a thermo-sensitive genic male sterile rice line GD-8S by molecular marker-assisted selection | |
| CN113832249B (en) | Molecular marker for detecting specific chromosome fragment of wheat diaphysis germplasm 8425B and application thereof | |
| CN105861496A (en) | Molecular marker in close linkage with bitter gourd powdery mildew resistance gene and application thereof | |
| JP2024066550A (en) | Oligonucleotides for detecting Tribolium castaneum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |