JP2005139116A - Nmf production promoter - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain an NMF production promoter comprising Nostoc extract and/or Umibudou extract, and to provide a skin care preparation for ameliorating moisturizing ability and a skin care preparation for ameliorating itch. <P>SOLUTION: The NMF production promoter comprising Nostoc extract and/or Umibudou extract is provided. A skin care preparation for ameliorating moisturizing ability and a skin care preparation for ameliorating itch are also provided respectively. In this promoter, Nostoc is a kind of terrestrial algae, belonging to the genus Nostoc, being e.g. Nostoc commune Vauch. var. flagelliforme, Nostoc commune Vauch, and Umibudou is a kind of sea algae, belonging to the genus Caulerpa, being e.g. Caulerpa lentillifera, C. racemosa W. v. Bosse var. laetevirens W. v. Bosse, C. okamurai W. v. Bosse, C. brachypus Harv. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a novel NMF production promoter, a skin external preparation for improving water retention ability, and a skin external preparation for improving scab.

  Nenjumo is a kind of cyanobacteria and is known to have an ultraviolet shielding ability, an antibacterial action, an antifungal action, an antiallergic action, and a testosterone-5α-reductase inhibitory action (Patent Documents 1 to 5). Sea grapes are a kind of seaweed, and hyaluronidase inhibitory action and hair growth action are known (Patent Documents 6 and 7). However, the NMF production promoting effect, the skin water retention ability improving effect and the kaymi improving effect are not known.

JP 60-13709 JP-A-6-116159 JP-A-7-242689 JP-A-10-265399 JP 2002-68943 A JP-A-9-67266 JP 2001-55314 A

  It has long been known that NMF plays an important role in the moisture retention of the stratum corneum, and so far the NMF component has been applied to the development of moisturizers. In recent years, it has become clear that the amino acid that forms the main component of NMF is produced by the degradation of filaggrin, the main component of keratohyalin granules, and in order to increase the production of NMF, it is important to promote the production of profilagrin and filaggrin in keratinocytes. Came to be considered. However, no keratinocytes have been found to sufficiently promote the production of profilagrin and filaggrin, that is, to increase the production of NMF.

  In view of the above circumstances, the present inventors conducted sincere research to find an NMF production promoter that promotes NMF production of epidermal keratinocytes, and as a result, found that the extract of Nenjumo and sea grapes meets the purpose, Furthermore, the present invention has been completed by finding out the effect of improving the water retention ability and the effect of improving the skin.

  That is, the present invention relates to an NMF production promoter, a skin external preparation for improving water retention ability, and a skin external preparation for improving scabs, characterized by containing an extract of nenjumo and / or an extract of sea grapes.

  The moss used in the present invention is a terrestrial algae belonging to the genus Nenjumo of the Cyanobacteria genus family, and examples include Hassai (scientific name: Nostocom commune Vouch. Var. In recent years, it has attracted attention as being effective for the prevention and treatment of adult diseases such as cardiovascular diseases and cancer. Moreover, since it is utilized for Chinese food as hair vegetables, a commercial item can be utilized. The sea grape used in the present invention is a seaweed belonging to the genus Iwata, which is a genus Iwadata (scientific name: Caulerpa lentillifera), Surichogita (scientific name: C. racemosa Wv Bosse var. Laetevirens Wv Bosse) : C. okamurai Wv Bosse), Heraiwata (scientific name: C. brachypus Harv.) And the like. In its use, natural products can be collected and used, or commercially available products can be used.

  For example, the commercially available hair vegetables and millet can be extracted by chopping and extracting the nunjumo and sea grape extract used in the present invention. The preparation method is not particularly limited, and for example, it may be extracted by heating or extracted at room temperature.

  Examples of the solvent to be extracted include water, lower monohydric alcohols (methanol, ethanol, 1-propanol, 1-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, Propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, propyl ether) Etc.). Preferred are water, lower monohydric alcohol and liquid polyhydric alcohol, and particularly preferred are water, ethanol, 1,3-butylene glycol and propylene glycol. Supercritical extraction using carbon dioxide or the like can also be used. These solvents may be used alone or in combination of two or more.

  These extracts may be used as they are in the extracted solvent, or may be used after processing such as concentration, dilution, and filtration, if necessary. Furthermore, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, or freeze drying, and used as a dried product.

  The NMF production promoter characterized by containing the extract of ninjumo and / or sea grape of the present invention has an action of promoting NMF production of epidermal keratinocytes, so that the water retention ability of skin and improvement of kaymi are improved. Also useful.

  In order to use the NMF production promoter according to the present invention for the above purpose, it is usually administered systemically or locally. Examples of the administration method include oral administration and transdermal administration. The dose varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc., but is usually 1 mg to 1 g per adult, preferably 20 mg to 200 mg once to several times a day. Is done. Of course, as described above, since the dosage varies depending on various conditions, an amount smaller than the above-mentioned dosage range may be sufficient, or it may be necessary to administer beyond the range.

  In the NMF production promoter of the present invention, the above extract may be used as it is, and a diluent may be used within a range not impairing the effect of the extract. The diluent may be a solid, liquid, or semi-solid, and examples include the following. That is, excipients, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, dispersants, buffers, fragrances, preservatives, solubilizers, solvents, and the like. Specifically, lactose, sucrose, sorbit, mannitol, starch, precipitated calcium carbonate, heavy magnesium oxide, talc, calcium stearate, magnesium stearate, cellulose or derivatives thereof, amylopectin, polyvinyl alcohol, gelatin, surface activity Agents, water, physiological saline, ethanol, glycerin, propylene glycol, cacao butter, laurin butter, petrolatum, paraffin, higher alcohol and the like.

  Typical preparations of the skin external preparation for improving water retention ability and the skin external preparation for improving eyelids in the present invention include creams, emulsions, lotions, hair tonics, sprays, packs, solutions, ointments, emulsions, suspensions and the like. Examples of the coating agent. In addition to active ingredients, these preparations include water, lower alcohols such as ethanol, higher alcohols such as cetanol, polyhydric alcohols such as polyethylene glycol and propylene glycol, celluloses such as hydroxypropylcellulose, animal Also, vegetable oils and fats, waxes, hydrocarbons such as petrolatum, silicon, surfactants, zinc oxide and the like can be blended.

  The blending amount of the extract of sea urchin extract and / or the extract of sea grape used in the present invention is 0. The blending ratio is 0001% by weight or more, preferably 0.001 to 90% by weight. In addition, the addition method may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  The extract of ninjumo and sea grape of the present invention exhibits an excellent keratinocyte NMF production promoting effect. Moreover, the skin external preparation for improving the water retention ability and the skin external preparation for improving the eye cream of the present invention showed an excellent improvement effect of the skin water retention ability and an effect of improving the eye shadow.

  Next, in order to describe the present invention in detail, examples of production of the extract used in the present invention, formulation examples of the present invention, and experimental examples are given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.

Production Example 1 Nenjumo Hot Water Extract 1 kg of purified water was added to 100 g of shredded Nenjumo (hair vegetables) and extracted at 95-100 ° C. for 2 hours. The obtained extract was concentrated under reduced pressure, and lyophilized to obtain 10 g of a fennel hot water extract.

Production Example 2 Nenjumo 50% 1,3-BG Extract To 100 g of Nenjumo (hair vegetables) shredded product, 500 g of purified water and 500 g of 1,3-butylene glycol were added and extracted at room temperature for 2 weeks. After extraction, it was filtered to obtain 950 g of 50% 1,3-BG extract of Nenjumo.

Production Example 3 Nenjumo Ethanol Extract To 100 g nenjumo (hair vegetables), 1 kg of 50% (v / v) aqueous ethanol solution was added and extracted at room temperature for 2 weeks. The obtained extract was concentrated under reduced pressure to obtain 5 g of a paste-like extract.

Manufacture example 4 Sea grapes hot water extract After squeezing the milletia in purified water and desalting, 1 kg of purified water was added to 100 g and extracted at 95-100 ° C for 2 hours. The obtained extract was concentrated under reduced pressure and freeze-dried to obtain 0.5 g of sea grape hot water extract.

Manufacture example 5 Sea grape 50% 1,3-BG extract After squeezing cruciator in purified water and desalting, 400 g of purified water and 500 g of 1,3-butylene glycol are added to it and extracted at room temperature for 2 weeks. did. After extraction, filtration was performed to obtain 950 g of 50% 1,3-BG extract of sea grapes.

Production Example 6 Sea Grape Ethanol Extract 1 kg of a 50% (v / v) aqueous ethanol solution was added to 100 g of a dried product of sea cucumber and extracted at room temperature for 2 weeks. The obtained extract was concentrated under reduced pressure to obtain 10 g of a paste-like extract.

Formulation Example 1 Lotion Formulation Formulation 1. Nenjumo hot water extract (Production Example 1) 0.1 part 2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5). Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance 0.1
11. Purified water 84.47
[Production method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, and both are mixed and filtered to obtain a product.

Comparative Example 1 A conventional lotion was prepared by replacing the nenjumo hot water extract with purified water in the conventional lotion formulation example 1.

Formulation Example 2 Cream Formulation Formulation 1. Nenjumo hot water extract (Production Example 1) 0.05 part Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5). Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11.1,3-butylene glycol 8.5
12 Ethyl paraoxybenzoate 0.05
13. Methyl paraoxybenzoate 0.2
14 Purified water 68.1
[Manufacturing method] Components 2 to 9 are heated and dissolved and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11-14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring.

Formulation Example 3 Emulsion Formulation Formulation 1. Nenjumoethanol extract (Production Example 3) 0.5 part2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5). Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. Purified water 72.7
[Manufacturing method] Components 2 to 8 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 9 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 4 Hair Tonic Formulation Formulation 1. Ethanol 60.0 parts2. Nenjumo 50% 1,3-BG extract (Production Example 2) 2.0
3. Glycerin 2.0
4). Purified water 36.0
[Production method] An extract of Nenjumo is dissolved in ethanol, glycerin and purified water are added, and the mixture is sufficiently stirred to obtain a product.

Formulation Example 5 Pack
Formulation Formulation 1. Nenjumo hot water extract (Production Example 1) 0.1 part2. Polyvinyl alcohol 12.0
3. Ethanol 5.0
4.1,3-Butylene glycol 8.0
5). Methyl paraoxybenzoate 0.2
6). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
7). Citric acid 0.1
8). Sodium citrate 0.3
9. Fragrance 0.1
10. Purified water 73.7
[Production method] Components 1 to 10 are uniformly dissolved to obtain a product.

Formulation Example 6 Lotion Formulation Formulation 1. Sea grape hot water extract (Production Example 4) 0.1 part 2.1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5). Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Fragrance 0.1
11. Purified water 84.47
[Production method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved, and both are mixed and filtered to obtain a product.

Formulation Example 7 Cream Formulation Formulation 1. Sea grape hot water extract (Production Example 4) 0.05 part2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5). Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11.1,3-butylene glycol 8.5
12 Ethyl paraoxybenzoate 0.05
13. Methyl paraoxybenzoate 0.2
14 Purified water 68.1
[Manufacturing method] Components 2 to 9 are heated and dissolved and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 11-14 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring.

Formulation Example 8 Emulsion Formulation Formulation 1. Sea grape ethanol extract (Production Example 6) 0.5 part2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5). Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. Purified water 72.7
[Manufacturing method] Components 2 to 8 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. The component 9 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 9 Hair Tonic Formulation Ethanol 60.0 parts2. Sea grape 50% 1,3-BG extract (Production Example 5) 2.0
3. Glycerin 2.0
4). Purified water 36.0
[Manufacturing method] Sea grape extract is dissolved in ethanol, glycerin and purified water are added, and the mixture is sufficiently stirred to obtain a product.

Formulation Example 10 Pack
Formulation Formulation 1. Sea grape hot water extract (Production Example 4) 0.1 part2. Polyvinyl alcohol 12.0
3. Ethanol 5.0
4.1,3-Butylene glycol 8.0
5). Methyl paraoxybenzoate 0.2
6). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
7). Citric acid 0.1
8). Sodium citrate 0.3
9. Fragrance 0.1
10. Purified water 73.7
[Production method] Components 1 to 10 are uniformly dissolved to obtain a product.

  Next, experimental examples will be given to explain the effects of the present invention in detail.

NMF production promotion test of keratinocytes Profilagrin mRNA expression as an index of NMF production of cultured keratinocytes was measured under the following conditions.

Evaluation Method of Effects on Profilaggrin mRNA Expression Mouse keratinocyte-derived Pam212 cells were cultured in Eagle's MEM medium containing 10% FCS under conditions of 37 ° C. and 5% CO ₂ . After becoming confluent, the cells were further cultured in Eagle's MEM medium supplemented with a 0.01 mg / ml concentration sample, and then total RNA was extracted. (N = 3) ISOGEN (Nippon Gene) was used for extraction of total RNA. Based on the total RNA extracted from Pam212 cells, the profilagrin mRNA expression level was measured by RT-PCR. The RT-PCR method includes TaKaRa RNA PCR Kit (AMV) Ver. 2.1, and 5'GAATCCATTTTACAGCAAAGCACCTG 3 'and 5'GGTAGTCCCAATGTGATTGCACGA- as a primer for profilaggrin
TTG3 ′ was used. GAPDH was used as an internal standard. Other operations were carried out in accordance with a predetermined method, and the PCR reaction solution was subjected to agarose gel electrophoresis, and profilagrin and GAPDH mRNA expression was confirmed as a band. These bands were photographed with a polaroid camera and quantified using a densitograph, and the expression level of profilagrin mRNA was determined as a ratio with respect to the GAPDH mRNA expression level as an internal standard.

NMF production promotion rate (%) = B / A × 100

A: Profilagrin / GAPDH mRNA expression level when no extract is added B: Profilagrin / GAPDH mRNA expression level when an extract is added

Use test Two months for 30 women (30-45 years old) who suffer from reduced skin water retention ability and skin itchiness using the lotions of Formulation Example 1 and Formulation Example 6 and the conventional lotion of Comparative Example 1 A usage test was conducted. After use, a questionnaire survey was conducted on water retention capacity and skin damage. The evaluation criteria of the questionnaire were evaluated as “excellent” for valid, “good” for slightly effective, “good” for slightly effective, and “impossible” for invalid.

  These results are shown in Tables 2 and 3. The lotion characterized by containing the extract of Nenjumo of Formulation Example 1 and the lotion characterized by containing the extract of sea grapes of Formulation Example 6 have excellent water retention capacity improvement and kaymi improvement effects. showed that. During the test period, there was no skin problem and there was no problem with safety.

  When the usage tests of the creams of Formulation Example 2 and Formulation Example 7 and the emulsions of Formulation Example 3 and Formulation Example 8 were conducted, all showed safe and excellent skin water retention ability improvement and scab improvement effect. In addition, the hair tonics of Formulation Example 4 and Formulation Example 9 also improved the properties of scalp that are easily dried, and dandruff and kayumi decreased.

  The present invention provides an NMF production promoter and an external preparation for skin having an effect of improving the skin water retention ability and improving the color.

Claims (3)

An NMF production promoter characterized by containing an extract of Nenjumo and / or an extract of sea grapes. A skin external preparation for improving the water retention ability, comprising an extract of Nenjumo and / or an extract of sea grapes. A skin external preparation for improving scabbard, comprising an extract of Nenjumo and / or an extract of sea grapes.