FI90353B - Plasmid for expression of human manganese superoxide dismutase in bacteria and method for producing and recovering enzymatically active human manganese superoxide dismutase - Google Patents

Description

1 90353

Plasmid for expression of human manganese superoxide dismutase in bacteria and method for producing and recovering enzymatically active human manganese superoxide dismutase

The present application refers to various publications in Arabic numerals in parentheses. Complete citations of these references can be found at the end of the patent application immediately before the claims. These publications in their entirety are incorporated herein by reference in the present application to more fully describe the known field of study to those skilled in the art, as known at the time of filing the present invention and claims.

In 1968, McCord and Fridovich (1) discovered the expression of superoxide dismutase (SOD) and free oxygen radicals (02—). Superoxide radicals as well as other highly reactive oxygen species are produced in each respirable cell as by-products of oxidative degradation to many different macromolecules and cellular components (for a report, see 2, 3). A group of metalloproteins known as superoxide dismutases catalyzes the oxidation-reduction reaction of 202 ~ + 2H + - * H 2 O 2 + O 2 and thus provides a control mechanism against oxygen toxicity.

There are several known forms of SOD that contain different metals and different proteins. Metals present in SOD include iron, manganese, copper and zinc. Of the known forms of SOD, all catalyze the same reaction. These enzymes are present in many developmental groups. Superoxide dismutases that contain iron are found primarily in prokaryotic cells. Superoxide dismutases with copper and zinc have been found in essentially all eukaryotic organisms (4). Superoxide 90353 dismutases containing manganese have been found in organisms ranging from microorganisms to humans.

Because each biological macromolecule can serve as a target for the destructive action of a potent superoxide radical, there has been a growing interest in the therapeutic potential of SOD. The scientific literature suggests that SOD may be useful in a wide range of clinical applications. These include the prevention of tumorigenesis and growth, as well as the reduction of cytotoxic and cardiotoxic effects of anti-cancer drugs (10), protection of bloodless tissues (12), and protection of sperm (13). In addition, there is interest in studying the effects of SOD on the aging event (14).

Research into the therapeutic potential of human SOD has been limited due to its limited intake.

Superoxide dismutase is also of interest due to its anti-inflammatory properties (11). Bovine superoxide dismutase (orgotein) has been shown to have anti-inflammatory properties and is currently marketed as a human drug in parts of Europe. It is also sold in the United States as a veterinary medicine, especially for the treatment of inflamed tendons in horses. However, the intake of orgotein is limited. Prior techniques involving the intake of orgotein from bovine or other animal cells have severe limitations, and the orgotein thus obtained may cause allergic reactions in humans because it is not of human origin.

Copper zinc superoxide dismutase (CuZn SOD) is the most studied and best characterized of the various forms of superoxide dismutase.

Human CuZn SOD is a dimeric metal protein composed of identical, non-covalently linked subunits, each with a molecular weight of 16,000 daltons, containing one atom of copper and one zinc (5). Each subunit consists of 153 amino acids sequenced (6, 7).

3 90353

The cDNA encoding human CuZn superoxide dismutase has been cloned (8). The complete sequence of the cloned DNA has also been determined (9). In particular, expression vectors containing DNA-encoding superoxide dismutase for the production and isolation of superoxide dismutase in bacteria have been described (24, 25). Expression of superoxide dismutase DNA as well as the production of SOD in yeast has also been reported (26).

Recently, the CuZn SOD gene locus has been characterized on human chromosome 21 (27), and recent developments regarding CuZn superoxide dismutase are summarized (28).

Significantly less is known about manganese superoxide dismutase (MnSOD) .E. The MnSOD of coli K-12 has recently been cloned and mapped (22). Barra et al. disclose a 196 amino acid amino acid sequence for an MnSOD polypeptide isolated from human liver cells (19). However, previous publications differ in the structure of the MnSOD molecule, whether it has two or four identical polypeptide subunits (19, 23). However, it is clear that the MnSOD polypeptide and the CuZn SOD polypeptide are not homologous (19). The homology of the amino acid sequences of MnSODs and FeSODs from different sources has also been compared (18).

Baret et al. disclose that in rats, the half-life of human MnSOD is substantially longer than the half-life of human Cu SOD; they also report that rat human MnSOD and rat Cu SOD are not effective as anti-inflammatory agents, whereas bovine Cu SOD and human Cu SOD are fully active (20).

McCord et al. publish information that naturally occurring human manganese superoxide dismutase protects human phagosy. . wish for strip-like (PMN) leukocytes from superoxide free radicals better than in bovine or porcine CuZn superoxide dismutase "in vitro" experiments (21).

4 SO 353

The invention relates to a polypeptide analog of human manganese superoxide dismutase comprising 199 amino acids having a methionine at the N-terminus in the sequence and having the particular sequence given in Figure 1. Barra et al., J. Biol. Chem., 259: 12595-12601; Further, Barra et al. does not suggest or even suggest that manganese superoxide dismutase with three additional amino acids could be an active enzyme. It should be noted that, with the exception of the additional N-terminal methionine of the present polypeptide, two other additional amino acids, Gly-Trp, are located in the center of the molecule.

The present polypeptide and reference to Barra et al. There are three differences between the polypeptide of the present invention in that the present polypeptide has a glutamic acid residue (Glu) at three sites, where Barra et al. represents the glutamine residue (Gin). Thus, there are six main differences between the present polypeptide and the reference by Barra et al. (namely, three additional amino acids and three different amino acids).

Reference Barra et al. does not disclose the particular amino acid sequence now disclosed, nor does it suggest that it could be expressed in bacteria, and it was certainly not obvious that, when so expressed, it would have been enzymatically active. In fact, Barra et al. does not even discuss the enzymatic activity of manganese superoxide dismutase of 196 amino acids. Thus, it would not be apparent to one skilled in the art that the present invention, in particular a specific polypeptide analog of superoxide didismutase comprising 199 amino acids, would be enzymatically active.

Reference Barra et al. on page 12598 states that "all manganese superoxide dismutases have 7 glycine residues at positions 76, 77, 94, 101, 112, 130, and 132 and 3 proline residues at positions 5, 165, and 170. All residues should be essential to maintain the secondary structure." We would like to emphasize that the two additional amino acids present in the present polypeptide are located at positions 122 and 123, which are located in Barra et al. in the middle of the indicated critical area. One of these two additional amino acids is the Glycine residue and Barra et al. recognizes that glycine residues are important for maintaining secondary structure. Reference Barra et al. these additional glycine residues do not exist in the sequence according to

In addition, we want to emphasize that the two changes of glutamic acid to glutamine are also in the middle of the molecule (residues 88 and 109) and these changes in amino acid sequence affect the molecular charge, which would also affect the folding of the polypeptide and thus the activity of the polypeptide.

It is well known in the art that an enzymatically active polypeptide is the result of the correct primary, secondary or tertiary structure. If either the primary, secondary, or tertiary structure changes, the enzymatic activity may change.

Thus, six changes in the amino acid sequence or "primary" structure of the present polypeptide (four of which are in the center of the molecule) could affect the secondary and tertiary (conformational) structure of the polypeptide. Thus, the enzymatic activity of the polypeptide could be altered. As discussed above, even reference Barra et al. suggests that amino acid residues that form the primary structure of naturally occurring hMbnSOD should be relevant for maintaining the secondary structure.

EP-A-138 111 discloses human Cu-Zn-super. . cloning and expression of roxide dismutase in E. coli and yeast. However, Cu-Zn superoxide dismutase is not related to MnSOD and there is no sequence homology between the two enzymes (see Barra et al., Page 12597). Thus, cloning and expression of the Cu-Zn-90 353 enzyme in no way teaches or suggests how to clone or express enzymatically active MnSOD.

The present invention relates to a plasmid for expressing a human manganese superoxide dismutase analog in a prokaryotic host cell.

The present invention further provides a method of producing an enzymatically active human MnSOD in bacteria and a method of recovering and purifying such an enzymatically active human MnSOD.

The present method also relates to the use of human manganese superoxide didismutase or analogs or mutants thereof to catalyze superoxide radicals to hydrogen peroxide and oxygen in molecular form. In particular, the present invention relates to the use of bacterial MnSOD or analogs or mutants thereof to reduce reperfusion injury following local anemia and to prolong the lifespan of dissected, isolated organs.

A DNA molecule containing a cDNA encoding a human manganese superoxide dismutase polypeptide or an analog or mutant thereof has been isolated from a human T cell library. The nucleotide sequence of a double-stranded DNA molecule encoding a human manganese superoxide dismutase polypeptide or an analog or mutant thereof has been found. The sequence of a single strand encoding a polypeptide or analog thereof is shown in Figure 1, from nucleotide 115 below the gene to nucleotide 708, inclusive. Other sequences encoding an analog or mutant may be approximately similar to the strand encoding the polypeptide. The nucleotide sequence of a single strand of a double-stranded DNA molecule, which encodes a 24 amino acid long peptide from nucleotides 43-114, including said nucleotides, is also shown in Figure 1.

A double-stranded cDNA or other double-stranded DNA molecule containing a nucleotide strand having a sequence encoding a human manganese superoxide dismutase polypeptide or an analog or mutant thereof may be included in a cloning vehicle such as a plasmid or virus. Each DNA molecule may be introduced into a cell, either a prokaryotic cell, e.g., a bacterial cell, or a eukaryotic cell, e.g., a yeast or mammalian cell, using known methods, including, but not limited to, cloning vehicles containing either molecule.

Preferably, the cDNA or DNA encoding the human manganese superoxide dismutase polypeptide or analog or mutant thereof is ligated into a plasmid, e.g., pMSE-4 or pMSARB4, and then introduced into a suitable host cell in which the DNA can be expressed and human manganese superoxide mutase, ) polypeptide::: or an analog or mutant thereof can be prepared. Preferred host cells include Escherichia coli, especially E. coli A4255 and E. coli A1645. Plasmid pMSE-4, E. coli strain: A4255, is deposited in the American Type Culture Collection under ATCC Accession No. 53250. Plasmid pMSARB4 can be obtained as shown in Figure 4 and as described in the description of the images.

Cells into which such DNA molecules have been introduced may be cultured or grown by methods known to those skilled in the art, under suitable conditions which allow transcription of the DNA into mRNA and expression of the mRNA as a protein. The resulting manganese superoxide dismutase protein can then be recovered.

8 90353

Veterinary and pharmaceutical compositions containing human MnSOD or analogs or mutants thereof, as well as suitable carriers, may also be prepared. This human manganese superoxide dismutase or its analogs or mutants can be used to catalyze the following reaction: 20 * · + 2H + -> H 2 O 2 -I-O 2 and thus can reduce cell inflammation caused by superoxide radicals.

More specifically, these enzymes, or analogs or mutants thereof, may be used to reduce inflammation caused by reperfusion following local anemia, to increase the lifespan of cut, isolated organs, or to treat inflammation.

The present invention relates to a process for the preparation of an enzymatically active human manganese superoxide dismutase or an analogue or mutant thereof in a bacterial cell. The bacterial cell contains a DNA sequence and is capable of expressing a DNA sequence encoding manganese superoxide dismutase or an analog or mutant thereof. The method involves maintaining the bacterial cell under suitable conditions as well as in a suitable preparation medium. The culture medium is supplemented with an amount of Mn ++ such that the concentration of Mn ++ available to the cell in the medium is greater than 2 ppm.

In a preferred embodiment of the present invention, the bacterial cell is an Escherichia coli containing a plasmid containing a DNA sequence encoding a human manganese superoxide dismutase polypeptide, for example pMSE-4 or pMS RB4 in E. coli strain A4255. The concentration of Mn ++ in the medium used for the preparation is about 50-1500 ppm, so that the concentration! 150-750 ppm are preferred.

9 90353

The present invention relates to a method for recovering manganese superoxide dismutase or an analogue thereof from bacterial cells containing said enzyme. The cells are first treated to recover a protein fraction containing proteins present in the cells, including human manganese superoxide dismutase or an analog or mutant thereof, and then the protein fraction is treated to recover human manganese superoxide dismutase or an analog or mutant thereof. In a preferred embodiment of the present patent, the cells are first treated to separate the soluble proteins from the insoluble proteins as well as the cell wall fragments, and the soluble proteins are recovered. The soluble proteins are then treated to separate the soluble proteins, e.g., by accompanying a fraction of soluble proteins containing hMnSOD or an analog or mutant thereof and a fraction containing hMnSOD or an analog or mutant thereof. The recovered fraction of soluble proteins is then treated to recover human manganese superoxide dismutase or an analog thereof.

A more preferred embodiment of the present invention relates to a method for obtaining human manganese superoxide dismutase or an analogue or mutant thereof from bacterial cells containing human manganese superoxide dismutase or an analogue or mutant thereof. The method first involves isolating the bacterial cells from the culture medium used and suspending them in a suitable solution having a pH of about 7.0-8.0. The cells are then disrupted and centrifuged, and the resulting supernatant is heated for about 30-120 minutes at 55-65 ° C, preferably 45-75 minutes at 58-62 ° C, and even more preferably for about one hour at 60 ° C, and then it is cooled to below 10 ° C, preferably to 4 ° C. Any precipitate formed must be removed by centrifugation, and the cooled supernatant is dialyzed against a suitable buffer, for example 2 mM potassium phosphate buffer, at a pH of about 7.8. Dialysis is preferably performed by ultrafiltration using a filter membrane smaller than 30K. The supernatant cooled simultaneously with or after dialysis may optionally be concentrated to a suitable volume, for example 0.03 of its original volume. The retained material is then eluted on an anion chromatography column with a suitably buffered solution, for example a solution of at least 20 millimolar relative to potassium phosphate and having a pH of about 7.8. Fractions of eluent containing superoxide dismutase are collected, pooled and dialyzed against about 40 mM potassium acetate at pH 5.5. The dialyzed combined fractions are then eluted through a cation exchange chromatography column using a linear gradient of about 40-200 millimolar to potassium acetate at a pH of about 5.5. Peak crystals containing superoxide dismutase are collected and combined. The combined peak fractions may then optionally be dialyzed against a suitable solution, e.g., water or a buffer solution, of about 10 millimolar relative to potassium phosphate and having a pH of about 7.8.

The present invention also relates to purified, enzymatically active human manganese superoxide dismutase or analogs thereof, e.g. met-hMnSOD, or mutants thereof prepared by the methods of the present invention.

The essential features of the invention are set out in the appended claims.

Figure 1. Sequence of human MnSQD CDNA

Figure 1 shows the nucleotide sequence of a single strand of a double-stranded DNA molecule encoding human manganese superoxide dismutase and the 198 amino acid sequence of human MnSOD corresponding to said DNA sequence. Figure 1 also shows a single strand of a double-stranded DNA molecule encoding a mature human MnSOD pre-peptide of 24 amino acids and an amino acid sequence corresponding to this DNA sequence. The figure also shows the 5 'and 3' sequences for which no translation is performed.

11 90353

Figure 2. Structure of pMSE-4: human MnSOD expression plasmid Plasmid pMS8-4, which contained MnSOD with an EcoRI (R-^) insert, was digested to completion with NdeI and NarI restriction enzymes. The large fragment was isolated and ligated with the synthetic oligomer as described in Figure 2. The resulting plasmid, pMS8-NN, contains the coding region for mature MnSODr preceded by the coding region ATG start codon. The above plasmid was digested with EcoRI, the terminals were complemented with a Klenow fragment of polymerase I, and further digested with NdeI. A small fragment containing the MnSOD gene was ligated into pSODs, 13, which were treated with NdeI and StulI. pSODet-13 may be obtained as described in co-pending U.S. Patent Application 644,245 and is incorporated herein by reference. This produced plasmid pMSE-4, which contained the MnSOD coding region, preceded by the ribosome binding site d1, and which was under the control of the promoter k PL. Plasmid pMSE-4 is deposited in the American Type Culture Collection under ATCC Accession No. 53250.

Figure 3. Effect of Mn ++ concentration on the activity of SOD produced in E. coli_

The map in Figure 3 shows the correlation between the specific activity of soluble recombinant MnSOD produced by E. coli strain A 4255, which contains plasmid pMSE-4, expressed in units / mg for both non-induction (32 ° C) and under induction (42 ° C) conditions, and the concentration of Mn ++ medium in the medium.

‘‘ Figure 4. Structure of pMSARB4: human MnSO 4 expression plasmid

The Tet expression vector, pARB, was prepared from pSODd ^ T-11 by complete EcoRI treatment, followed by partial digestion with BamHI restriction enzymes. pSOD / i ^ T-11 is deposited in the American Type Culture Collection (ATCC) under accession number 53468. The extracted plasmid was ligated with the following synthetic oligomer - · - 5 1 - AATTCCCGGGTCTAGATCT - 3 'V 3'- GGGCCCAGATCTAGACTAG - 5' 12 90 353 resulting in was pARB containing the Ϊ1 P ^ promoter Tor in.

The EcoRI fragment of the MnSODr expression plasmid pMSE-4, which contains the ribosome binding site d1 and the complete sequence encoding the mature enzyme, was inserted into the single EcoRI site of pARB. The resulting plasmid. pMSARB4 contains the MnSOD gene, which is under the control of ^ P, as well as RBS and confers resistance to tetracycline.

A double-stranded DNA molecule containing a cDNA encoding a human manganese superoxide dismutase polypeptide or an analog or mutant thereof has been isolated from a human T cell DNA library. A nucleotide sequence of a double-stranded DNA molecule encoding a human manganese superoxide dismutase polypeptide or an analog or mutant thereof has been discovered. The sequence of a single strand of a DNA molecule encoding a human manganese superoxide dismutase polypeptide or analog thereof is shown in Figure 1 and includes nucleotide numbers 115-708, inclusive. The sequence of a single strand encoding an hMnSOD analog or mutant is approximately similar to the strand encoding an hMnSOD polypeptide. Figure 1 also shows the peptide preceding human manganese superoxide dismutase. Nucleotides numbers 43-114, including said nucleotides, encode this peptide.

Methods for preparing cDNA and determining the sequence of DNA encoding a human manganese superoxide dismutase polypeptide, analog, or mutant thereof are known to those skilled in the art and will be described in more detail later herein. In particular, a DNA sequence encoding human manganese superoxide dismutase has now been discovered, and known synthetic methods can be used to prepare DNA molecules containing portions of this sequence.

Conventional cloning vehicles, such as plasmids, e.g., pBR322, viruses, or bacteriophages, e.g., can be modified or constructed using known methods to prepare new cloning vehicles that contain a cDNA encoding human manganese superoxide dismutase or polypeptide. Similarly, such cloning vehicles can be engineered or constructed to include DNA molecules having in one strand a segment having the sequence shown in Figure 1 for a human manganese superoxide dismutase polypeptide, or segments substantially similar thereto. can be prepared by a variety of methods, including enzymatic or chemical synthesis.

The resulting cloning vehicles are chemical entities that do not occur in nature and can be created by a modern technique described as recombinant DNA technology. The cloning vehicle is preferably a plasmid, for example pMSE-4 or pMS RB4. These cloning vehicles may be introduced into cells, either prokaryotic, e.g., bacterial cells (Escherichia coli, B. subtilis, etc.), or eukaryotic cells, e.g., yeast or mammalian cells, using methods known in the art, such as transformation, transfection, etc. thus comprising a cDNA encoding a human manganese superoxide dismutase polypeptide or a mutant or analog thereof, if the cDNA was present in the cloning vehicle, or cells containing DNA comprising a strand having all or part of a sequence for the human MnSOD polypeptide shown in the figure. or a similar sequence if such DNA was present in the cloning vehicle.

Escherichia coli cells are preferred host cells for the cloning vehicles of the present invention. The currently preferred auxotrophic strain of E. coli is A1645, stored in the American Type Culture Collection in Rockville, Maryland, USA, and containing plasmid pApoE-Ex2, ATCC Accession No. 39787. All the American i4 90353

The recordings in the Type Culture Collection referred to in this application were made in accordance with the Budapest Treaty, based on the text of the treaty "the International Recognition of the Deposit of Microorganisms".

A1645 was obtained from Al637 by selection for Gal + (ability to use galactose) as well as for loss of tetracycline resistance. It still contains phage λ: η components. Its phenotype is C600 r ~ m + gal + thr- leu- IacZ- bl (λοΙ857ΔΗ1ABamHl N +).

A1637 was obtained from C600 by transferring (inserting) a portion of the genome containing the gene for tetracycline resistance into the galactose operon and phage λ: η elements containing components for cl-repressor synthesis. C600 is available from the American Type Culture Collection, ATCC Accession No. 23724.

Phototropic strains of Escherichia coli that allow high levels of polypeptide expression even when grown in minimal medium are even more preferred hosts for expressing genes encoding manganese superoxide dismutase. Today, one preferred strain is A4255. Strain A4255, which contains plasmid pMSE-4, is deposited in the American Type Culture Collection under accession number 53250.

Emerging cells into which DNA encoding a human manganese superoxide dismutase polypeptide or analog or mutant thereof has been introduced may be processed when appropriately grown or cultured under appropriate conditions known to those skilled in the art so that the DNA directs the DNA. expression of the genetic information encoded by the hMnSOD polypeptide, for example, to direct the expression of the hMnSOD polypeptide or analog or mutant thereof, and the cell expresses the hMnSOD polypeptide or analog or mutant thereof, which can then be recovered.

is 90 3 53

Throughout this application, the term "superoxide dismutase" (SOD) refers to an enzyme or polypeptide that acts as a receptor for superoxide or oxygen-free radicals or that catalyzes the following mutation reaction: 2 ~ + 2H + ------> 02 + H 2 O 2

The term "manganese superoxide dismutase" (MnSOD) as used herein means the element manganese in all its chemical forms.

The term "human manganese superoxide dismutase polypeptide" as used in the present application means a polypeptide of 198 amino acids having a portion of the amino acid sequence shown in Figure 1: the N-terminus of the sequence is lysine encoded by nucleotides 115-1.17 of Figure 1, and the COOH-terminus of the sequence is encoded by nucleotides 706-708 of Figure 1.

The term "polynucleotide manganese complex" as used in the present application means a molecule comprising a human manganese superoxide dismutase polypeptide complexed with manganese in any chemical form having the enzymatic activity of a naturally occurring human manganese superoxide dismutase.

The term "human manganese superoxide dismutase" as used in the present application means a molecule comprising at least two human manganese superoxide dismutase polypeptides complexed with manganese in any chemical form and having polypeptide activity from a naturally occurring human manganese superoxide dismutase enzyme.

The term "human manganese superoxide dismutase polypeptide analog" as used in the present application means a polypeptide comprising a human manganese superoxide dismutase polypeptide having one or more additional amino acids attached at either or both ends.

16 90353

The term "polypeptide manganese complex analog" as used in the context of the present application means a molecule comprising a polypeptide manganese complex having a polypeptide moiety comprising one or more additional amino acids attached to either or both ends.

The term "human manganese superoxide dismutase analog" as used in the present application refers to a molecule comprising at least two polypeptides, at least one of which is an analog of a human manganese superoxide dismutase polypeptide, complexed with manganese in any of its chemical forms, and having a .

The term "human manganese superoxide dismutase polypeptide mutant" in the context of the present application means a polypeptide having an amino acid sequence substantially identical to, but different from, one or more amino acids of a human manganese superoxide dismutase polypeptide.

The term "polypeptide manganese complex mutant" refers to a molecule comprising a mutant complex of a human manganese superoxide dismutase polypeptide with manganese in one of its chemical forms, and having a complex with the enzymatic activity of manganese superoxide dismutase.

The term "human manganese superoxide dismutase mutant" as used in the present application means a molecule comprising at least two polypeptides, at least one of which is a mutant complex of a human manganese superoxide dismutase polypeptide with a manganese superoxide active moxanid

17,353,53 mutants of the hMnSOD polypeptide and hMnSODr included in the present invention can be prepared by mutating the DNA sequence of Figure 1 having the N-terminus of lysine encoded by nucleotides 115-117 and having the COOH terminus of the sequence. nucleotides 706-708.

Mutation of DNA can be performed by methods known to those skilled in the art, for example, the method described by Bauer et al. have reported in Gene 37: 73-81 (1985). The mutated sequence can be inserted (inserted) into appropriate expression vectors as described in the present application, which vectors are then introduced into the cells, which are then treated so that the mutated DNA directs the expression of hMnSOD polypeptide mutants and hMnSOD mutants.

Human manganese superoxide dismutase is assumed to be a protein having at least two, possibly four, identical subunits, each of about 198 amino acids in the sequence shown in Figure 1 for human manganese superoxide dismutase, with a lysine at the N-terminus of nucleotides 115-117 of Figure 1. encoded by and having the COOH terminus of the sequence is lysine encoded by nucleotides 706-708 of Figure 1.

Human MnSO 4 or analogs or mutants thereof may be prepared from cells into which DNA or cDNA encoding human manganese superoxide dismutase or analogs or mutants thereof has been introduced. This human MnSO 4 or its analogs or mutants may be used to catalyze the dismutation or monovalent reduction of the superoxide anion in the presence of protons to form hydrogen peroxide according to the following equation:, 0Li + human MnSOD „Λ 20 ^ i + 2H -> H 2 O 2 + 02

Veterinary and pharmaceutical compositions containing effective amounts of hMnSO 4 or one or more hMnSO analogs or mutants and a suitable carrier may also be prepared. Such carriers are well known to those skilled in the art. hMnSODra or an analogue or mutant thereof may be administered directly or in the form of a composition to an animal or human, for example, to treat inflammation or to reduce damage caused by oxygen-free radicals in reperfusion following anemia or transplantation. hMnSODra or an analog or mutant thereof may also be added directly or in the form of a composition to the perfusion medium of an isolated organ to reduce damage to the isolated organ caused by oxygen-free radicals during perfusion following organ detachment, thus prolonging organ life. In addition, hMnSODra or an analog or mutant thereof may be used to reduce neurological damage during post-anemic reperfusion and to treat bronchial and lung growth failure.

A method for producing an enzymatically active human manganese superoxide dismutase or an analogue or mutant thereof in a bacterial cell has also been invented. The bacterial cell contains a DNA sequence and is capable of expressing a DNA sequence encoding human manganese superoxide dismutase or an analog or mutant thereof. The method involves maintaining the bacterial cell under suitable conditions as well as in a suitable production medium. The preparation medium is supplemented with such

The X.L.

By the amount of Mn, that the concentration of Mn in the medium is greater than 2 ppm.

The bacterial cell can be any bacterium in which the DNA sequence encoding human manganese superoxide dismutase has been introduced by recombinant DNA techniques. The bacterium must be able to express the DNA sequence as well as produce a protein product.

Suitable conditions and the medium used for the preparation change according to the bacterium and the strain.

19 90353

The bacterial cell may contain a DNA sequence encoding a superoxide dismutase or analog within a vector DNA molecule, such as a plasmid. The vector or plasmid is constructed by recombinant DNA techniques to obtain a sequence encoding SOD inserted at an appropriate site in the molecule.

In a preferred embodiment of the present invention, the bacterial cell is an Escherichia coli cell. The preferred auxotrophic strain of E. coli is A1645. The preferred prototrophic strain of E. coli is A4255. The E. coli cell of the present invention contains a plasmid encoding human manganese superoxide dismutase or an analog or mutant thereof.

In a preferred embodiment of the present invention, the bacterial cell contains plasmid pMSE-4. The method for constructing this plasmid is described in the descriptions of the figures, and the plasmid itself is described in Example 2. This plasmid is deposited under ATCC Accession No. 43250.

In another preferred embodiment of the present invention, the bacterial cell contains plasmid pMSARB4. The method for constructing this plasmid is described in the legends of the figures; and the plasmid itself is described in Example 5. This plasmid may be constructed from pSOD / T-II stored in the

To the American Type Culture Collection under deposit number 53468.

In specific embodiments of the present invention, the enzymatically active human manganese superoxide dismutase analog is prepared by an E. coli strain A4255 cell containing plasmid pMSE-4 and an E. coli strain A4255 cell containing plasmid pMSARB4.

A suitable culture medium for the bacterial cell may be any type of acceptable medium, such as casein hydrolyzate or LB (Luria Broth) medium, the latter being preferred. Suitable growth conditions vary according to the E. coli strain and the plasmid contained therein, for example, E. coli A4255 containing plasmid pMSE-4 is induced at 42 ° C and maintained at the above temperature for about 1-5 hours. Suitable temperature, time, shaking, and aeration conditions for inoculation and culture to a suitable density prior to the production stage and to maintain the culture during the production phase may vary and are familiar to those skilled in the art.

The Mn ++ ion concentration of the medium required to produce enzymatically active MnSOD varies depending on the type of medium used.

In the LB-type medium, an Hn ++ ion concentration of 150 to 750 ppm has been found to be effective. It is preferred that the concentration of Mn ++ in recombinant media be about 50-1500 ppm.

The specific ingredients of suitable storage, culture, inoculation and production media may vary and will be familiar to those skilled in the art.

The present invention also relates to a method for recovering human manganese superoxide dismutase or an analogue or mutant thereof from bacterial cells containing said enzyme. First, the cells are treated to obtain a protein fraction containing proteins present in the cells, including human manganese superoxide dismutase or an analog or mutant thereof, and then the protein fraction is treated to obtain human manganese superoxide dismutase or an analog or mutant thereof.

In a preferred embodiment of the present invention, the cells are first treated to first separate the soluble proteins from the insoluble proteins as well as the cell fragments, and then the soluble proteins are recovered. The soluble proteins thus obtained are then treated to separate, for example, precipitate, a fraction of soluble proteins, 21 90353 containing human manganese superoxide dismutase or an analogue or mutant thereof, and the fraction is collected. The fraction is then treated separately to recover human manganese superoxidide disease or an analog or mutant thereof.

A more preferred embodiment of the present invention is described below. First, the bacterial cells are isolated from the production medium and slurried in a suitable solution having a pH of about 7.0 or 8.0. The cells are then fragmented and centrifuged. The resulting supernatant is heated for about 30-120 minutes at a temperature of about 55-65 ° C, preferably for 45-75 minutes at 58-62 ° C, and even more preferably for one hour at 60 ° C, then cooled to below 10 ° C. C, preferably to about 4 ° C. The precipitate formed during cooling is removed, e.g. by centrifugation, and then the cooled supernatant is dialyzed against a suitable buffer. The cooled supernatant is preferably dialyzed by ultrafiltration using a filter membrane smaller than 30K, preferably 10K. Suitable buffers include 2 mM potassium phosphate buffer at a pH of about 7.8. Simultaneously with this dialysis or after dialysis, the cooled supernatant may optionally be concentrated to a suitable volume, for example - 0.03 of the initial volume of supernatant has been found to be suitable. The retaining solution is then eluted by anion exchange chromatography; on a column with a suitably buffered solution, for example a solution of at least 20 millimoles of potassium phosphate: buffer having a pH of about 7.8. Fractions containing superoxide dismutase are pooled, pooled and dialyzed against about 40 mM potassium acetate at pH 5.5. The dialyzed, combined fractions are then eluted through a cation exchange chromatography column with a linear gradient of potassium acetate (KOAC) from about 40 mmol to about 200 mmol of potassium acetate and a pH of 5.5. The peak fractions containing superoxide dismutase are pooled and pooled. Optionally, the combined peak fractions may then be dialyzed against a suitable solution, for example a buffer solution of about 10 millimolar relative to potassium phosphate and having a pH of about 7.8.

The present invention also relates to a purified, e.g., substantially free of, other human constituents, human manganese superoxide dismutase, or analogs or mutants thereof, prepared by the methods of the present invention. In particular, the present invention relates to an analog of human manganese superoxide dismutase, the polypeptides of which have the amino acid sequence shown in Figure 1, the N-terminus of which is lysine encoded by nucleotides 115-117 of Figure 1, and the COOH-terminus of which is lysine encoded by nucleotides 706 of Figure 1. -708, and wherein the sequence has an additional methionine residue at the N-terminus (Met-hMnSOD). A preferred embodiment of the present invention relates to purified Met-hMnSOD having a specific activity of 3500 units / mg.

examples

The following examples are not intended to limit the scope of the invention and should not be construed as such. The present examples do not include details of conventional methods used to construct vectors, to export (insert) genes encoding polypeptides into such vector holes, or to transfer the resulting plasmids into a host. The examples also do not include a detailed description of conventional methods used to determine polypeptides produced by such host vector systems or used to determine the identity of such polypeptides by active staining of isoelectric focusing gels (IEFs). Such methods are well known to those skilled in the art and are described in several publications, including, for example, T. Maniatis, E.F. Fritsch and J. Sombrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1982).

23 90353 J.M. McCord and I. Fridovich, J. Biol. Chem. 244: 6049-55 (1969).

C. Beauchamp and I. Fridovich, Anal. Biochem. 44: 276-87 (1971).

Example 1

To identify MnSOD cDNA clones, mixed oligomer probes were synthesized according to the published amino acid sequence (18, 19).

5 'probe - 30 mer sequence AA, _ - aa „. (18, 19) - lb 24 5 '3'

TTGCATAATTTGTGCCTTAATGTGTGGTTC

T G T G

G G

31 probe - 32 mer sequence AA179 - AAlsg (18) 5 '3'

TCTGTTACGTTTTCCCAGTTTATTACGTTCCA G G G G

The 5 'probe, consisting of 30 nucleotides, corresponds to amino acids 15-24 of mature MnSOD. The 3 'probe, consisting of 32 nucleotides, corresponds to amino acids 179-189 of mature MnSOD. The 5 'probe is a mixed probe consisting of 36 different sequences, as indicated above. The 3 'probe is a mixture probe consisting of 16 different sequences, as indicated above. (When more than one nucleotide is labeled at a particular position, the DNA strand was synthesized using equimolar amounts of each labeled nucleotide to generate a mixture probe.) The 5 'probe was used to screen 300,000 plaques from a T cell cDNA library cloned into the T'gt-10 vector. . Hybridization to phage plaque replicas immobilized on nitrocellulose filters was performed by standard methods (Maniatis et al. Supra) except that hybridization was performed at 50 ° C, 8xSSC, for 16 hours. The filters were then washed at 50 ° C with 5xSSC and 0.1 silicon SDS 90353 24

Three positive plaques were isolated and designated Phi MS8, Phi MS1, and Phi MS1J.

DNA digestion products from Phi MS8 and Phi MS1 using EcoRI indicated that they both have cDNA inserts that are approximately 800 base pairs in length and hybridize to both the 5 'and 3' pathways. oligonucleotide probes. Phi MS1Jr had only a 450 bp cDNA insert that hybridized only to the 5 'terminal probe.

The EcoRI inserts of the three phage clones were subcloned into the EcoRI site of pBR322, yielding pMS8-4, pMS1-4, and pMS1J, respectively. Restriction analysis and hybridization to the 5 'and 3' oligonucleotide probes showed that both pMS8-4 and pMS1-4 have similar formulas. The following restriction map is derived for both plasmids, showing the 5 '-> 3' orientation.

5 '

Rl PvuII PvuII Seal BamI Stul Rl 1 i 1 l II l. The sequence of the cMS DNA insert of pMS8-4 is shown in Figure 1. The predicted amino acid sequence differs from the published amino acid sequence (19) ίΐ- -..... i - »i: τ '1 ~ - l —ro 100 200 300 400 500 600 700 800 in that Glu is detectable in place of Gln at three (3) positions (AA 42, 88, 108) and between AA10, there are two * 123-124 additional amino acids Gly and Trp. Sequence analysis of pMS1-4 and pMS1J revealed that three MnSOD clones had been independently derived and confirmed these differences from the published amino acid sequence.

The sequence above the N-terminal lysine of the mature MnSOD results in a 24 amino acid pre-peptide sequence.

25 90353

Example 2

D

Structure of pMSE-4: Amp human MnSOD expression plasmid The starting point for the structure of pMSE-4 is plasmid pMS8-4, obtained as described in Example 1. Plasmid pMS8-4, which contains the human MnSODr cDNA with an EcoRI insert, was completely digested with NdeI and NarI restriction enzymes. The large fragment was isolated and ligated with the synthetic oligomer as shown in Figure 2. The resulting plasmid, pMS8 ~ NN, contains the mature MnSODra coding region preceded by the ATG start codon. Said plasmid was digested with EcoRI, the ends were complemented with a Klenow fragment of polymerase I, and further digested with NdeI. A small fragment containing the MnSOD gene was inserted into pSOD 13 (insertion was performed) treated with NdeI and StuI. pSOD 13 may be obtained as described in co-pending U.S. Patent Application 644,245, which is incorporated herein by reference. This generated plasmid pMSE-4, which contained the MnSOD coding region, was preceded by the ribosome binding site d1 and was under the control of the hp promoter. Plasmid pMSE-4 is deposited in the American Type Culture Collection under ATCC Accession No. 53250. All methods used in the above preparations were those described by Maniatis, supra.

Example 3

Combination of human MnSOD expression

Plasmid pMSE-4 was introduced into Escherichia coli strain A4255 using known methods. E. coli strain 4255 containing pMSE-4 was then grown at 32 ° C in Luria broth medium (LB) containing ampicillin 100 g / ml to an optical density (OD) of 0.7 at 600 nmr. measured. Samples taken at various time intervals were electrophoretically separated on sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE). Gels showed an increase in human MnSOD levels up to 120 min post-induction, at which point recombinant MnSOD protein comprised 27% of total cellular proteins as determined by Coomassie blue-stained gel screening 26,905,353. 90 seconds of sonication of the samples in an N-375 sonicator and division of proteins into soluble (s) and insoluble fractions (p) by centrifugation at 10,000 x g for 5 minutes indicated that most of the recombinant MnSOD prepared was insoluble. The induced, soluble protein fraction contained only slightly more SOD activity than the induced counterpart, based on an assay performed by standard methods. See McCord et al., Supra. Apparently, the portion of MnSOD present in the soluble fraction is inactive.

This suggests that most of the human MnSOD prepared under the conditions described in this example is ineffective.

Example 4 + 4-

Effect of Mn in the medium on the solubility and activity of MnSOD_

The addition of Mn ++ at increasing concentrations up to 450 ppm to E. coli A4255 medium containing pMSE-4 before 2 hours of induction at 42 ° C had no adverse effect on human MnSOD. the overall yield. Analysis of soluble (s) as well as insoluble (p), sound-treated protein fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) showed increased solubility of the recombinant protein with increasing concentrations of Mn ++ (Table 1). Determination of SOD activity (see McCord et al., Supra) suggests that there is a correlation between increasing concentrations of Mn ++ in the medium and increased solubility of MnSOD, with a clear optimum concentration of Mn ++ in the medium of 150 ppm (Figure 3). In addition, increased concentrations of Mn ++ previously activated an inactive soluble enzyme. Soluble protein fractions of induced cultures grown using these concentrations of Mn ++ always show a 60-fold increase in SOD activity compared to soluble protein fractions obtained from non-induced cultures grown at these concentrations of Mn ++ 27,90353. Activity staining of isoelectric focusing gels (IEF) (see Beaucham et al., Supra) indicated that the multimodes of the combination MnSOD were similar to the multimodes of natural human MnSOD.

The results obtained for the preparation of human MnSOD by E. coli A1645 are similar to the results presented above.

table 1

Mn + Percent Percent Specific ak- (million soluble soluble solubility monocompounds) my country MnSOD my country MnSODra ropes / mg solubilized soluble protein total bacterial origin human s protein

Of MnSOD of which O 30.6 7.2 30 50 72.7 15.4 241 100 78.0 16.9 356 150 82.9 18.8 606 200 82.0 20.8 338 250 79.2 20, 4,380,300 80.8 20.3,381,450 89.2 22.4,323

Example 5 Structure of pMSARB4: Tet human MnSO 4 expression plasmid

The Tet expression plasmid pARB was prepared from pSOD ^ T-II by complete digestion with EcoRI, followed by partial digestion with BamHI restriction enzymes. pSOD ^ T-11 is deposited in the American Type Culture Collection under accession number 53468. The digested plasmid was ligated with a synthetic oligomer having the following structure: 5'-AATTCCCGGGTCTAGATCT-3 '3'-GGGCCCAGATCTAGACTAG-5' to give pARB, which contained the ^ P ^ promoter.

28 9 0 353

The MRISOD expression plasmid The EcoRI fragment of pMSE-4, which contained the dl ribosome binding site and the complete coding sequence of the mature enzyme, was inserted (inserted) into the only EcoRI site of pARB. The resulting plasmid pMSA RB4 contains the MnSOD gene, which is regulated by λ-Ρ, as well as dl RBS and confers resistance to tetracycline (Figure 4).

Example 6

Expression of human MnSQD from pMSARB 4

Plasmid pMSARB4 was introduced into Escherichia coli strain A4255 using known methods. Cultures were grown at 32 ° C in Luria broth (LB) containing various concentrations of Mn ++ until an optical density (OD) of 6.7 was reached in 600 others. Induction was performed at 42 ° C. Samples taken at various time intervals were electrophoresed by SDS-PAGE. The level of hMnSOD was always increased by an induction time of 120 minutes, at which time hMnSOD accounted for about 15% of the total cellular proteins, as determined by Coomassie Blue stained gel screening.

The induced MnSOD was soluble regardless of the Mn ++ concentration of the medium. This is in contrast to the findings obtained with the Amp plasmid pMSE-4. (See Example 4.) However, the maximum activity and expression level of SOD depended on the addition of Mn ++ (Table 2).

29 90353

Table 2

Expression of MnSOD in E. coli A4255 (pMSARB4)

Million- Percent sol- Specific activity in parts hMnSODra units / mg soluble

Mn ++ soluble bacterial proteins from tera proteins 42 ° 32 ° 42 ° O 10.9 8.0 23 50 19.8 8.0 227 100 16.0 8.0 241 200 17.0 10.0 278 300 16, 0 9.3 238

Example 7

Purification of Enzymatically Active Combination of Human MnSOD_ E. Colin strain A4255 with plasmid pMSARB4 was fermented in LB supplemented with 750 ppm Mn ++ at 32 ° C to an absorbance of 17.0 at 600 nm. Induction of human MnSOD expression was achieved by raising the temperature to 42 ° C for 2 hours, at which time the culture reached an A600 of 43.0. Cells were harvested by centrifugation and resuspended in 0.2 initial volumes in 50 mM potassium phosphate buffer, pH 7.8, containing 250 mM NaCl. The bacteria were fragmented to pass twice through Dynomill, centrifuged, and the cell pellets discarded. The supernatant was heated for one hour at 60 ° C, cooled to 4 ° C, and the clarified supernatant was concentrated to 0.03 of the original volume and dialyzed against 2 mM potassium phosphate buffer pH 7.8, Pelicon in an ultrafiltration apparatus equipped with a 10K membrane. The crude enzyme preparation was applied to a DE52 column, which was washed thoroughly with 2 mM potassium phosphate buffer, pH 7.8, and eluted with 20 mM potassium phosphate buffer, pH 7.8. The combined fractions containing the enzyme were dialyzed against 40 mM potassium acetate, pH 5.5, applied to a CM52 column and eluted with a linear gradient of 40-200 mM potassium acetate, pH 5.5. Peak fractions containing: human MnSODra were pooled, dialyzed against H 2 O, returned to 10 mM potassium phosphate buffer, pH 7.8, and frozen at -20 ° C.

The resulting combination of human MnSOD was more than 99% pure, with a specific activity of about 3500 units / mg. The overall yield of the purification method was about 30% (Table 3).

Sequencing of the purified enzyme indicates the presence of 1-methethionine at the N-terminal amino acid compared to known human MnSOD (19).

Analysis of the metal content by atomic absorption gave about 0.77 Μη atoms per enzyme subunit.

This is in line with published data (23).

90353 31 O ’

E

• H: ra H -P -P -H

λ:: 0

ro x r- r ~ - O cm O

-h i — i <J \ uo no O

c ui iH ro LO

(D .V M i — i cn ro C> 1

•B

cp tn • p 3 tn ρ -rt <L> CO 4-> a -h tn co>: ra S-i Q) en

•B

E

Cp: ra O ao O O ro - - - - - ro ^ O co ro co lo 4-> O cc co ro en

O «H <D

a-> tn e -h ro a 3

(OOcncN en r ~ cm P

coco * «'» · 3

m m oo in 'a * P

p Di ή m -p

en C

• h rt TO 3 s:

P -H

a -p ή

•B

ro C C id • -H <- <

O Q -H

o ra P

ϋ en -P -P

C3CO OO O ro cm 4-1 rP Σ P '' '' ~ φ

CO I Cl · Di O O r ~ -P

m en o cm cm en

E-f -ie -H Ή * P

• H rt TO

CC -C

ra o P

ra λ; a e o p x e -C o: ra tn e -y

i — t * P O

φ -P 'ro -P 4-4

U] C I -P

• h ra> i ra> i <d

TO -P -P TO C fH

sz ra »H o> ι ή

Oh cd) 3 4-1 -H

p 4J en * j E

el) -H · ρ ra: ra · η · η Op a 11) 41 P TO -PP> 1 co: ra -P -p -h -p -P en en * * «« ha rara -pi ra 3 ra ra e rH ra -P i ra 3 3 a):> p en ra e en ή tp <v -Hencotneua) -p .e E "PU <uenii o -p ouid-hcoocmcm> ra co anoera mmp> Op O 3 0) 3-hw ς <Q '* DtnaJ-v - tQtj * 32 90 353

References 1. McCord, J.M. and Fridovich, I., J. Biol. Chem. 244: 6049-55 (1969).

2. Fridovich, I. in Advances in Inorganic Biochemistry, editors Eichhorn, G.L. and Marzilli, L.G.

(Elsevier / North Holland, New York), ss. 67-90 (1979).

3. Freeman, B.A. and Crapo, J.D., Laboratory Investion 47: 412-26 (1982).

4. Steinman, H.M. in Superoxide Dismutase, edited by Oberley, L.W. (CRC Press, Florida), ss. 11-68 (1982).

5. Hartz, J.W. and Deutsch, H.F., J. Biol. Chem. 247: 7043-50 (1972).

6. Jabusch, J.R., Farb, D.L., Kerschensteiner, D.A. and Deutsch, H.F., Biochemistry 19: 2310-16 (1980).

7. Barra, D., Martini, F., Bannister, J.V., Schinina, M.W., Rotilio, W.H., Bannister, W.H. and Bossa, F., FEBS Letters 120: 53-56 (1980).

8. Lieman-Hurwitz, J., Daphne, N., Lavie, V., and Groner, Y., Proc. Natl. Acad. Sci. USA 79: 2808-11 (1982).

9. Sherman, L., Dafni, N., Lieman-Hurwitz, J. and Groner, Y., Proc. Natl. Acad. Sci. USA 80: 5465-69 (1983).

10. Oberley, L.W. and Buettner, G.R., Cancer Research 39: 1141-49 (1979).

11. Huber, W, and Menander-Huber, K.B., Clinics in Rheum. Dis. 6: 465-98 (1980).

12. McCord, J.M. and Roy, R.S., Can. J. Physiol. Pharma. 60: 1346-52 (1982).

33

SO 35 S

13. Alvarez, J.G. and Storey, B.T., Biol. Reprod. 28: 1129-36 (1983).

14. Talmasoff, J.M., Ono, T., and Cutler, R.G., Proc. Natl. Acad. Sci. USA 77: 2777-81 (1980).

15. Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J., J. Biol. Chem. 193: 265-75 (1951).

16. Weser, U. and Hartmann, H.J., FEBS Letters 17: 78-80 (1971).

17. Jewett, S.LO., Latrenta, G.S. and Beck, C.M., Arc. Biochem. Biophys. 215: 116-128 (1982).

18. Harris, J.I. and Steinman, H.M., Superoxide and Superoxide Dismutase, Michelson, A.M., McCord, J.M. and Fridovich, I. editors, Academic Press, London, p. 225-230 (1977).

19. Barra, D., Schinina, ME, Simmaco, M. (Bannister, JV, Bannister, WH, Rotilio, G and Bossa, F., J. Biol. Chem. 259: 12595-601 (October 25, 1984 ).

20. Baret, A., Jadot, G., and Michelson, A.M., Biochemical Pharmacology 33: 2755-60 (September 1, 1984).

21. McCord, J.M. and Salin, M.L., Movement, Metabolism and Bactericidal Mechanisms of Phagocytes, Ross, A., Patriarca, P.L., Romeo, D. (eds.) p. 257-264 (1977).

22. Touati, D., Journal of Bacteriology 155: 1078-87 (1983).

23. McCord, J.M., Boyle, J.A., Day, Jr., E.D., Rizzolo, L.J. and Salin, M.L., Superoxide and Superoxide Dismutase,

Michaelson, A.M., McCord, J.M., and Fridovich, I. (eds.) Academic Press, London p. 129-138 (1977).

24. European Patent Publication 0131843 A1, published January 23, 1985, corresponding to European Patent Application 84107717.5, filed July 3, 1984, which claims priority to U.S. Serial No. 514,188, filed July 15, 1983.

34 90 3 53 25. Hallewell, et al., Nucleic Acids Res. 5, (1985).

26. European Patent Publication 0138111 A1, published April 24, 1985, corresponding to European Patent Application 84111416.8, filed September 25, 1984, which claims priority to U.S. Serial No. 538,607, filed October 3, 1983, and U.S. Pat. serial number 609 412, filed May 11, 1984.

27. EMBO Journal, Part 4, no. 1, ss. 77-84 (January 1985).

28. Abstracts of the Fourth International Conference on Superoxide and Superoxide Dismutase, Rome, Italy, September 1-6. days 1985.

Claims (21)

1. Plasmid for expression in a suitable prokaryotic host cell of a human manganese superoxide dismutase analog showing the enzymatic activity of naturally occurring human manganese superoxide dismutase, characterized in that the analog comprises two or four non-covalently bound polypeptides, each of which comprises 199 amino acids, each polypeptide sequence presenting in its N-terminal methionine immediately adjacent to lysine encoded by nucleotides 115-117 of FIG. 1, and proceeds to lysine encoded by nucleotides 706-708 of FIG. 1, which is the COOH of the polypeptide. terminal, and that the plasmid comprises a DNA encoding such a polypeptide, and light regulatory elements arranged in the plasmid such that expression of the polypeptide and formation of the human manganese superoxide dismutase analog in the host cell is achieved. Plasmid according to claim 1, characterized in that it is pMSE-4 deposited in Escherichia coli strain A4255 under ATCC number 53250. Plasmid according to claim 1, characterized in that it is pMSARB4. 4. Prokaryotic host cell, characterized in that the plasmid of claim 1 is inserted therein. Host cell according to claim 4, characterized in that it is a cell of Escherichia coli strain A4255 containing a plasmid designated pMSE-4 deposited under ATCC number 53250. Host cell according to claim 4, characterized in that it is an Escherichia coli cell containing a plasmid designated pMSARB4. Process for the preparation of the human manganese superoxide dismutase analogue, characterized in that a host plasmid system according to claim 4 is grown under such conditions that the human manganese superoxide dismutase analog is formed and the analog thus formed is recovered. 41 90353 A process for producing an enzymatically active recombinant human manganese superoxide dismutase with a DNA sequence of Figure 1 containing nucleotides 115-708 having substantially the same amino acid sequence as and the biological activity of naturally occurring human manganese superoxide dismutase or its analog or mutant by culturing a bacterial cell culture in a production medium supplemented with a non-growth inhibitory amount of Mn ++, such that the concentration of Mn ++ in the medium is higher than 2 ppm during bacterial growth, which bacterial cells contain a plasmid containing a DNA encoding the human manganese superoxide dismutase analog and which cells can express this DNA encoding the human manganese superoxide dismutase analog, wherein culture is carried out under conditions such that DNA is expressed and the human manganese superoxide dismutase analog is formed in the bacterial cells, after which the enzymatically active analogously formed or the mutant is recovered. 9. A method according to claim 8, characterized in that the bacterial cells are Escherichia coli cells. The method of claim 8, characterized in that the plasmid contains DNA encoding a human manganese superoxide dismutase analog, which comprises two or four non-covalently linked identical polypeptides, each comprising 199 amino acids, each having a polypeptide sequence in its N-terminal methionine immediately adjacent to lysine encoded by nucleotides 115-117 in FIG. 1, and proceeds to lysine encoded by nucleotides 706-708 in FIG. Method according to claim 10, characterized in that the plasmid is pMSE-4 deposited in Escherichia coli strain A4255 under ATCC number 53250. 90 353 42 Method according to claim 10, characterized in that the plasmid is pMSARB4. Process according to claim 8, characterized in that the Mn ++ concentration is 50-1500 ppm. Method according to claim 9, characterized in that the Escherichia coli cells are cells of Escherichia coli strain A4255, containing a plasmid pMSE-4 and deposited under ATCC number 53250. Method according to claim 9, characterized in that the Escherichia coli cells are cells of Escherichia coli strain A4255, containing a plasmid pMSARB4. Method for catalyzing the following reaction: 202 '+ 2H + -► H202 + 02 characterized in that reagents are contacted with the human manganese superoxide dismutase or its analogue expressed with the plasmid of claim 1 under appropriate conditions. A method for reducing damage to cells in vitro caused by superoxide radicals, characterized in that reduction of superoxide radicals is catalyzed according to claim 16. A method for extending the survival period of withdrawn isolated organs, characterized in that an effective amount of human manganese superoxide dismutase is added to the perfusion medium of claim 1. A method of recovering recombinant human manganese superoxide dismutase comprising DNA sequence of Figure 1 containing nucleotides 115-708, or an analog or mutant thereof from bacterial cells containing human manganese superoxide dismutase or an analogue or mutant thereof, characterized by (a) treating the bacterial cells to recover a protein fraction containing the proteins contained in the cells including human manganese superoxide dismutase or the analog or mutant thereof; and (b) treating the protein fraction to recover human manganese superoxide dismutase or the analog or mutant thereof. The method of claim 19, characterized by (a) treating the cells for separation of soluble proteins and cell wall breakdown; (b) recovery of the soluble proteins; (c) treating the soluble proteins so obtained to separate a fraction of the soluble proteins containing human manganese superoxide dismutase or the analog or mutant thereof; (d) recovering the fraction of soluble proteins containing human manganese superoxide dismutase or the analog or mutant thereof; and (e) treating the fraction of soluble proteins containing human manganese superoxide dismutase or the analog or mutant thereof for separate recovery of human manganese superoxide dismutase or the analog or mutant thereof. The method of claim 19, characterized by (a) isolating the bacterial cells from the culture medium; (b) slurrying the isolated bacterial cells into a suitable solution having a pH of 7.0 - 8.0; (c) disruption of the slurried bacterial cells; (d) centrifuging the disrupted bacterial cells; (e) heating the obtained supernatant for a period ranging from 30 to 120 minutes at a temperature ranging from 55 ° C to 65 ° C; (f) cooling the heated supernatant to a temperature lower than 10 ° C; (g) removing any precipitate from the cooled supernatant; (H) dialysis of the cooled supernatant against a bulky buffer; (i) eluting the retained material on an anion exchange chromatography column with a suitable buffered solution; (j) collecting and aggregating fractions of eluted material containing human manganese superoxide dismutase or the analog or mutant thereof; (k) dialysis of the pooled fractions against 40 mM potassium acetate, pH 5.5; (l) eluting the dialyzed pooled fractions through a cation exchange chromatography column with a linear gradient of 40 - 200 mM potassium acetate, pH 5.5; and (m) collecting and pooling fractions of the eluate containing human manganese superoxide dismutase or the analog or mutant thereof.