JP2007191452A - Estrogen-like active agent - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an estrogen-like active agent and an anti-aging dermatological external agent containing 1, 2 or more extract(s) selected from extracts of Canna generalis Bailey, Canna indica L. var. orientalis Hook. fil., Canarium album and Symplocos racemosa. <P>SOLUTION: The agent containing 1, 2 or more extract(s) selected from extracts of Canna generalis Bailey, Canna indica L. var. orientalis Hook. fil., Canarium album and Symplocos racemosa exerts excellent estrogen-like activity and inhibits or improves changes such as atrophy, wrinkle and sagging due to one of causes of decrease or deficiency of estrogen accompanied by aging and can be used as an anti-aging dermatological external agent. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to an estrogen-like agent containing one or more selected from canna, kanran and rodda extracts.

  Estrogen is a sex steroid hormone that is known to affect various organs such as glucose metabolism and bone, brain and blood vessels. The natural forms of estrogen include estradiol-17β, estrone and estriol. Among the estrogens produced in the body, estradiol-17β is the most effective.

Estrogens have been shown to promote collagen synthesis and increase the proportion of young, low-crosslinked collagen that has just been biosynthesized. This leads to the effect of keeping the dermis young and tensioning the skin. Furthermore, estrogen has the effect of reducing UV stress. When male and female mice are irradiated with the same dose of ultraviolet rays, the damage is greater in males, and it has been suggested that female estrogen is resistant to ultraviolet rays (Non-patent Document 1). In addition, the decrease in estrogen increases the activity of collagen degrading enzymes by UV rays and causes wrinkles and tarmi. Therefore, promoting the secretion of female hormones may lead to the prevention of skin aging such as wrinkles and tarmi ( Non-patent document 2).
Norihisa Kawai, 1 other, “Application of isoflavones to skin care”, Fragrance Journal 2000-12, p. 129-131 Hiroshi Tanaka and 4 others, “Effects of Cucurbitaceae plants on skin changes in ovariectomized mice by long-term ultraviolet irradiation”, 18th Annual Meeting of the Japanese Society of Pharmaceutical Sciences, p.122

In postmenopausal women, it has been reported that estrogen levels decrease and become deficient (Non-patent Document 3), and the decrease in estrogen levels due to aging and skin aging symptoms are closely related. It is done.
Shah MG, Maibach HI. Am J Clin Dermatol. 2001; 2 (3): 143-50

  Due to such circumstances, estrogen can be expected to have a useful effect in the field of skin care, but it is difficult to administer the hormone itself to the human body or by external skin preparations from the viewpoint of safety and regulation. Conceivable. As a result of diligent research, the present inventors have found that extracts of canna, kanran and rodda exert an estrogen-like action and have completed the present invention.

  An object of the present invention is to suppress or improve changes such as skin atrophy, wrinkles and sagging caused by aging by exerting an estrogen-like action.

Examples of the canna according to the present invention include a plant included in the cannadaceae such as Hana canna (Canna generalis Bailey), Dundoku (Canna indica L. var. Orientalis Hook. Fil.), And interspecific hybrids or intergeneric hybrids. The varieties that are available on the market can be used for the hybrids and their interspecific hybrids, and those that grow naturally in Kyushu etc. can be used.
The extract of canna used in the present invention is extracted from a part of the plant body such as leaves, stems, flowers, fruits, rhizomes, or the whole plant. Preferably, what is obtained by extracting from the rhizome of the plant body is good.

The orchid used in the present invention has the scientific name Canarium album, is an evergreen small tree native to South Vietnam, and is distributed in Indochina and southern China. Because it can eat fruit, it is also cultivated in China and Taiwan, and is sometimes planted in Kagoshima and Okinawa. In the private sector, immature fruit is used as an antidote, and in Taiwan, dried fruit is used as a healthy stomach medicine.
The kanran extract used in the present invention is extracted from a part of the plant body such as leaves, stems, bark, flowers, and fruits of the plant body or from the whole plant. Preferably, those obtained by extraction from the leaves of the plant body are good.

The Rodda used in the present invention has the scientific name Symplocos racemosa, and the one native to India is used as an Ayurvedic herbal medicine for hemostasis, diarrhea, eye / skin inflammation, irregular menstruation, etc. Is also famous.
The extract of rodda used in the present invention is extracted from a part of the plant body such as leaves, stems, bark, flowers, fruits and roots of the plant body or whole grass. Preferably, those obtained by extraction from leaves, stems and bark of the plant body are good.

The extraction method of canna, kanran and rodda of the present invention is not particularly limited, and for example, it may be extracted by heating, or may be extracted at room temperature or low temperature.
Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol). , Glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether) Etc.). Preferred are polar solvents such as water, lower alcohols and liquid polyhydric alcohols, and particularly preferred are water, ethanol, 1,3-butylene glycol and propylene glycol. These solvents may be used alone or in combination of two or more.

  The extract may be used as it is, or may be used after concentration, dilution, filtration, decolorization with activated carbon, deodorization, or the like, if necessary. Further, the extracted solution may be used as a dried product after being concentrated and dried, spray dried, freeze dried, etc., or may be used after concentrating or isolating the active ingredient by performing column purification or the like. good.

  The estrogen-like agent containing one or more selected from the extracts of canna, kanran and rhoda of the present invention is used for the purpose of suppressing or improving changes such as skin atrophy, wrinkle and sagging due to aging. Is usually administered systemically or locally by external application. The dose varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc., but is usually 1 mg to 1 g per adult, preferably 20 mg to 200 mg once to several times a day. Is done. Since the dosage varies depending on various conditions, an amount smaller than the above-mentioned administration range may be sufficient, or it may be necessary to administer beyond the range.

  The estrogenic agent of the present invention can be used in any of cosmetics, quasi-drugs, and pharmaceuticals. Examples of the dosage form include lotions, creams, emulsions, gels, aerosols, essences and packs. , Cleaning agents, bath preparations, foundations, dusting powders, lipsticks, ointments, poultices and the like that are applied to the skin. The above-mentioned extract may be used as it is, and the components used for the external preparation are within the range not impairing the effect of the extract, oils, waxes, hydrocarbons, fatty acids, alcohols, esters, interfaces Components such as activators, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, dyes, antioxidants, whitening agents, chelating agents, and the like can also be blended.

  The amount of the extract used in the present invention is 0.0001% by weight or more, preferably 0.001 to 50% by weight in terms of solid matter with respect to the estrogenic agent or anti-aging skin external preparation of the present invention. % Formulation is good. If it is less than 0.0001% by weight, a sufficient effect is hardly expected. When it exceeds 50% by weight, the effect is hardly increased and it is uneconomical. In addition, the addition method may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  The extract of canna, kanran and rhoda of the present invention, and the estrogenic agent and anti-aging skin external preparation having the same, exhibit an estrogen-like effect, such as skin atrophy and wrinkles caused by aging, sagging, etc. Changes can be suppressed or improved.

  Next, in order to describe the present invention in detail, examples of producing the extract used in the present invention, formulation examples and experimental examples of the present invention will be given as examples, but the present invention is not limited thereto. The part of the amount shown in the examples indicates part by weight, and% indicates% by weight.

Production Example 1 Kanna Hot Water Extract Hana Kanna stems, leaves, and rhizomes were each cut into raw pieces, and 1000 ml of water was added to each 100 g, followed by extraction at 100 ° C. for 2 hours. The obtained extract was filtered, concentrated, and freeze-dried to obtain a hot water extract of canna. 0.25 g of hot water extract was obtained from stems and leaves, and 0.5 g of hot water extract was obtained from rhizomes.

Production Example 2 Kanna Ethanol Extract Hannacanna stems, leaves, and rhizomes were each dried and then cut into small pieces, and 1000 ml of ethanol was added to each 100 g, followed by reflux extraction at 50 ° C. for 8 hours. The obtained extract was filtered and then concentrated to dryness to obtain an ethanol extract of canna. An ethanol extract of 2.0 g was obtained from the stem and leaves, and 4.5 g from the rhizome.

Production Example 3 50% 1,3-butylene glycol extract of canna Hana canna rhizomes were cut into raw pieces, and 100 g was mixed with 1,3-butylene glycol (1,3-BG) and water (1: 1000 g of 1) was added and extracted at room temperature for 2 days. After extraction, the extract was filtered to obtain 950 g of 50% 1,3-butylene glycol extract of canna.

Production Example 4 Hot Water Extract of Kanran A dried kanran leaf was cut into small pieces, 1000 ml of water was added to 100 g thereof, and the mixture was extracted at 100 ° C. for 2 hours. The obtained extract was filtered, concentrated, and lyophilized to obtain 7.0 g of kanran hot water extract.

Production Example 5 Canran 50% Ethanol Extract A dried kanran leaf was cut into small pieces, 1000 ml of 50% ethanol was added to 100 g of the extract, and the mixture was extracted at 50 ° C. for 2 hours. The obtained extract was filtered and then dried to obtain 10 g of an orchid 50% ethanol extract.

Production Example 6 Canran 50% 1,3-Butylene Glycol Extract After cutting the dried kanran leaves into fine pieces, 200 g of purified water and 200 g of 1,3-butylene glycol were added to the 50 g, and extracted at room temperature for 7 days. And filtered to obtain 370 g of a 50% 1,3-butylene glycol extract of canlan.

Production Example 7 Hot Water Extract of Rodda 400 ml of purified water was added to 20 g of dried Rodda bark, extracted at 95-100 ° C. for 2 hours, filtered, and the filtrate was concentrated and freeze-dried to heat Rhoda. 4.0 g of water extract was obtained.

Production Example 8 Ethanol Extract of Rodda 1000 ml of ethanol was added to 100 g of dried roda bark, extracted at room temperature for 7 days, filtered, the filtrate was concentrated to dryness, and 5.8 g of Rhoda ethanol extract was obtained. Obtained.

Production Example 9 50% 1,3-Butylene Glycol Extract of Rodda 200 g of purified water and 200 g of 1,3-butylene glycol were added to 20 g of dried roda bark, extracted for 7 days at room temperature, filtered, 380 g of 50% 1,3-butylene glycol extract was obtained.

Formulation Example 1 Cream 1
Formulation Formulation 1. 1. Canna hot water extract (Production Example 1, rhizome) 1.0 part Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5). Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11.1,3-butylene glycol 8.5
12 Ethyl paraoxybenzoate 0.05
13. Methyl paraoxybenzoate 0.2
14 Purified water 67.15
[Manufacturing method] Components 2 to 9 are heated and dissolved and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11 to 14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 10 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 2 Cream 2
Formulation Formulation 1. 1. Hot water extract of kanran (Production Example 4) 0.5 part Rhoda hot water extract (Production Example 7) 0.5
3. Squalane 5.5
4). Olive oil 3.0
5). Stearic acid 2.0
6). Beeswax 2.0
7). Octyldodecyl myristate 3.5
8). Polyoxyethylene cetyl ether (20E.O.) 3.0
9. Behenyl alcohol 1.5
10. Glycerol monostearate2.5
11. Fragrance 0.1
12.1,3-Butylene glycol 8.5
13. Ethyl paraoxybenzoate 0.05
14 Methyl paraoxybenzoate 0.2
15. Purified water 67.15
[Manufacturing method] Components 3 to 10 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 2 and ingredients 12-15 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 11 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 3 Cream 3
In Formulation Example 1, Cream 3 was obtained by replacing the hot water extract of kanna with a 50% 1,3-butylene glycol extract of Rodda (Production Example 9).

Comparative Example 1 Conventional Cream A conventional cream was prepared by replacing the hot water extract of kanna with purified water in Formulation Example 1.

Formulation Example 4 Lotion Formulation Formulation amount 1. Canran 50% ethanol extract (Production Example 5) 0.1 part 2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5). Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance 0.1
11. Purified water 84.47
[Manufacturing method] Components 2-6 and 11 and components 1 and 7-10 are dissolved uniformly, and both are mixed and filtered to obtain a product.

Formulation Example 5 Latex 1
Formulation Formulation 1. 50% 1,3-butylene glycol extract of canna (Production Example 3) 0.5 part Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5). Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. Purified water 72.7
[Manufacturing method] Components 2 to 8 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 9 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 6 Latex 2
In Formulation Example 5, 0.5 part of 50% 1,3-butylene glycol extract of canna was added to 0.25 parts of kanran hot water extract (Production Example 4) and hot water extract of Rodda (Production Example 7) 0 The emulsion 2 was replaced with 25 parts.

Formulation Example 7 Gel formulation Formulation amount 1. Roda 50% 1,3-butylene glycol extract (Production Example 9) 1.0 part Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5). Fragrance 0.05
6.1,3-Butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Purified water 83.25
[Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved and mixed to obtain a product.

Formulation Example 8 Pack Formulation Formulation 1. Rhoda ethanol extract (Production Example 8) 0.1 part Canna hot water extract (Production Example 1, rhizome) 0.1
3. Polyvinyl alcohol 12.0
4). Ethanol 5.0
5.1,3-Butylene glycol 8.0
6). Methyl paraoxybenzoate 0.2
7). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
8). Citric acid 0.1
9. Sodium citrate 0.3
10. Fragrance 0.05
11. Purified water 73.65
[Production Method] Components 1 to 11 are uniformly dissolved to obtain a product.

Formulation Example 9 Foundation Formulation Formulation amount 1. Canna ethanol extract (Production Example 2, rhizome) 0.5 part Canran 50% ethanol extract (Production Example 5) 0.5
3. Stearic acid 2.4
4). Polyoxyethylene sorbitan monostearate (20E.O.) 1.0
5). Polyoxyethylene cetyl ether (20E.O.) 2.0
6). Cetanol 1.0
7). Liquid lanolin 2.0
8). Liquid paraffin 3.0
9. Isopropyl myristate 6.5
10. Sodium carboxymethylcellulose 0.1
11. Bentonite 0.5
12 Propylene glycol 4.0
13. Triethanolamine 1.1
14 Methyl paraoxybenzoate 0.2
15. Titanium dioxide 8.0
16. Talc 4.0
17. Bengala 1.0
18. Yellow iron oxide 2.0
19. Fragrance 0.1
20. Purified water 60.1
[Production method] Components 3 to 9 are heated and dissolved, and kept at 80 ° C to obtain an oil phase. Swell component 10 well with component 20, then add components 1, 2 and 11-14 and mix uniformly. To this, components 15 to 18 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The oily phase is added to the aqueous phase with stirring, cooled, and component 19 is added at 45 ° C, and cooled to 30 ° C with stirring to give a product.

Formulation Example 10 Ointment Formulation Formulation amount 1. Canna hot water extract (Production Example 1, rhizome) 0.01 part 50% 1,3-butylene glycol extract of kanran (Production Example 6) 0.5
3. Polyoxyethylene cetyl ether (30E.O.) 2.0
4). Glycerol monostearate 10.0
5). Liquid paraffin 5.0
6). Cetanol 6.0
7). Methyl paraoxybenzoate 0.1
8). Propylene glycol 10.0
9. Purified water 66.39
[Production Method] Components 3 to 6 are dissolved by heating and mixed, and kept at 70 ° C. to obtain an oil phase. Ingredients 1, 2, and 7-9 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled to 30 ° C. with stirring to obtain a product.

  Next, experimental examples will be given to explain the effects of the present invention in detail.

Experimental Example 1 Examination of estrogen receptor binding ability The estrogen receptor binding ability of canna, canlan and rodda was examined using an estrogen R (α) competitive screening kit (Wako Pure Chemical Industries, Ltd.). Kanna, kanran and rodda were dissolved in DMSO, and the mixed solution with the reaction solution was transferred to an ERα-immobilized dry microplate. After reacting at room temperature for 2 hours, free fluorescent reagents and the like were washed with a washing solution. Thereafter, the amount of fluorescent estradiol bound to the immobilized ERα was detected using a fluorescent multiplate reader spectrofluorometer under the conditions of Extraction 485 nm, Emission 535 nm, and Flash Number 10 times. As a comparative sample, soybean isoflavone reported to have an estrogen-like action was used.

  The results of these experiments are shown in Table 1. As a result, the canna, kanran and rodda extracts showed superior estrogen receptor binding ability compared to soybean isoflavones.

  When the estrogen receptor binding ability was similarly measured for a mixture of two or more selected from extracts of canna, kanran and rodda, it showed excellent estrogen receptor binding ability.

Experimental Example 2 Estrogen-like effect study Estrogen-like effects of canna, kanran and rhoda were examined using cyclinD2 which has been reported recently as an increase in mRNA expression after binding to estrogen (non-patented) Reference 4).
Human keratinocyte-derived HaCaT cells were cultured in DMEM medium containing 10% FCS for 4 days under conditions of 37 ° C. and 5% CO ₂ . Confluent cells were washed once with PBS (−), replaced with serum-free DMEM medium, and 1 μg / ml of each sample was added. As a control, cells without any sample were used. After further incubation for 3 hours, total RNA was extracted using ISOGEN. CyclinD2 mRNA expression level was measured by real-time PCR based on total RNA extracted from cells. For the real-time PCR method, TaKaRa SYBR ExScript ^™ RT-PCR Kit (Perfect Real Time) was used. As primers for cyclinD2, 5′CCCTCTGCTGGACGGTACTAA3 ′ and 5′TCCTATCCTGCCAATTCAGTGTGA3 ′ were used. The reverse transcription reaction was performed at 42 ° C for 15 minutes and then at 95 ° C for 2 minutes. Furthermore, after 95 seconds at 95 ° C. as initial denaturation, PCR was performed for 40 cycles with 95 ° C. for 5 seconds and 60 ° C. for 31 seconds as 1 cycle. Further, as a dissociation stage, 95 ° C. for 15 seconds, 60 ° C. for 1 minute, and 95 ° C. for 15 seconds were performed. GAPDH was used as an internal standard. For other operations, the expression level of cyclinD2 mRNA was determined as a ratio with respect to the expression level of GAPDH mRNA, which is an internal standard, according to a predetermined method.
(Non-Patent Document 4)
Naoko Kanda and Shinichi Watanabe. Invest Dermatol. 123: 319-328, 2004.

  The results of these experiments are shown in Table 1. As a result, the extract of canna, kanran, and rodda showed an excellent increase in the expression level of cyclinD2 mRNA compared to the control.

  A change in the expression level of cyclinD2 mRNA was also measured in a mixture of two or more selected from extracts of canna, kanran and rodda, and it was confirmed that it showed an excellent cyclinD2 mRNA expression level promoting effect and had an estrogenic action. It was done.

Experimental example 3 Use test 1
Targeting 30 women (50 to 80 years old) who feel skin changes due to aging using 1% aqueous solution of Kanna hot water extract, kanran hot water extract, and Rodda hot water extract A 4-month use test was conducted. After use, the effect of improving skin sagging, wrinkles and beams was judged by a questionnaire. As a control, purified water was used.

  These test results are shown in Table 3. As a result, when using a 1% aqueous solution of Kanna hot water extract, kanran hot water extract, and Rodda hot water extract, the skin sagging is superior to the case of using purified water as a control, The improvement effect of wrinkles and beams was shown. That is, 1% aqueous solution of Kanna hot water extract, kanran hot water extract, and Rodda hot water extract showed remarkable effects. During the test period, there was no skin problem and there was no problem with safety.

  A similar test was conducted on other aqueous solutions containing one or more selected from canna, kanran, and rhoda extracts, and it was safe and had excellent skin sagging, wrinkle and elasticity improvement effects. showed that.

Experiment 4 Use test 2
Using the creams of Formulation Examples 1 to 3 and the conventional cream of Comparative Example 1, a 3-month use test was conducted on 30 women (50 to 80 years old) who felt skin changes due to aging. It was. After use, the effect of improving skin sagging, wrinkles and beams was judged by a questionnaire.

  The test results are shown in Table 4. As a result, the creams obtained in Formulation Examples 1 to 3 were superior to the conventional cream obtained in Comparative Example 1 in improving skin sagging, wrinkles and elasticity. During the test period, there was no skin problem and there was no problem with safety. There was also no problem with the deterioration of the prescription ingredients.

  When the usage test was similarly conducted for Formulation Examples 4 to 10, it was safe and showed excellent skin sagging, wrinkle improvement and beam improvement effects.

One or more selected from the canna, kanran and rhoda extracts of the present invention can be used as excellent estrogen-like agents and anti-aging skin external preparations, skin atrophy and wrinkles caused by aging, It is possible to suppress or improve changes such as sagging.

Claims (2)

An estrogenic agent containing one or more selected from canna, kanran and rodda extracts. An anti-aging skin external preparation containing the estrogen-like agent according to claim 1.